ID: 915061521

View in Genome Browser
Species Human (GRCh38)
Location 1:153189856-153189878
Sequence CTGCAGTGTCTGCCCCTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915061521_915061532 25 Left 915061521 1:153189856-153189878 CCTGGGAGGGGCAGACACTGCAG No data
Right 915061532 1:153189904-153189926 CACAAAAGCCTCCTGTAGGGTGG No data
915061521_915061524 -4 Left 915061521 1:153189856-153189878 CCTGGGAGGGGCAGACACTGCAG No data
Right 915061524 1:153189875-153189897 GCAGTTCCTAGCCATCTGTGGGG No data
915061521_915061523 -5 Left 915061521 1:153189856-153189878 CCTGGGAGGGGCAGACACTGCAG No data
Right 915061523 1:153189874-153189896 TGCAGTTCCTAGCCATCTGTGGG No data
915061521_915061533 26 Left 915061521 1:153189856-153189878 CCTGGGAGGGGCAGACACTGCAG No data
Right 915061533 1:153189905-153189927 ACAAAAGCCTCCTGTAGGGTGGG No data
915061521_915061522 -6 Left 915061521 1:153189856-153189878 CCTGGGAGGGGCAGACACTGCAG No data
Right 915061522 1:153189873-153189895 CTGCAGTTCCTAGCCATCTGTGG No data
915061521_915061529 22 Left 915061521 1:153189856-153189878 CCTGGGAGGGGCAGACACTGCAG No data
Right 915061529 1:153189901-153189923 CCCCACAAAAGCCTCCTGTAGGG No data
915061521_915061527 21 Left 915061521 1:153189856-153189878 CCTGGGAGGGGCAGACACTGCAG No data
Right 915061527 1:153189900-153189922 GCCCCACAAAAGCCTCCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915061521 Original CRISPR CTGCAGTGTCTGCCCCTCCC AGG (reversed) Intergenic