ID: 915061527

View in Genome Browser
Species Human (GRCh38)
Location 1:153189900-153189922
Sequence GCCCCACAAAAGCCTCCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915061526_915061527 -9 Left 915061526 1:153189886-153189908 CCATCTGTGGGGCAGCCCCACAA No data
Right 915061527 1:153189900-153189922 GCCCCACAAAAGCCTCCTGTAGG No data
915061521_915061527 21 Left 915061521 1:153189856-153189878 CCTGGGAGGGGCAGACACTGCAG No data
Right 915061527 1:153189900-153189922 GCCCCACAAAAGCCTCCTGTAGG No data
915061520_915061527 27 Left 915061520 1:153189850-153189872 CCAACTCCTGGGAGGGGCAGACA No data
Right 915061527 1:153189900-153189922 GCCCCACAAAAGCCTCCTGTAGG No data
915061525_915061527 -4 Left 915061525 1:153189881-153189903 CCTAGCCATCTGTGGGGCAGCCC No data
Right 915061527 1:153189900-153189922 GCCCCACAAAAGCCTCCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915061527 Original CRISPR GCCCCACAAAAGCCTCCTGT AGG Intergenic
No off target data available for this crispr