ID: 915072426

View in Genome Browser
Species Human (GRCh38)
Location 1:153281617-153281639
Sequence TTGGATGTGGATGAAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915072418_915072426 15 Left 915072418 1:153281579-153281601 CCAAAGTATAAGTGCTGAGCTGG No data
Right 915072426 1:153281617-153281639 TTGGATGTGGATGAAGAGGAAGG No data
915072416_915072426 25 Left 915072416 1:153281569-153281591 CCATCCACATCCAAAGTATAAGT No data
Right 915072426 1:153281617-153281639 TTGGATGTGGATGAAGAGGAAGG No data
915072417_915072426 21 Left 915072417 1:153281573-153281595 CCACATCCAAAGTATAAGTGCTG No data
Right 915072426 1:153281617-153281639 TTGGATGTGGATGAAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915072426 Original CRISPR TTGGATGTGGATGAAGAGGA AGG Intergenic
No off target data available for this crispr