ID: 915061532

View in Genome Browser
Species Human (GRCh38)
Location 1:153189904-153189926
Sequence CACAAAAGCCTCCTGTAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915061525_915061532 0 Left 915061525 1:153189881-153189903 CCTAGCCATCTGTGGGGCAGCCC No data
Right 915061532 1:153189904-153189926 CACAAAAGCCTCCTGTAGGGTGG No data
915061521_915061532 25 Left 915061521 1:153189856-153189878 CCTGGGAGGGGCAGACACTGCAG No data
Right 915061532 1:153189904-153189926 CACAAAAGCCTCCTGTAGGGTGG No data
915061526_915061532 -5 Left 915061526 1:153189886-153189908 CCATCTGTGGGGCAGCCCCACAA No data
Right 915061532 1:153189904-153189926 CACAAAAGCCTCCTGTAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915061532 Original CRISPR CACAAAAGCCTCCTGTAGGG TGG Intergenic
No off target data available for this crispr