ID: 915071490

View in Genome Browser
Species Human (GRCh38)
Location 1:153272570-153272592
Sequence TGCCTGTACCATGGTCCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915071487_915071490 1 Left 915071487 1:153272546-153272568 CCACCACTGTGGTCTAGTGGGAC No data
Right 915071490 1:153272570-153272592 TGCCTGTACCATGGTCCTTCTGG No data
915071482_915071490 29 Left 915071482 1:153272518-153272540 CCTGAAGCTTGGGTGTGTTGGGG No data
Right 915071490 1:153272570-153272592 TGCCTGTACCATGGTCCTTCTGG No data
915071488_915071490 -2 Left 915071488 1:153272549-153272571 CCACTGTGGTCTAGTGGGACATG No data
Right 915071490 1:153272570-153272592 TGCCTGTACCATGGTCCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915071490 Original CRISPR TGCCTGTACCATGGTCCTTC TGG Intergenic
No off target data available for this crispr