ID: 915062625

View in Genome Browser
Species Human (GRCh38)
Location 1:153198813-153198835
Sequence TGGGATTCTCTATGCAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915062615_915062625 27 Left 915062615 1:153198763-153198785 CCAATGGATGTTAGTATTGGGAC No data
Right 915062625 1:153198813-153198835 TGGGATTCTCTATGCAGAGCTGG No data
915062620_915062625 5 Left 915062620 1:153198785-153198807 CCTAAAGCTCAGGGAAGAGGGTG No data
Right 915062625 1:153198813-153198835 TGGGATTCTCTATGCAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915062625 Original CRISPR TGGGATTCTCTATGCAGAGC TGG Intergenic
No off target data available for this crispr