ID: 915061520

View in Genome Browser
Species Human (GRCh38)
Location 1:153189850-153189872
Sequence TGTCTGCCCCTCCCAGGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915061520_915061523 1 Left 915061520 1:153189850-153189872 CCAACTCCTGGGAGGGGCAGACA No data
Right 915061523 1:153189874-153189896 TGCAGTTCCTAGCCATCTGTGGG No data
915061520_915061524 2 Left 915061520 1:153189850-153189872 CCAACTCCTGGGAGGGGCAGACA No data
Right 915061524 1:153189875-153189897 GCAGTTCCTAGCCATCTGTGGGG No data
915061520_915061529 28 Left 915061520 1:153189850-153189872 CCAACTCCTGGGAGGGGCAGACA No data
Right 915061529 1:153189901-153189923 CCCCACAAAAGCCTCCTGTAGGG No data
915061520_915061522 0 Left 915061520 1:153189850-153189872 CCAACTCCTGGGAGGGGCAGACA No data
Right 915061522 1:153189873-153189895 CTGCAGTTCCTAGCCATCTGTGG No data
915061520_915061527 27 Left 915061520 1:153189850-153189872 CCAACTCCTGGGAGGGGCAGACA No data
Right 915061527 1:153189900-153189922 GCCCCACAAAAGCCTCCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915061520 Original CRISPR TGTCTGCCCCTCCCAGGAGT TGG (reversed) Intergenic
No off target data available for this crispr