ID: 915061523

View in Genome Browser
Species Human (GRCh38)
Location 1:153189874-153189896
Sequence TGCAGTTCCTAGCCATCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915061520_915061523 1 Left 915061520 1:153189850-153189872 CCAACTCCTGGGAGGGGCAGACA No data
Right 915061523 1:153189874-153189896 TGCAGTTCCTAGCCATCTGTGGG No data
915061521_915061523 -5 Left 915061521 1:153189856-153189878 CCTGGGAGGGGCAGACACTGCAG No data
Right 915061523 1:153189874-153189896 TGCAGTTCCTAGCCATCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915061523 Original CRISPR TGCAGTTCCTAGCCATCTGT GGG Intergenic
No off target data available for this crispr