ID: 915071487

View in Genome Browser
Species Human (GRCh38)
Location 1:153272546-153272568
Sequence GTCCCACTAGACCACAGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915071487_915071489 -8 Left 915071487 1:153272546-153272568 CCACCACTGTGGTCTAGTGGGAC No data
Right 915071489 1:153272561-153272583 AGTGGGACATGCCTGTACCATGG No data
915071487_915071490 1 Left 915071487 1:153272546-153272568 CCACCACTGTGGTCTAGTGGGAC No data
Right 915071490 1:153272570-153272592 TGCCTGTACCATGGTCCTTCTGG No data
915071487_915071495 19 Left 915071487 1:153272546-153272568 CCACCACTGTGGTCTAGTGGGAC No data
Right 915071495 1:153272588-153272610 TCTGGAACAAGCCTGGTCATTGG No data
915071487_915071496 28 Left 915071487 1:153272546-153272568 CCACCACTGTGGTCTAGTGGGAC No data
Right 915071496 1:153272597-153272619 AGCCTGGTCATTGGTTCTACTGG No data
915071487_915071493 12 Left 915071487 1:153272546-153272568 CCACCACTGTGGTCTAGTGGGAC No data
Right 915071493 1:153272581-153272603 TGGTCCTTCTGGAACAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915071487 Original CRISPR GTCCCACTAGACCACAGTGG TGG (reversed) Intergenic
No off target data available for this crispr