ID: 915061529

View in Genome Browser
Species Human (GRCh38)
Location 1:153189901-153189923
Sequence CCCCACAAAAGCCTCCTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915061526_915061529 -8 Left 915061526 1:153189886-153189908 CCATCTGTGGGGCAGCCCCACAA No data
Right 915061529 1:153189901-153189923 CCCCACAAAAGCCTCCTGTAGGG No data
915061520_915061529 28 Left 915061520 1:153189850-153189872 CCAACTCCTGGGAGGGGCAGACA No data
Right 915061529 1:153189901-153189923 CCCCACAAAAGCCTCCTGTAGGG No data
915061521_915061529 22 Left 915061521 1:153189856-153189878 CCTGGGAGGGGCAGACACTGCAG No data
Right 915061529 1:153189901-153189923 CCCCACAAAAGCCTCCTGTAGGG No data
915061525_915061529 -3 Left 915061525 1:153189881-153189903 CCTAGCCATCTGTGGGGCAGCCC No data
Right 915061529 1:153189901-153189923 CCCCACAAAAGCCTCCTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915061529 Original CRISPR CCCCACAAAAGCCTCCTGTA GGG Intergenic
No off target data available for this crispr