ID: 915061524

View in Genome Browser
Species Human (GRCh38)
Location 1:153189875-153189897
Sequence GCAGTTCCTAGCCATCTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915061521_915061524 -4 Left 915061521 1:153189856-153189878 CCTGGGAGGGGCAGACACTGCAG No data
Right 915061524 1:153189875-153189897 GCAGTTCCTAGCCATCTGTGGGG No data
915061520_915061524 2 Left 915061520 1:153189850-153189872 CCAACTCCTGGGAGGGGCAGACA No data
Right 915061524 1:153189875-153189897 GCAGTTCCTAGCCATCTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915061524 Original CRISPR GCAGTTCCTAGCCATCTGTG GGG Intergenic
No off target data available for this crispr