ID: 915061522

View in Genome Browser
Species Human (GRCh38)
Location 1:153189873-153189895
Sequence CTGCAGTTCCTAGCCATCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915061520_915061522 0 Left 915061520 1:153189850-153189872 CCAACTCCTGGGAGGGGCAGACA No data
Right 915061522 1:153189873-153189895 CTGCAGTTCCTAGCCATCTGTGG No data
915061521_915061522 -6 Left 915061521 1:153189856-153189878 CCTGGGAGGGGCAGACACTGCAG No data
Right 915061522 1:153189873-153189895 CTGCAGTTCCTAGCCATCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915061522 Original CRISPR CTGCAGTTCCTAGCCATCTG TGG Intergenic
No off target data available for this crispr