ID: 915061574

View in Genome Browser
Species Human (GRCh38)
Location 1:153190192-153190214
Sequence CTGTATGAAGGGTGGGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 226}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915061574 Original CRISPR CTGTATGAAGGGTGGGAGAC AGG (reversed) Intergenic
901445399 1:9305175-9305197 CAGCATGAAGAGTGTGAGACGGG - Intronic
901816310 1:11795388-11795410 AAGTATTTAGGGTGGGAGACGGG - Intronic
904610673 1:31724586-31724608 GTGGATGAAGGGCTGGAGACTGG + Intergenic
905615165 1:39391962-39391984 CTGGAAGAAGAGTGGGAGAAGGG + Intronic
906057033 1:42925268-42925290 TTGTAAGAAGGGTGTGAGAAAGG - Intergenic
906311892 1:44760189-44760211 CTCTAGGAAGGGAGGGACACAGG - Intronic
907869923 1:58433647-58433669 CTGTGTGGAGGGGGGGAGGCGGG + Intronic
908016395 1:59841982-59842004 GAGTAAGAAGGGTGCGAGACAGG - Intronic
908339436 1:63161429-63161451 CTCTATGAAGGGCGTGAAACAGG - Intergenic
909524686 1:76609776-76609798 CTATATGAAGGAGGGGGGACAGG - Intronic
910736413 1:90462996-90463018 CTATCTGAAGGGTGGGAGTGAGG - Intergenic
911959188 1:104278055-104278077 CTGTCAGAAGGGTGGCAGACAGG + Intergenic
911971480 1:104443365-104443387 CTGTGTGAAAGGTGGGAGGGGGG - Intergenic
912223128 1:107700449-107700471 CTGTAAGCAGGGTGGGGGAAAGG - Intronic
912546566 1:110455574-110455596 CAGTATGAAGGGTGGCATACAGG - Intronic
912972147 1:114293672-114293694 CTGGAGGAAGGCTGGGAAACTGG - Intergenic
913610265 1:120503835-120503857 CTGAATGAAGCGTGGGGGGCTGG + Intergenic
914580925 1:149018404-149018426 CTGAATGAAGCGTGGGGGGCTGG - Intronic
915061574 1:153190192-153190214 CTGTATGAAGGGTGGGAGACAGG - Intergenic
916390734 1:164328223-164328245 CTATTTGAAGGGTGGGAGGAGGG + Intergenic
918464232 1:184805691-184805713 CTCTATGAAGGCTGGGACGCGGG + Intronic
919813194 1:201421826-201421848 GTGTGTGAAGGGTGGGAGGGAGG - Intronic
920337174 1:205252775-205252797 CATTTTGAAGGGTGGGAAACTGG - Intronic
920587363 1:207179698-207179720 CTGTCTGAAGGATGGGAGACTGG + Intergenic
923353892 1:233134624-233134646 AGGTAAGAAGGGAGGGAGACAGG + Intronic
923645629 1:235817711-235817733 CAGGATGGAGGGTGGGAGAAGGG + Intronic
924554650 1:245108123-245108145 CTGGGTGACGGGTGGGTGACGGG - Intronic
1063547505 10:6996695-6996717 GTTTATGTAGGGTGGGAGGCGGG - Intergenic
1064063358 10:12158800-12158822 CTGGAGGCAGGGTGGGAGATAGG - Intronic
1064304194 10:14150689-14150711 CTCTCTGAAGGGTGAGAGAAGGG - Intronic
1065006624 10:21386546-21386568 GAGAAAGAAGGGTGGGAGACAGG - Intergenic
1066048959 10:31618179-31618201 CTGCAGGAAGGGTGGGAGGTGGG - Intergenic
1069861823 10:71476231-71476253 CTGCATGAAGGGGTGGGGACGGG - Intronic
1071965329 10:90846023-90846045 CTGTGGGAAGGATGGGTGACAGG + Intronic
1072560723 10:96571296-96571318 CTGTATGAAGGGTAGAGGAGGGG - Intronic
1072625346 10:97107755-97107777 CTGTGAGTAGGGTGGAAGACAGG + Intronic
1075721082 10:124587889-124587911 CTGAATGCAGGTTGGGGGACAGG + Intronic
1076080328 10:127574600-127574622 GGGGATGAAGGGTGGAAGACAGG + Intergenic
1076526783 10:131117123-131117145 CTGTGTTCAGGGTGGGAGGCTGG + Intronic
1078224657 11:9380989-9381011 CTCTATGAAGGATGAGACACAGG + Intergenic
1081744916 11:45466161-45466183 CTATTTGAAGGGAGGGATACTGG + Intergenic
1083707490 11:64526308-64526330 GTGGATGAAGGGTGGGAGGAGGG - Intergenic
1084309925 11:68311156-68311178 CTGGATGCAGGGTGGAAGAAGGG + Intergenic
1084953786 11:72680744-72680766 CTGGGTGGAAGGTGGGAGACCGG + Intergenic
1086558532 11:88140619-88140641 CTGAAGGAAGAGTGAGAGACAGG + Intronic
1086793758 11:91073898-91073920 CTGTATGAACTGTGTGATACTGG - Intergenic
1088217584 11:107529801-107529823 CTGTATTAAAAGTAGGAGACAGG - Intronic
1088551284 11:111014733-111014755 CTTTAGGAAGGGTGGGAGGCAGG - Intergenic
1088989724 11:114942193-114942215 CTGTATTCAGTGTGAGAGACAGG - Intergenic
1090586532 11:128219287-128219309 AGGGATGAAGGGTTGGAGACAGG - Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1095370851 12:41465698-41465720 CTGGAGGAAGGGAGAGAGACTGG - Intronic
1095958297 12:47819044-47819066 CTGTGTGAGGGGTGGGGGACAGG - Intronic
1098199934 12:68043766-68043788 ATGAATGAAGGGTGGGGGATAGG - Intergenic
1101898393 12:108772438-108772460 CTGCATAAAGGGTGGGGGAGGGG + Intergenic
1103859406 12:124000203-124000225 TTGTCTGGAGGGTGGGAGAGTGG - Intronic
1104094948 12:125548544-125548566 GTGTGTGAAGGCTGAGAGACAGG + Intronic
1105947549 13:25202669-25202691 CTGAATGAAAAGTGGGAAACAGG + Intergenic
1106166168 13:27248431-27248453 CTGAAAGAAAGGTGGGAGAAAGG + Intergenic
1106580326 13:31012430-31012452 TTTTGTGAAGGGTGGGAGAAGGG + Intergenic
1107096658 13:36544874-36544896 CTGTATGCAGGGTTGGGGAGGGG + Intergenic
1108212567 13:48153034-48153056 CTGTTGGAAGGATGGGAGATGGG - Intergenic
1109433349 13:62266447-62266469 TTTTATGAAGCATGGGAGACTGG + Intergenic
1110485652 13:76038590-76038612 CTCAATGAAGGATGGGAGAATGG + Intergenic
1111713158 13:91843684-91843706 CTGTATGAAGAGTAGGTGGCTGG + Intronic
1114341013 14:21743992-21744014 GAGTCTGAAGGGTGGGAGAGTGG + Intergenic
1116122601 14:40739390-40739412 ACGTATCAAGGGTGGGAGATGGG - Intergenic
1116674253 14:47885191-47885213 CAGGAGGAAGGGTGGGAGGCAGG - Intergenic
1121312713 14:92943795-92943817 CTGTCTGCAGGGTGGGAAACTGG + Intronic
1121779172 14:96610820-96610842 TGATATGGAGGGTGGGAGACAGG + Intergenic
1122021976 14:98845570-98845592 ATGTTTGAAGAGAGGGAGACAGG + Intergenic
1125318802 15:38459709-38459731 CTGTACCAAGGGTGGGCGCCCGG + Intronic
1125485676 15:40109149-40109171 CTGTATTAGGTGTGGGAGAGGGG + Intergenic
1127257768 15:57306484-57306506 CTCTCTGAAGGCTGGGAGTCCGG - Intergenic
1129660145 15:77548820-77548842 CTGTGTGAAGGGTGGGGGAAGGG + Intergenic
1129675184 15:77629475-77629497 CTTTAGGAAGAGAGGGAGACTGG - Intronic
1130133250 15:81160959-81160981 CTTTGGGAAGGGTGGGAGAATGG + Intronic
1131317578 15:91353557-91353579 CTGTATGTTGGGTGAGAGAAAGG - Intergenic
1131423578 15:92327222-92327244 CTGCATGGAGGGTGGGTGGCAGG - Intergenic
1131557146 15:93409617-93409639 CTGAAAGTAGGGTGGGAGATTGG - Intergenic
1134562582 16:15223413-15223435 CTGAGTGAAGGTTGGGAGGCTGG - Intergenic
1134923122 16:18135040-18135062 CTGAGTGAAGGTTGGGAGGCTGG - Intergenic
1135951013 16:26914116-26914138 CTGAGTGAATGGTGGGAGAACGG + Intergenic
1137592332 16:49701260-49701282 GTGTGTGTAGGGTGGGGGACAGG + Intronic
1138624313 16:58237002-58237024 CGGGATGAAGGCTGGGAGGCAGG + Intronic
1143862460 17:9900829-9900851 CTGTTTGAAGGGTTGGACAGGGG - Intronic
1146021976 17:29287226-29287248 CTGTTTTAAGGTTGGGACACTGG + Exonic
1146916308 17:36680483-36680505 CTGGATGTGGGGTGGGAGAAGGG - Intergenic
1147357725 17:39910824-39910846 CTGTATGTGGGGTGGGGCACTGG - Intronic
1147449747 17:40496569-40496591 TTGTACGGAGGGTGGGAGGCAGG - Intronic
1152019450 17:77772785-77772807 CCTTGTGTAGGGTGGGAGACTGG + Intergenic
1157929691 18:51808107-51808129 CAGGATGAAGGGTGGGGCACTGG - Intergenic
1158037254 18:53048267-53048289 CTGAGTGGAGGGTGGGAGAAGGG - Intronic
1160159754 18:76462015-76462037 ATGTGGGAAGGGTGGGAGCCAGG - Intronic
1161217019 19:3099673-3099695 GGGGATGGAGGGTGGGAGACTGG - Intronic
1162289896 19:9771120-9771142 CTGGGGGAAGGGTGGGAGAAGGG - Intronic
1162490307 19:10987534-10987556 CTGGGTGAAAGGTGGGAGATGGG + Intronic
1163260221 19:16185188-16185210 CTGTGTGAAGAATGGGAGACCGG + Intergenic
1164096244 19:22012320-22012342 CAGTGGGAAGGGTGGGAGAGGGG - Intergenic
1164199465 19:23004641-23004663 CAGTGGGAAGGGTGGGAGAGGGG - Intergenic
1164729740 19:30494445-30494467 CTGTCTGAAGGGTGCGACAATGG + Intronic
1165176128 19:33931167-33931189 TTGTATGAAGAGTGGGCTACAGG + Intergenic
1166534256 19:43562296-43562318 CTGTATGGAAGGAGGGAGCCTGG + Intronic
1167438743 19:49496026-49496048 CTTTTTGAAGGGTGGGCGGCCGG - Intergenic
926390844 2:12390978-12391000 CTGCATGCAGGATGGGGGACTGG - Intergenic
926792029 2:16583723-16583745 CTCTTTGAAGTCTGGGAGACAGG - Intronic
927493675 2:23537732-23537754 CTGCATGTCGGGTGGGAAACTGG + Intronic
927697128 2:25246365-25246387 CTGTAAGGAGGGTGGGGGAAGGG - Intronic
931374183 2:61693428-61693450 CTGTATGATTTGGGGGAGACAGG + Intergenic
931448459 2:62347208-62347230 GAGAAAGAAGGGTGGGAGACAGG + Intergenic
931578291 2:63744034-63744056 ATGTATGAAGGGTGGGGGTGTGG + Intronic
934712013 2:96522528-96522550 CCGTATGAAGGCTGGGGGCCTGG + Intergenic
939725233 2:145711791-145711813 CTATATGCAGGGTGGCACACTGG + Intergenic
939789263 2:146551020-146551042 CTGAAACAAGGGTGGGAGATGGG - Intergenic
940649966 2:156432766-156432788 GTGTGTGAAGAGTGGGAGAGTGG + Intergenic
941725177 2:168852742-168852764 CTGTCTGAAGGGTGGGGAAAGGG - Intronic
946534858 2:220615924-220615946 CTGTATGAGGGGAATGAGACTGG - Intergenic
947670612 2:231933392-231933414 GAGTCTGCAGGGTGGGAGACAGG + Intergenic
948591208 2:239051617-239051639 GTGCATGAAGGCTTGGAGACGGG + Exonic
1170816545 20:19719424-19719446 CCTTAAGAAGGGTGGGAGATGGG + Intronic
1173471037 20:43323895-43323917 CTGTATGAAGCCTGGGGGCCGGG - Intergenic
1175815023 20:61878779-61878801 CTGTGTGCAAGGCGGGAGACAGG - Intronic
1175862083 20:62155936-62155958 CAGAATGAAAGGTGGAAGACTGG - Intronic
1176887248 21:14271649-14271671 TTTTATGAGGGGTGGGAGATTGG - Intergenic
1177196913 21:17912748-17912770 CTGGATCAGGGGTGGGAGGCAGG + Intronic
1177412555 21:20749245-20749267 CTGAGGGAAGGGTAGGAGACAGG - Intergenic
1178255861 21:31052019-31052041 CTGGATGAGGGTGGGGAGACAGG + Intergenic
1178381861 21:32116812-32116834 CTGCTAGAAGGGTGGGAGGCTGG - Intergenic
1180278804 22:10673504-10673526 CTGTCAGGGGGGTGGGAGACTGG - Intergenic
1181207430 22:21263535-21263557 CTGTCTGAAGGGTGGTGGGCTGG - Intergenic
1181760397 22:25054454-25054476 GTGTATGCAGGGTGGGAGGTGGG + Intronic
1181882856 22:25994983-25995005 ATGCTTGAAGGGTGGGTGACAGG + Intronic
1183774793 22:39956931-39956953 CTGAGTGAAGGGTGAGAGCCTGG - Intronic
1184742998 22:46439924-46439946 CTGTGTGAGGGGTGGGAGGGCGG - Intronic
1185347040 22:50314982-50315004 CTGGGTGAACGGTGGGAGAGCGG - Intronic
950962129 3:17118272-17118294 TGGCCTGAAGGGTGGGAGACAGG - Intergenic
951285030 3:20800357-20800379 GTGGATGAAGGGTGGCAGAAGGG + Intergenic
954881316 3:53837759-53837781 GTGTATGTAAGGTGGGAGGCCGG + Intronic
955531750 3:59880301-59880323 CTGGATGAAGGGAAGGAGCCAGG - Intronic
956179187 3:66501293-66501315 AGGTGTGAAGGGCGGGAGACTGG + Intergenic
958690479 3:97459578-97459600 CTGTATGTAGTTTTGGAGACAGG + Intronic
958707250 3:97671327-97671349 GTTCATGAAGGGTGGGGGACAGG + Intronic
964873251 3:161336484-161336506 CTGTATGGAGGGTTGCATACAGG + Intergenic
966288531 3:178326686-178326708 CTGAAGGAAGGGTGGGAAATAGG - Intergenic
966735949 3:183187279-183187301 CTGTAGTAAGGCTGGCAGACAGG + Intronic
967475016 3:189906574-189906596 CTGTATGAAGGCAGAGAAACTGG - Intergenic
969725483 4:8915768-8915790 AGGTATGGAGGGTGGGGGACGGG + Intergenic
973744697 4:53951700-53951722 AGGAATGAAGGGTGGGAGGCAGG + Intronic
976627884 4:87206590-87206612 CTGTAGAAATGGTGGGAGATGGG + Intronic
977853945 4:101865045-101865067 CAGGAAGAAGGGTTGGAGACAGG + Intronic
977978703 4:103297389-103297411 CTGGATGGAGGGTGGGAGGAGGG - Intergenic
978505429 4:109451221-109451243 CTGTATATAGAGAGGGAGACAGG + Intronic
978784237 4:112591720-112591742 CTGAATGAAGAGAGGGAGAAAGG - Intronic
978897609 4:113907937-113907959 CAGGATGGAGGGTGGGAGAAGGG + Intronic
979460889 4:120982075-120982097 CTGAATGAAGGTTAGGAAACTGG + Intergenic
979988653 4:127347254-127347276 CTGTATGAAGTGTGGGATTGTGG - Intergenic
980064252 4:128166403-128166425 CAGAATGAAAGGAGGGAGACAGG - Intronic
980902354 4:138916860-138916882 CAGTTTGAAGGGATGGAGACAGG - Intergenic
982213484 4:153060055-153060077 CTGTATGAGGGATGGGCCACTGG + Intergenic
983167013 4:164490353-164490375 TTGTATGAAGGGAGTGAAACCGG - Intergenic
983967653 4:173832600-173832622 CAGTAGGAAGGGTGAGAGAAGGG - Intergenic
984023578 4:174516484-174516506 GAGGATGAAGGGTGGGAGAAGGG + Intronic
985869659 5:2544255-2544277 CTTAATGAAGGGTGGGATAATGG + Intergenic
986243042 5:5978712-5978734 CTGTATCACGGGTGGGAGGCTGG - Intergenic
986767167 5:10938684-10938706 CTGCAGTAAGGGTTGGAGACAGG + Intergenic
987130807 5:14858256-14858278 CTGGGGGAAGGGTGGGAGGCGGG - Intronic
990866371 5:60384979-60385001 CTGTATGTATTCTGGGAGACAGG - Intronic
992310602 5:75495012-75495034 ATGTCTCAAGGGTGGGAGATAGG - Intronic
992488023 5:77214378-77214400 CTGTATGAATGGAGGGAAAACGG - Intronic
992529508 5:77640997-77641019 CTGTCTGGAGGGAGGGAGAAGGG + Intergenic
993497757 5:88627083-88627105 CTGTTTTAACAGTGGGAGACTGG + Intergenic
994624803 5:102205234-102205256 CTGTCTGGAGGGTGGGAGAAGGG + Intergenic
997350784 5:133230101-133230123 CTGTATGGTGGGTGGTACACCGG + Intronic
1001443590 5:171764707-171764729 CTACATGAAGGATGGGAGGCTGG - Intergenic
1001725180 5:173890500-173890522 ATGTGTGAAGGGTGGGGGATGGG - Exonic
1003023748 6:2534945-2534967 CTGTATGACTGGGGAGAGACCGG - Intergenic
1003962086 6:11218311-11218333 CTGAATGAAGGGTGGCAGTGAGG - Intronic
1004437088 6:15606637-15606659 CTGGATGAAGGTGGGGAGAGTGG - Intronic
1004700900 6:18078540-18078562 CTGTTTAAAGGGTGGGAAATGGG + Intergenic
1004893493 6:20124228-20124250 GTTTATGGAGGGTGGGAGAGAGG + Intronic
1006224018 6:32521423-32521445 CTGCGTGAAGGGTGGGTGCCAGG + Intronic
1007235984 6:40391896-40391918 CTGTGCGCAGGGTGGGAGAAGGG - Exonic
1007916905 6:45569531-45569553 CTGGATGGAGGGAGGGAGACTGG + Intronic
1008107854 6:47459881-47459903 CTTTATCAAGGGTGGGGGTCGGG - Intergenic
1011383061 6:86763526-86763548 CTGTAGGAATGGTGTGGGACAGG + Intergenic
1012146872 6:95695080-95695102 TTGTGTGGAGGGTGGGAGAAAGG - Intergenic
1012896697 6:104957320-104957342 GTCTAAGAAGGGTGGGAGAGGGG - Intronic
1013356635 6:109351086-109351108 ATGTAGGTAGGCTGGGAGACAGG - Intergenic
1014983325 6:127972056-127972078 CTGTAGAAAGGGTGGAAGTCTGG + Intronic
1015812734 6:137177474-137177496 GTGGATGAAGGGTGGGAGGGAGG - Intergenic
1015932630 6:138376664-138376686 ATGTATCAAGGGTGGGATACAGG + Intergenic
1017022657 6:150152729-150152751 CTGCAGTGAGGGTGGGAGACAGG - Intronic
1017270966 6:152504891-152504913 GTGTATGAGGGGTAGGTGACAGG - Intronic
1017687808 6:156930612-156930634 CTGTATGAAGAACGGAAGACTGG + Intronic
1018828093 6:167423066-167423088 CCGTGTGGAGGGTTGGAGACGGG - Intergenic
1019271745 7:153166-153188 CTGTATGAAGGGTGTGCACCAGG + Intergenic
1019704137 7:2489453-2489475 CTGGAGGAGGGGTGGGAGAAAGG + Intergenic
1019918933 7:4150636-4150658 CTGAATGTAGGGAGGGAGGCAGG + Intronic
1022031033 7:26492013-26492035 CAGTGAGGAGGGTGGGAGACAGG + Intergenic
1022463426 7:30633813-30633835 CTGTTTGAAGGGCAAGAGACTGG + Exonic
1027232233 7:76279551-76279573 CTCTGTGTAGGGAGGGAGACAGG + Intronic
1027682795 7:81241325-81241347 GAGAATGAGGGGTGGGAGACAGG - Intergenic
1028024573 7:85821241-85821263 GTGTGTGAAGGCTGGGAGCCAGG + Intergenic
1028596824 7:92554748-92554770 CTGTGGGAAGGGTGGGAGGAGGG - Intergenic
1028920593 7:96306408-96306430 CAGTAAGAAGGTTGGGAGAAGGG - Intronic
1029167462 7:98603001-98603023 CTGTATTGAGGGTGGGTGAGAGG + Intergenic
1029941554 7:104485767-104485789 CTGTCAGAGGGGTGGGAGGCTGG - Intronic
1030196207 7:106856027-106856049 CTGTCAGCAGGGAGGGAGACTGG - Intergenic
1031582101 7:123488592-123488614 GTGTATGTAGGGTGGAAGATGGG - Intronic
1032424697 7:131812996-131813018 CTGTATGAGGGGTGGCAAACTGG + Intergenic
1036056400 8:5259738-5259760 CCTTTTGAAGGGTGGGAGAAGGG + Intergenic
1039343998 8:36683965-36683987 CTTTAGGAAGAGTGGGAGAAAGG - Intergenic
1039384099 8:37116616-37116638 CAGTATGAAGGCTGGCACACTGG - Intergenic
1041233456 8:55775790-55775812 ATGAATGAAGGGTGGGGGAGGGG + Intronic
1042027845 8:64443106-64443128 CAGAATAAGGGGTGGGAGACAGG + Intergenic
1042793747 8:72637499-72637521 CTGTGTGTGGGCTGGGAGACGGG + Intronic
1047498976 8:125428137-125428159 GAGTATGAATGGTGGGAGGCCGG - Intergenic
1047663018 8:127059128-127059150 CTGTACAGAGGGTGGGTGACTGG - Intergenic
1048201763 8:132380585-132380607 GGGTGTGAAGGGTGGGAGATGGG - Intronic
1048632911 8:136263651-136263673 CTGGGTGAAGGGTACGAGACAGG + Intergenic
1051310762 9:15768499-15768521 ATGAAGGAAGGCTGGGAGACAGG - Intronic
1051960240 9:22751648-22751670 CAGAATGCAGGGTGGGAGAGAGG + Intergenic
1056292734 9:85160339-85160361 CTGCAGGGAGGGTGGGAGGCAGG - Intergenic
1056292874 9:85161310-85161332 CTGCAGGGAGGGTGGGAGGCAGG - Intergenic
1058743194 9:107965060-107965082 ATGACTGCAGGGTGGGAGACAGG - Intergenic
1060060429 9:120454772-120454794 CCGTCTGAAGGATGGGAGACTGG - Intronic
1060488619 9:124065519-124065541 CTGAATGGAGGGAGGGAGGCAGG + Intergenic
1060859373 9:126941494-126941516 AAGTAGGCAGGGTGGGAGACAGG - Intronic
1061160659 9:128892179-128892201 ATGCATGAAGGTTGGGAGATGGG + Intronic
1062170651 9:135133028-135133050 CAGTTTGAAGGGTGGGAAACCGG + Intergenic
1062302907 9:135885469-135885491 CTCTGTGCAGAGTGGGAGACGGG + Intronic
1186704375 X:12126505-12126527 CTGCAGGAAGGGTGAGAGAGAGG + Intergenic
1187154356 X:16710022-16710044 GAGTATGAGGGGTGAGAGACAGG - Intronic
1187410969 X:19050243-19050265 CTCTAGGAAGGGCTGGAGACTGG + Intronic
1187444219 X:19346198-19346220 CTCCATGAAGGGAGGGAGAAGGG + Intronic
1188437296 X:30175707-30175729 ATGTAGGAAGGCAGGGAGACAGG + Intergenic
1189230780 X:39450949-39450971 CAGGATGAAGGGTGGCAGGCCGG - Intergenic
1189856175 X:45227471-45227493 CTGTATGAAGTGTATGAGATGGG + Intergenic
1191670064 X:63740726-63740748 CTGAGTGAAGGGTGGGAAGCAGG - Intronic
1195320346 X:103716744-103716766 TTGTATTAGGGGTGTGAGACTGG + Intronic
1195820801 X:108943820-108943842 CTGTATGAAGGGTGAGGCACGGG + Intergenic
1200072360 X:153535524-153535546 CCGGAGGAAGGGTGGGAAACAGG - Intronic
1200539708 Y:4443301-4443323 CTATATGCAGTGTGGGAGAAAGG + Intergenic