ID: 915071493

View in Genome Browser
Species Human (GRCh38)
Location 1:153272581-153272603
Sequence TGGTCCTTCTGGAACAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915071488_915071493 9 Left 915071488 1:153272549-153272571 CCACTGTGGTCTAGTGGGACATG No data
Right 915071493 1:153272581-153272603 TGGTCCTTCTGGAACAAGCCTGG No data
915071487_915071493 12 Left 915071487 1:153272546-153272568 CCACCACTGTGGTCTAGTGGGAC No data
Right 915071493 1:153272581-153272603 TGGTCCTTCTGGAACAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915071493 Original CRISPR TGGTCCTTCTGGAACAAGCC TGG Intergenic
No off target data available for this crispr