ID: 915061526

View in Genome Browser
Species Human (GRCh38)
Location 1:153189886-153189908
Sequence TTGTGGGGCTGCCCCACAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915061526_915061538 21 Left 915061526 1:153189886-153189908 CCATCTGTGGGGCAGCCCCACAA No data
Right 915061538 1:153189930-153189952 GTCTCAGGAGCGAGTGCAATGGG No data
915061526_915061527 -9 Left 915061526 1:153189886-153189908 CCATCTGTGGGGCAGCCCCACAA No data
Right 915061527 1:153189900-153189922 GCCCCACAAAAGCCTCCTGTAGG No data
915061526_915061532 -5 Left 915061526 1:153189886-153189908 CCATCTGTGGGGCAGCCCCACAA No data
Right 915061532 1:153189904-153189926 CACAAAAGCCTCCTGTAGGGTGG No data
915061526_915061537 20 Left 915061526 1:153189886-153189908 CCATCTGTGGGGCAGCCCCACAA No data
Right 915061537 1:153189929-153189951 AGTCTCAGGAGCGAGTGCAATGG No data
915061526_915061539 22 Left 915061526 1:153189886-153189908 CCATCTGTGGGGCAGCCCCACAA No data
Right 915061539 1:153189931-153189953 TCTCAGGAGCGAGTGCAATGGGG No data
915061526_915061533 -4 Left 915061526 1:153189886-153189908 CCATCTGTGGGGCAGCCCCACAA No data
Right 915061533 1:153189905-153189927 ACAAAAGCCTCCTGTAGGGTGGG No data
915061526_915061536 6 Left 915061526 1:153189886-153189908 CCATCTGTGGGGCAGCCCCACAA No data
Right 915061536 1:153189915-153189937 CCTGTAGGGTGGGCAGTCTCAGG No data
915061526_915061529 -8 Left 915061526 1:153189886-153189908 CCATCTGTGGGGCAGCCCCACAA No data
Right 915061529 1:153189901-153189923 CCCCACAAAAGCCTCCTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915061526 Original CRISPR TTGTGGGGCTGCCCCACAGA TGG (reversed) Intergenic
No off target data available for this crispr