ID: 915071489

View in Genome Browser
Species Human (GRCh38)
Location 1:153272561-153272583
Sequence AGTGGGACATGCCTGTACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915071482_915071489 20 Left 915071482 1:153272518-153272540 CCTGAAGCTTGGGTGTGTTGGGG No data
Right 915071489 1:153272561-153272583 AGTGGGACATGCCTGTACCATGG No data
915071487_915071489 -8 Left 915071487 1:153272546-153272568 CCACCACTGTGGTCTAGTGGGAC No data
Right 915071489 1:153272561-153272583 AGTGGGACATGCCTGTACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915071489 Original CRISPR AGTGGGACATGCCTGTACCA TGG Intergenic
No off target data available for this crispr