ID: 915062696

View in Genome Browser
Species Human (GRCh38)
Location 1:153199382-153199404
Sequence TGGCCAACACCCAGCCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915062692_915062696 25 Left 915062692 1:153199334-153199356 CCATGCACAGCTAGACAAAGCAG No data
Right 915062696 1:153199382-153199404 TGGCCAACACCCAGCCAGCAGGG No data
915062693_915062696 -3 Left 915062693 1:153199362-153199384 CCTGTTATACTAAAGAACTGTGG No data
Right 915062696 1:153199382-153199404 TGGCCAACACCCAGCCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915062696 Original CRISPR TGGCCAACACCCAGCCAGCA GGG Intergenic
No off target data available for this crispr