ID: 915071496

View in Genome Browser
Species Human (GRCh38)
Location 1:153272597-153272619
Sequence AGCCTGGTCATTGGTTCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915071491_915071496 2 Left 915071491 1:153272572-153272594 CCTGTACCATGGTCCTTCTGGAA No data
Right 915071496 1:153272597-153272619 AGCCTGGTCATTGGTTCTACTGG No data
915071488_915071496 25 Left 915071488 1:153272549-153272571 CCACTGTGGTCTAGTGGGACATG No data
Right 915071496 1:153272597-153272619 AGCCTGGTCATTGGTTCTACTGG No data
915071487_915071496 28 Left 915071487 1:153272546-153272568 CCACCACTGTGGTCTAGTGGGAC No data
Right 915071496 1:153272597-153272619 AGCCTGGTCATTGGTTCTACTGG No data
915071492_915071496 -4 Left 915071492 1:153272578-153272600 CCATGGTCCTTCTGGAACAAGCC No data
Right 915071496 1:153272597-153272619 AGCCTGGTCATTGGTTCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915071496 Original CRISPR AGCCTGGTCATTGGTTCTAC TGG Intergenic
No off target data available for this crispr