ID: 915074288

View in Genome Browser
Species Human (GRCh38)
Location 1:153296134-153296156
Sequence GAGAATTCCCTTCCCTCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 672
Summary {0: 1, 1: 3, 2: 68, 3: 157, 4: 443}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915074281_915074288 19 Left 915074281 1:153296092-153296114 CCCTGTAAAGCTGTCTCTTGTGG 0: 4
1: 111
2: 233
3: 333
4: 492
Right 915074288 1:153296134-153296156 GAGAATTCCCTTCCCTCTCCAGG 0: 1
1: 3
2: 68
3: 157
4: 443
915074283_915074288 18 Left 915074283 1:153296093-153296115 CCTGTAAAGCTGTCTCTTGTGGG 0: 5
1: 124
2: 219
3: 323
4: 521
Right 915074288 1:153296134-153296156 GAGAATTCCCTTCCCTCTCCAGG 0: 1
1: 3
2: 68
3: 157
4: 443

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915074288 Original CRISPR GAGAATTCCCTTCCCTCTCC AGG Intergenic
900135457 1:1115511-1115533 GAGAACCCCCTCCCCTCCCCAGG + Intronic
900849284 1:5129720-5129742 GAGAATTCCATTTGCTCTCATGG - Intergenic
901210815 1:7525100-7525122 GAGACTTGCATCCCCTCTCCAGG + Intronic
902219671 1:14957109-14957131 GAGTCTTTCCTTCTCTCTCCTGG + Intronic
903268806 1:22175018-22175040 CAGAATTTCCTTCCTTCTCAAGG - Intergenic
903309527 1:22443659-22443681 GAGAATCTCCTTCCCTTTCTAGG - Intergenic
904293310 1:29501550-29501572 GAGAATTCCTTTCCCTTTCCAGG - Intergenic
904322179 1:29705181-29705203 GAGATGTCCCTTCCCACCCCTGG + Intergenic
904323127 1:29709521-29709543 GTGAGTCCCCTTCCCTCTCTGGG + Intergenic
904479653 1:30785927-30785949 GACAATTCCCTCCCCTCTCAAGG + Intergenic
904809758 1:33155714-33155736 GAGAATTCACTTCTCTATCCAGG + Intronic
905920531 1:41715985-41716007 CAGATTTCCCTGCCCACTCCAGG - Intronic
905976055 1:42174637-42174659 GAGCAGACCCTTCCCTCTCTGGG + Intergenic
907173148 1:52490948-52490970 GCGAAATCTCTTACCTCTCCTGG + Intronic
907948240 1:59155357-59155379 GAGTTTTCCCTCTCCTCTCCTGG - Intergenic
908095216 1:60730479-60730501 GAGATTCCCCTTACCTTTCCAGG + Intergenic
908239617 1:62177769-62177791 GAGAATCACCTTCCCTTTCCAGG + Intergenic
908662108 1:66447973-66447995 GAGAATCCCCTTCCCTTTCCAGG + Intergenic
908817904 1:68052413-68052435 GACAATCTCCTTCCCTTTCCAGG + Intergenic
908898823 1:68932048-68932070 AGGAATTGCCTTCCCACTCCAGG + Intergenic
909194941 1:72607416-72607438 GAGAATCCCCTTCCCTTCCCAGG + Intergenic
909199867 1:72677442-72677464 CAGAATCCCCTTCCCTTTCCAGG - Intergenic
909259221 1:73465406-73465428 GATATTTCCCTTTCCTTTCCAGG - Intergenic
909440401 1:75689988-75690010 GAGACTCCCATTCCCTTTCCAGG + Intergenic
909474106 1:76062838-76062860 GAGAACTCCTTTCCCTTTCCAGG - Intergenic
909590098 1:77338628-77338650 GATCATACTCTTCCCTCTCCAGG - Intronic
911407637 1:97462784-97462806 GAGAATCCCCTTCCTTTTCCAGG + Intronic
913173610 1:116254457-116254479 GAGAATCCCCTTCCCTTTCCAGG + Intergenic
915074288 1:153296134-153296156 GAGAATTCCCTTCCCTCTCCAGG + Intergenic
915579242 1:156803626-156803648 GAGAAATGCCCTCCCCCTCCTGG + Intergenic
915642714 1:157241585-157241607 GAGAACCCCCTTCCCTTTCCAGG + Intergenic
915708346 1:157868958-157868980 GAGAATCCCCTTCCTGATCCAGG - Intronic
916145106 1:161731319-161731341 GAGAATCCTCTTCCCTCTCCAGG + Intergenic
916715562 1:167444077-167444099 GACAAGTCACTTCCCTCTCTGGG + Intronic
916749861 1:167714242-167714264 GGGTATTCCCTTCCCTCGCTCGG + Intergenic
917257657 1:173132864-173132886 GAGAATCCCCTTCCCTTTCTAGG + Intergenic
917410017 1:174749783-174749805 GAGGATTCCCTTCTCTTTCCAGG - Intronic
917479269 1:175396843-175396865 GAGGATTGCCTTCCCCATCCTGG + Intronic
918233530 1:182557227-182557249 GAGTCTTCCCTTCCCTATCAGGG + Intronic
919358708 1:196562114-196562136 GAGAATTCCATTCCCTTTCCAGG - Intronic
919933391 1:202236068-202236090 CAGCTTTCCCTTCCCTCTGCAGG + Intronic
920513988 1:206570725-206570747 CAGAATTTCCTTCCCTTTCAAGG + Intronic
920893666 1:210020977-210020999 AAAAATTCCCTCCCCTCACCTGG - Intronic
920939977 1:210473075-210473097 GAGAATCCCCTTCCCTTTCCAGG - Intronic
921056535 1:211546897-211546919 GACACTGCCCTCCCCTCTCCTGG + Intergenic
922047941 1:221964935-221964957 GAGAATCCCCTTCCCTTTCCAGG + Intergenic
922075179 1:222236450-222236472 GAGAATCCTCTTCCCTTTCCAGG - Intergenic
922166534 1:223120152-223120174 GAGAATCCCCTTCCCTTTCCAGG + Intronic
922255821 1:223892093-223892115 GAGCATCCCCTTCCCTCATCTGG - Intergenic
922276470 1:224083398-224083420 GAGAATCCTCTTCTCTTTCCAGG + Intergenic
922427142 1:225509268-225509290 GACCGTTCCCTTCCCTGTCCCGG - Intronic
922929468 1:229377490-229377512 GAGACTTCCCTTCTCCCTGCAGG - Intergenic
923328770 1:232903240-232903262 GAGAATCTCTTTCCCTTTCCAGG - Intergenic
923384534 1:233453429-233453451 AAGAATCCCCTTCCCTTTCCAGG + Intergenic
923556670 1:235006339-235006361 GAGAATTTCCTTCCTTTTCAAGG - Intergenic
923764381 1:236879587-236879609 CACAATTCTCCTCCCTCTCCAGG + Intronic
923902466 1:238342129-238342151 CAGAATTCCCTTCCTTCTTAAGG + Intergenic
924573212 1:245256923-245256945 GAGAATCTCCTTCCCTTCCCAGG + Intronic
924852395 1:247843567-247843589 GAGAATCCCTTTCCCTCTCCAGG + Intergenic
1062788439 10:284939-284961 CAGAATTCTCTTCCCTCTGAGGG - Intronic
1062803612 10:398140-398162 GACAATCTCCTTCCCTTTCCAGG + Intronic
1063102707 10:2964287-2964309 GAGAACCCCCTTCCCTTTCCAGG + Intergenic
1064081021 10:12308123-12308145 ATGAGTTCCTTTCCCTCTCCAGG + Intergenic
1064184847 10:13152714-13152736 GAGAATCCCCTTCCCTTTCCAGG + Intergenic
1064359325 10:14649357-14649379 GAGAATTCCCTTTCCTTTCCAGG + Intronic
1064500526 10:15967208-15967230 GAGAAGTCCGTTCAGTCTCCTGG + Intergenic
1064520234 10:16193307-16193329 GAGAACACCCTTCCCTTTCCAGG + Intergenic
1064619759 10:17202856-17202878 GAGACTCCCTTTCCCTTTCCAGG - Intergenic
1064829958 10:19452177-19452199 GAGAAATTCCTTTCCTCTCAAGG + Intronic
1065154456 10:22855155-22855177 TATACTTCACTTCCCTCTCCTGG + Intergenic
1065265577 10:23971739-23971761 GAGAATCCCCTTCCCTTCCCAGG + Intronic
1066039279 10:31529956-31529978 TAGAATTCACTTCCCTTTCTAGG + Intergenic
1066192924 10:33072295-33072317 GAGAATCCTCTTCCCTTTCTAGG + Intergenic
1067382685 10:45789368-45789390 AACAAATCCCTTTCCTCTCCTGG + Exonic
1067399253 10:45955985-45956007 GAGAATCCCCTTCCCTTTCCAGG + Intergenic
1067867572 10:49925201-49925223 GAGAATCCCCTTCCCTTTCCAGG + Intronic
1067890387 10:50129916-50129938 AACAAATCCCTTTCCTCTCCTGG + Exonic
1067935780 10:50611194-50611216 GTTGATTCCCTTTCCTCTCCTGG - Intronic
1068483636 10:57628068-57628090 GAGAATCCCCTTCCCTTTCCAGG - Intergenic
1069248741 10:66243299-66243321 GAGAATTCTCTTCCCTTTCCAGG + Intronic
1070298584 10:75186242-75186264 GAGATTCCCCTCCCTTCTCCAGG + Intergenic
1070450492 10:76552824-76552846 AAGAATTCCCTTCCCTGGACTGG + Intronic
1071036402 10:81251872-81251894 GAAAACCCCCTTCCCTTTCCAGG + Intergenic
1071274407 10:84039831-84039853 CAGAATCCCTTTCCCTTTCCAGG - Intergenic
1071404091 10:85311954-85311976 GAGTATTGGCTTCCCTCTTCTGG - Intergenic
1071922922 10:90371736-90371758 GGGAATTCCCTTTCCTAGCCAGG - Intergenic
1072689765 10:97564394-97564416 CAGAATCCCGTTCCCTTTCCAGG + Intronic
1072700215 10:97635148-97635170 GAAAATCCCCTTCCCTTTCCAGG - Intronic
1073396052 10:103218484-103218506 GAGAATCCCTTTCCTTTTCCAGG - Intergenic
1073541646 10:104320107-104320129 CAGAATCTCCTTCCCTTTCCAGG + Intronic
1073541654 10:104320180-104320202 CAGAATTTCCTTCCCTTTCCAGG + Intronic
1073561042 10:104497183-104497205 GAGAATCCCCTTTCCTTTCCAGG - Intergenic
1074141043 10:110672686-110672708 GAAAGTTGCCTTCCCACTCCAGG - Intronic
1074505505 10:114066982-114067004 GTGAAGGCCCTTCCCTCTCTGGG - Intergenic
1074716158 10:116221400-116221422 GTGAATTCTCTTCTCTCTCTGGG - Intronic
1074997592 10:118771182-118771204 GAGAATCCCCTTCCTTTTTCAGG + Intergenic
1075853766 10:125610125-125610147 GAGAATTCCCTGCCCCTTCCCGG + Intronic
1076517257 10:131053517-131053539 AAGAATCCCCTTCCCTTTCTAGG + Intergenic
1076732329 10:132444980-132445002 AATAATTCAGTTCCCTCTCCTGG + Intronic
1076935450 10:133565648-133565670 GAGAATTACCTCACATCTCCAGG - Intronic
1076997445 11:305218-305240 GAGAATCTCCTTCCCTTTCTAGG - Intergenic
1077409701 11:2397976-2397998 GAGAATCCCCCTCCCTTTCCAGG - Intergenic
1080163629 11:29210448-29210470 GAGAATTTCCATTCCTTTCCAGG - Intergenic
1080689387 11:34543679-34543701 GAGCTTTGTCTTCCCTCTCCAGG - Intergenic
1080709992 11:34737726-34737748 GAGAACTCCCTCCCCTAGCCAGG + Intergenic
1080823997 11:35832601-35832623 GAGAGCTCCCTTACCTCTTCTGG + Intergenic
1080881721 11:36327559-36327581 GAGAATCCTCTTCCCTTTCCAGG + Intronic
1081154075 11:39667507-39667529 GAGAATCCCCTTCCCTTTTCAGG + Intergenic
1083389749 11:62339104-62339126 GAGAATCCCCTTCCTTTTCTAGG - Intronic
1083682341 11:64357409-64357431 GAGAACCCCCTGCCCTGTCCAGG + Exonic
1083955607 11:65981403-65981425 GAGACTTCCCTTCTCTGCCCTGG + Intergenic
1084025871 11:66449106-66449128 GAGAATCTCCTTCCTTTTCCGGG + Intronic
1084175793 11:67421449-67421471 GAGGACTCCCTGCCCTCCCCAGG - Intronic
1084191662 11:67502198-67502220 GAGAAGTCCCAGCCCTCTCCAGG - Intronic
1086203845 11:84234887-84234909 GAAAATCCCCTCCCCTTTCCAGG + Intronic
1086450372 11:86909508-86909530 GGCAAGTCACTTCCCTCTCCGGG - Intronic
1086751954 11:90507410-90507432 GAGAATCTCCTTCCCTTTCCAGG - Intergenic
1087127071 11:94638999-94639021 GAAGATTCCCTTCCTTCTTCCGG + Intergenic
1087991102 11:104745842-104745864 GAGAATCCCCTTTCCTTTTCAGG + Intergenic
1088847028 11:113677062-113677084 GAAAATACCCTTCACTCTCAAGG + Intergenic
1089416340 11:118295339-118295361 GAGAATTGCCCTCCACCTCCAGG + Intergenic
1089856771 11:121552329-121552351 AAGAATTCCATTCCTTTTCCAGG + Intronic
1090247580 11:125227548-125227570 GAGAATTTCCTTCCTTCTTAAGG + Intronic
1090290078 11:125535653-125535675 CAGAATCCTCTTCCCTTTCCAGG + Intergenic
1090382715 11:126338190-126338212 GGGCATTCCCTGGCCTCTCCAGG - Intronic
1091121483 11:133061451-133061473 GATATTTCCTTTCCATCTCCAGG - Intronic
1091258946 11:134218429-134218451 AAGAACTCTCTTCTCTCTCCTGG + Intronic
1092255024 12:6922178-6922200 GAGAGTTCTCTTCACTCACCAGG - Intronic
1093762342 12:22924510-22924532 GAGAATCCCATTTCCTTTCCAGG + Intergenic
1094421406 12:30274953-30274975 GGGTATTCTCTTCCCTTTCCAGG - Intergenic
1095268122 12:40183823-40183845 GAGAATCTCCCTTCCTCTCCAGG + Intergenic
1095748284 12:45683523-45683545 CAGAATTCCCTTCCCTTTTAAGG - Intergenic
1096686221 12:53290023-53290045 AGGAATTCCCTTCCCTGTCTTGG - Intronic
1096971280 12:55668379-55668401 CAGCATTCTCTTGCCTCTCCAGG + Intergenic
1097224825 12:57471082-57471104 GTGAGTTCCCTTCCCACTCTGGG + Exonic
1097691171 12:62735898-62735920 GAGAACTACCTTCCATTTCCAGG - Intronic
1098161508 12:67650258-67650280 CAGAGTTCCCTTCCCTGACCCGG + Intronic
1098584504 12:72140098-72140120 GAAAATTCTCTTCCCTTTCCAGG + Intronic
1100299125 12:93291047-93291069 GAGAATCCTCTTCCCTTTTCAGG + Intergenic
1101345058 12:103879026-103879048 GACAATCTCCTTCCCTCTCCTGG + Intergenic
1102015336 12:109644583-109644605 GAGGCTTCTCTTCCCTCTCACGG + Intergenic
1102466033 12:113131307-113131329 GAGAGTCCCCTTCCCTCTCTGGG + Intronic
1102712030 12:114936577-114936599 GAAAATTCCCTCCACTCTCGAGG - Intergenic
1104057953 12:125244916-125244938 GTGAATTCACTTCCCTCTCTCGG + Intronic
1104110397 12:125699041-125699063 TAGAACTCCCTTCCTTCTGCTGG - Intergenic
1104355353 12:128080393-128080415 GAGAATCCCCTTCCCTTTCCAGG + Intergenic
1104530578 12:129566679-129566701 GAGAATCCCCTTCCCTTTCCAGG + Intronic
1104537971 12:129636208-129636230 GATAATCCCCTTCCCTCTCCAGG - Intronic
1104810070 12:131614954-131614976 GAGAATCCCGTGCCCTTTCCAGG + Intergenic
1105046916 12:133012254-133012276 GAGAAATACCTCCCCTCTCTGGG + Exonic
1105385393 13:19924634-19924656 CAGAATTTCCTTCCCTTTCAAGG + Intergenic
1105419732 13:20241500-20241522 CAGGAATGCCTTCCCTCTCCGGG + Intergenic
1105454943 13:20531678-20531700 CAGAATTTCCTTCCCTTTTCAGG - Intergenic
1105479223 13:20758092-20758114 GATAATCCCCTTCCCTTTCCAGG + Intronic
1106114897 13:26809037-26809059 GAGATTTCCTTTTCCTCTCTGGG + Intergenic
1106397428 13:29394611-29394633 GAGAATCCCCTTCCCTTTCCAGG - Intronic
1106512426 13:30422512-30422534 GAGAACAGCTTTCCCTCTCCCGG - Intergenic
1106591144 13:31099536-31099558 GAAAATTCCCTTCACTGTCTGGG - Intergenic
1107821450 13:44289332-44289354 GAAACTTCCCTTGCCTCTCCCGG + Intergenic
1108114424 13:47111258-47111280 GAGAATTACCTTCCGTGTTCCGG - Intergenic
1108131189 13:47302188-47302210 GATGCTTCCCTTCCCTTTCCAGG + Intergenic
1108375818 13:49813109-49813131 GAGACTTCCCTTCCTTGCCCTGG - Intergenic
1108747624 13:53410753-53410775 AAGAATTCCCTGACCTCTCCAGG + Intergenic
1108821643 13:54357964-54357986 GAGAATCTCCTTCCCTTTTCAGG + Intergenic
1109342539 13:61079449-61079471 GAGAACCCCCTTCCCTTTCCAGG + Intergenic
1109997519 13:70148205-70148227 GAGAATCCCCTTCCCTTTGCAGG - Intergenic
1111659982 13:91197324-91197346 TAGAATTCCCTTCCCTTTTAAGG + Intergenic
1112088650 13:96057787-96057809 GAGAATTTCCTTCCCTTTTAAGG + Intergenic
1112185923 13:97127666-97127688 GAGCATCCCCTTCCCTTTCCAGG - Intergenic
1112237524 13:97649648-97649670 GAGTCTTTCCTTCCCTTTCCAGG - Intergenic
1113479796 13:110612230-110612252 GAGACTCCCCTTCCTTTTCCAGG + Intergenic
1113971830 13:114197166-114197188 GAGAATCTCCTTCCCTTTCCAGG - Intergenic
1114515010 14:23293517-23293539 GAGAACCCACTTACCTCTCCTGG + Intronic
1114525547 14:23365374-23365396 GAAAATTCCCTTCCCGGGCCGGG + Exonic
1114565676 14:23631061-23631083 GAAAATCCCCTTCTCTTTCCAGG - Intronic
1115060094 14:29177137-29177159 GAGAATACCCATTCCTTTCCAGG + Intergenic
1117331375 14:54715562-54715584 CAGACTTCCCTTCACACTCCAGG - Intronic
1117969424 14:61237415-61237437 GAGAACTCCTTTCCCTTTCCAGG + Intronic
1118105770 14:62657756-62657778 GAGAACCCACTTCCCTTTCCAGG + Intergenic
1118213797 14:63789272-63789294 GGGAACTCCCTTCACTATCCTGG + Intergenic
1118800275 14:69183460-69183482 AAGAACTACCTACCCTCTCCAGG + Intergenic
1118971078 14:70638722-70638744 GAGAATCATCTCCCCTCTCCAGG + Intergenic
1119130112 14:72164227-72164249 CAGAGATGCCTTCCCTCTCCTGG - Intronic
1119457885 14:74772054-74772076 GAAGATTACCTTCCCTATCCAGG - Intronic
1121424994 14:93844088-93844110 GAGAATCTCCTTCCCTTTCCAGG - Intergenic
1121912409 14:97803337-97803359 GAGAATCCCCATCTCTCTGCTGG - Intergenic
1122414762 14:101543599-101543621 GAAAAGTCCCTACCCTCTCTGGG + Intergenic
1122583351 14:102785940-102785962 GAGCCTTCCCTGCCTTCTCCAGG + Intronic
1122968900 14:105144484-105144506 GAACATTCCCTCCCCTCTCCGGG + Intronic
1122988675 14:105225964-105225986 GATAATCCCCTTCCCTTTCCAGG + Intronic
1123159228 14:106261519-106261541 GAGAATCTCCTTCCCTTTCCAGG - Intergenic
1123160342 14:106272389-106272411 GAGAATCTCCTTCCCTTTCCAGG - Intergenic
1123178901 14:106448388-106448410 GCGAATCTCCTTCCCTTTCCAGG - Intergenic
1123207999 14:106732133-106732155 GAGAATCTCCTTCCCTTTCCAGG - Intergenic
1124603482 15:31153130-31153152 GAGAATCCCTTTCCCTTTCCAGG + Intronic
1124898655 15:33801419-33801441 GAGAATCCCCTTCCCTTTCCTGG - Intronic
1124963125 15:34412859-34412881 CAGAATTTCCTTCCCTTTTCAGG - Intronic
1124979748 15:34559085-34559107 CAGAATTTCCTTCCCTTTTCAGG - Intronic
1125341353 15:38678747-38678769 GAGAATCCCTTTCCCTTTCCAGG + Intergenic
1125609452 15:40960694-40960716 GATCATTGCCTCCCCTCTCCTGG - Intergenic
1127851284 15:62914131-62914153 GAAAATCCCCTTCCCTTTCCAGG - Intergenic
1128704143 15:69826273-69826295 GGCAATCCCTTTCCCTCTCCAGG + Intergenic
1129326701 15:74803620-74803642 GAGCTTTCCCGTCCCTCTCCGGG - Intergenic
1129576437 15:76752547-76752569 TAGAATTTCCTTCCCTTTTCAGG - Intronic
1129615964 15:77098880-77098902 GGCAAGTCCTTTCCCTCTCCAGG - Intergenic
1129697109 15:77746970-77746992 GGTAAGTCCCTGCCCTCTCCTGG - Intronic
1131083576 15:89556606-89556628 GTGAATTCTCTTCCCTTTACAGG + Intergenic
1131799491 15:96054287-96054309 GACACTTCCCTGCCCTCCCCCGG + Intergenic
1131906669 15:97150141-97150163 CAGAATTCCCTTCCCTTTCAAGG - Intergenic
1132119656 15:99166164-99166186 GGCATTTCCCTGCCCTCTCCTGG + Intronic
1132585145 16:702901-702923 GAGGACCCCCTTCCCTCTCTTGG - Intronic
1133230996 16:4366423-4366445 GAGAGCTGCCTTCCCACTCCAGG + Intronic
1133307501 16:4819945-4819967 GCGAATTCCCTTTCCTTTCTTGG + Intronic
1134001886 16:10789261-10789283 GAGAACCCCCTTCCCTTTCCAGG - Intronic
1134053157 16:11151707-11151729 GAGAAGTCGCTACTCTCTCCTGG - Intronic
1134313472 16:13097234-13097256 GGAAATTCCCTTCCCTTCCCTGG - Intronic
1135137758 16:19897466-19897488 GAGCAAGCCCTTCCCTCACCCGG - Intergenic
1135346305 16:21691463-21691485 GTTAAAACCCTTCCCTCTCCTGG - Intronic
1136289555 16:29263226-29263248 GAGAATCCTCTTCCCTTTCCAGG - Intergenic
1137239107 16:46639719-46639741 GAGGACTCCCTTGCCTCTCTGGG + Intergenic
1138261701 16:55628148-55628170 GAGAATTCTCTTCCCTTTCCAGG - Intergenic
1138334327 16:56240706-56240728 TAGATTTCCCCTCCCTCTCCAGG + Intronic
1138342480 16:56299280-56299302 GAGAAAGGCCTTCTCTCTCCAGG - Intronic
1138454541 16:57113817-57113839 GAAACTTCCTTTCCCTCTCTGGG + Intronic
1140310107 16:73840809-73840831 GAGATTTCCATTCCTCCTCCCGG + Intergenic
1140458319 16:75117343-75117365 GAGAATCCCCTCCCCTTTCCAGG + Intergenic
1140782400 16:78308622-78308644 GAGAACATCCTTCCCTTTCCAGG + Intronic
1140954149 16:79846962-79846984 GAAAATTCCCTGACCTCTTCTGG + Intergenic
1141411872 16:83840548-83840570 GAGAATTCCCCTCCCTTTCCAGG - Intergenic
1141612381 16:85189187-85189209 GAAGTTTCTCTTCCCTCTCCTGG + Intergenic
1142095292 16:88236206-88236228 GAGAATCCTCTTCCCTTTCCAGG - Intergenic
1142707171 17:1702892-1702914 GAAAAGCCCCTTCCCTGTCCTGG + Exonic
1144144077 17:12380534-12380556 GAGAACCCCCTTCCCTTTCTAGG + Intergenic
1144583035 17:16470648-16470670 GACATTTCCCTTCCCTCCCCTGG - Intronic
1144755189 17:17675850-17675872 GAGAGTTTCCTCCCCTCTCTAGG + Intergenic
1145021823 17:19437878-19437900 GAGAATCCCCTTCCCTTTCCAGG + Intergenic
1145027922 17:19483021-19483043 AAGAATCCCCTTCCTTTTCCAGG + Intergenic
1145032241 17:19513248-19513270 GAGAATCCCCCTCCCTTTCCAGG + Intronic
1145243979 17:21255765-21255787 GAGAATCCCCCTCCCTTTCTGGG - Intergenic
1145633037 17:25895863-25895885 GATAATTCCTTTCCCTCCACAGG - Intergenic
1145641325 17:26015367-26015389 GATAATTCCTTTCCCTCCACAGG - Intergenic
1145642935 17:26038950-26038972 GAGAATTCCCTTTCCACCACAGG - Intergenic
1145657380 17:26248497-26248519 GATAATTCCTTTCCCTCCACAGG - Intergenic
1145679331 17:26568054-26568076 GAGAATTCCCTTTCCACCACAGG - Intergenic
1145679511 17:26570655-26570677 GAGAATTCCCTTTCCACCACAGG - Intergenic
1145679839 17:26575419-26575441 GAGAATTCCCTTTCCACCACAGG - Intergenic
1145680003 17:26577802-26577824 GAGAATTCCCTTTCCACCACAGG - Intergenic
1145680169 17:26580184-26580206 GAGAATTCCCTTTCCACCACAGG - Intergenic
1145680333 17:26582564-26582586 GAGAATTCCCTTTCCACCACAGG - Intergenic
1145681092 17:26593327-26593349 GAGAATTCCCTTTCCACCACAGG - Intergenic
1145681425 17:26598089-26598111 GAGAATTCCCTTTCCACCACAGG - Intergenic
1145681755 17:26602854-26602876 GAGAATTCCCTTTCCACCACAGG - Intergenic
1145681919 17:26605234-26605256 GAGAATTCCCTTTCCACCACAGG - Intergenic
1145682257 17:26610000-26610022 GAGAATTCCCTTTCCACCACAGG - Intergenic
1145682791 17:26617767-26617789 GAGAATTCCCTTTCCACCACAGG - Intergenic
1145683133 17:26622527-26622549 GAGAATTCCCTTTCCACCACAGG - Intergenic
1145774309 17:27517097-27517119 GAGAATCCCCTTCCCTTTCTAGG + Intronic
1146225902 17:31066044-31066066 AATAATTCCCTTCCCTTTCCTGG - Intergenic
1146642553 17:34552343-34552365 GAGGACTCCCTGCCCTCTCTGGG - Intergenic
1147875202 17:43616159-43616181 GAAAAGTCCTTTCCCTCTCTGGG - Intergenic
1148951818 17:51319921-51319943 GAGAATCCCCTTCCCTTTCCTGG - Intergenic
1150222294 17:63502815-63502837 CAGAATTTCCTTCCCTCTTAAGG + Intronic
1151589232 17:75032617-75032639 CAGGTTTCCATTCCCTCTCCTGG - Intronic
1151798719 17:76364552-76364574 GAGAATCCCCTTCCCTTCTCAGG + Intronic
1152137507 17:78513413-78513435 GAGAATCCCCTTCTCTTTCCTGG + Intronic
1153413787 18:4823403-4823425 GAGAATCCCTATCCCTTTCCAGG - Intergenic
1153432981 18:5039020-5039042 GAGAATCCTCTTCCCTTTCCAGG - Intergenic
1153772584 18:8427534-8427556 CAGAATTCCCTTCCTTTTCAAGG + Intergenic
1153833062 18:8940085-8940107 GAGAATCCCCTTTCTTTTCCAGG - Intergenic
1154113513 18:11590809-11590831 GAGGAATCCCTTCCCTTTCCAGG - Intergenic
1155850514 18:30768757-30768779 GAGAATCCCCTTCCCTTTCCAGG + Intergenic
1156185684 18:34660536-34660558 GAGAATCCCCTTCCCTTTCCAGG + Intronic
1157141673 18:45114388-45114410 GAGATTTTCCTCCCCACTCCTGG + Intergenic
1157483761 18:48072922-48072944 TGGAGTTCCCTTCCCCCTCCAGG + Intronic
1157504308 18:48215757-48215779 GAAAATCCCTTTCCCTTTCCAGG - Intronic
1157876867 18:51281827-51281849 GAGAATCTCCTTCCCTTTCCAGG - Intergenic
1158767255 18:60468013-60468035 GTGAATTTCCTTTCCTCTCAGGG + Intergenic
1159670474 18:71214926-71214948 GAAAATCCCCTTCCCCTTCCAGG - Intergenic
1160032054 18:75270523-75270545 GAAAATACCCTTCTCTATCCAGG + Intronic
1160399602 18:78600467-78600489 GAGAATTTCCTCCCCTCTCCTGG - Intergenic
1160543772 18:79639551-79639573 GAGAATCCTCTTCCCTTTCCAGG + Intergenic
1161588106 19:5116546-5116568 GAGACTCCCCTTGACTCTCCTGG - Intronic
1161632255 19:5363919-5363941 CAAAATTCCCCTCCCTGTCCTGG - Intergenic
1163564697 19:18043958-18043980 GAGAAATACCTTCCTGCTCCTGG + Intergenic
1165692030 19:37871050-37871072 GAGAATCCCCTTCCCTTTTCAGG - Intergenic
1166531887 19:43547795-43547817 CAGAATTCCCCTCCCTCTTGGGG + Intronic
1167599102 19:50443643-50443665 CAGAGTTCCAGTCCCTCTCCAGG - Intronic
1168103769 19:54154649-54154671 GAGAACTCAGTCCCCTCTCCTGG + Intronic
1168137141 19:54359510-54359532 GAGCAGCCCCGTCCCTCTCCGGG + Intronic
1168160935 19:54509575-54509597 GAGCAGCCCCGTCCCTCTCCGGG - Intronic
1168584205 19:57579343-57579365 GAGAATCCCCTTTCCTCTCCAGG - Intronic
925457435 2:4027923-4027945 GATAATTCTCTCCCCTCTTCTGG + Intergenic
925509620 2:4610960-4610982 GAGAATCACCTTCCCTCACTAGG - Intergenic
928604797 2:32935806-32935828 GAGAATCCCCTTCCCTTTCCAGG + Intergenic
929010292 2:37435404-37435426 TACAATTCCCTTCCCTTTCATGG - Intergenic
929584748 2:43106561-43106583 GCAAAGCCCCTTCCCTCTCCAGG - Intergenic
930285480 2:49422649-49422671 GAGAATTCTCTTCCCTTTCCAGG + Intergenic
932745956 2:74333768-74333790 ACGGATTCCCTTCCATCTCCTGG + Intronic
933026268 2:77263207-77263229 TGGAATTCCCTGCCCTCTCCAGG - Intronic
933797429 2:85930743-85930765 AAGATTTCCTTTCCCTTTCCAGG - Intergenic
934107788 2:88711639-88711661 AAGAATCCCCTTCCCTTTCCAGG - Intronic
934793162 2:97080547-97080569 GAGAATTGCCTTGGCTCTTCAGG + Intergenic
934813025 2:97299996-97300018 GAGAATTGCCTTGGCTCTTCAGG - Intergenic
934824670 2:97408484-97408506 GAGAATTGCCTTGGCTCTTCAGG + Intergenic
934940237 2:98495859-98495881 GAGAATCCCCTTCCCTTTCCAGG - Intronic
935735057 2:106099921-106099943 GAGAATTCCCTTTCACCTCAGGG + Intronic
935844050 2:107145174-107145196 GGGAATTCCCTTTCCTAGCCAGG - Intergenic
937099528 2:119258082-119258104 GGGAATTGCCATCCCTTTCCTGG - Intronic
937280870 2:120716416-120716438 GGCAATTCCCTTCTCTCTCCAGG - Intergenic
937539325 2:122928662-122928684 GAGAATCCTTTTCCCTTTCCAGG + Intergenic
937838048 2:126493659-126493681 CAGAATCTCCTTCCCTTTCCAGG - Intergenic
938661833 2:133494867-133494889 GAGAATCCCCTTCCCTTTCCAGG + Intronic
938891255 2:135707572-135707594 GAGTATTCCCTTCCCTTTGCAGG + Intronic
938964477 2:136376183-136376205 GAGAATTCCCTTTTCTCTATAGG + Intergenic
938974811 2:136466126-136466148 CAGAATTTCCTTCCTTCTCAAGG - Intergenic
939107966 2:137971714-137971736 GGGAATAGCCTTCACTCTCCAGG - Intronic
939559853 2:143719626-143719648 GGGAATTCCATTCTCTCTCCTGG + Intronic
940197513 2:151112213-151112235 GAGAATCTCCTTCCCTTTCTGGG - Intergenic
941085702 2:161115080-161115102 GGGAACTCACTTCCCTCTCTGGG + Intergenic
942097876 2:172550536-172550558 GAGGATCCCCTTCCCTTTCCAGG + Intergenic
942605055 2:177681968-177681990 GAGAATCCCCTTCCCTTTCCAGG + Intronic
942936378 2:181561620-181561642 GAGAATCTCCTTCCCTTTCCAGG + Intronic
943309275 2:186306822-186306844 GGAAATCCCCTTCCCTTTCCAGG + Intergenic
943363424 2:186947237-186947259 GAAAATGCCACTCCCTCTCCTGG - Intergenic
943458805 2:188143466-188143488 GAGACTGCCAGTCCCTCTCCTGG + Intergenic
943481561 2:188426448-188426470 CAGAATCTCCTTCCCTTTCCAGG - Intronic
944294211 2:198043658-198043680 TAGATTTCTCCTCCCTCTCCAGG - Intronic
944301444 2:198129184-198129206 GAGAAGCCCCTTCCCTTTCCAGG + Intronic
944720528 2:202418858-202418880 GAGAATCCCCTTCCCTTTCCAGG - Intronic
945011261 2:205466307-205466329 GAGAAATCCCATTCCTCTGCAGG + Intronic
946089688 2:217209872-217209894 GAGAATCCCCTTCCTTCACTAGG + Intergenic
946289901 2:218736720-218736742 GAGAATTCCCTTGCTGATCCCGG - Intronic
947226111 2:227841938-227841960 GAGAATTCCCTTCCCTTTCTAGG - Intergenic
947267451 2:228299365-228299387 TAGAGTCCCCTTCCCTTTCCAGG - Intergenic
947814731 2:233028952-233028974 GAGAATCCCCTTCCCTTTCCAGG + Intergenic
947995859 2:234526592-234526614 GAGAATTACTATCCATCTCCTGG + Intergenic
948620217 2:239229894-239229916 GAGAATCCCATGCCCTTTCCAGG - Intronic
1168845793 20:943814-943836 GAGAATCCTTTTCCCTTTCCAGG - Intergenic
1169160870 20:3377268-3377290 GAGAATCCCTTTCACTTTCCAGG - Intronic
1169302837 20:4459535-4459557 GAGAATCCCATTCCCTTTCCAGG + Intergenic
1170724173 20:18911309-18911331 GAGAATTCCCTTTCCTTTCCAGG + Intergenic
1171494454 20:25545819-25545841 GAGAATCTCCTTCCTTTTCCAGG + Intronic
1171994604 20:31722391-31722413 AAAAATTCCATTCCCCCTCCAGG + Intronic
1172886999 20:38238078-38238100 GAGAAGTCACTGCCCTCTCTGGG - Intronic
1173746469 20:45441207-45441229 GAGAATCCCCTTCCCTTTCCAGG - Intergenic
1174159083 20:48537638-48537660 GAGAATCTCTTTCCCTTTCCAGG - Intergenic
1174543223 20:51306033-51306055 GAGAATCCTCTTCCCTTTCCAGG - Intergenic
1175181348 20:57149853-57149875 GAGAATCCCCTTCCCTTTCCAGG - Intergenic
1175484971 20:59339323-59339345 GGGAATTCCCTGCTCACTCCTGG + Intergenic
1175487880 20:59358308-59358330 GGGAATTCCCTGCTCACTCCTGG - Intergenic
1175586769 20:60147342-60147364 GAGAATCCCCTTCCCTTTCCAGG - Intergenic
1175633509 20:60561312-60561334 AAGAAGTGCCTTCCATCTCCAGG + Intergenic
1175635494 20:60579387-60579409 GAGAATCCTCTTCCCTTTTCAGG - Intergenic
1177649492 21:23942013-23942035 GAGAATTTCCTTCCCTTTCCAGG + Intergenic
1178247492 21:30968009-30968031 GAGAATCCCCTTCCCTTTCCAGG - Intergenic
1178627413 21:34229571-34229593 GAGAATTTCCTTCCTTCTTAAGG - Intergenic
1178914154 21:36697753-36697775 GAGTATCCGCTTCCCTCCCCTGG - Intergenic
1180668077 22:17530793-17530815 CAGAATTTCCTTCCCTCTTAAGG - Intronic
1181377745 22:22473830-22473852 CAGATTTCCCTTCCCTGTCTTGG + Intergenic
1182024591 22:27108126-27108148 GGTAAGTCCCTTCCCTCTCTGGG + Intergenic
1183103100 22:35595986-35596008 GAGAATCCCCTTCCCTTTCCAGG + Intergenic
1183832844 22:40427972-40427994 GGAACTTCCCTGCCCTCTCCTGG - Intronic
1184933333 22:47698190-47698212 GAGAATCCCTTTCCCTTTCCAGG - Intergenic
949171129 3:998463-998485 GAAGATTCCATACCCTCTCCTGG - Intergenic
949403308 3:3688200-3688222 GAGAATCCCCTTCCCTTTCTGGG - Intergenic
950187543 3:10954387-10954409 GAGCAGTCCCTCCCCTCCCCAGG + Intergenic
950224954 3:11225904-11225926 GTTAATTCACTTCCTTCTCCAGG - Intronic
950330598 3:12153218-12153240 GACTATTCCCTTTCCTCCCCAGG - Exonic
950478931 3:13232808-13232830 CAGAATTCCCTTCCATTTCATGG - Intergenic
950885926 3:16362828-16362850 GAGTGTCCCCTTCCCTCTTCTGG - Intronic
951773832 3:26286734-26286756 GAGAATATGCTTCCCTTTCCAGG + Intergenic
951857476 3:27213885-27213907 GAGAATCTCCTTCCCTTTCCAGG + Intronic
952033765 3:29175550-29175572 GAGAATCCCCTTCCCTTTCGAGG - Intergenic
952138727 3:30454785-30454807 GAGCAGCCTCTTCCCTCTCCAGG - Intergenic
953048466 3:39317105-39317127 GAGAATCCCCTTCCCTTTCCTGG + Intergenic
953801023 3:46022374-46022396 GAGAATCCCCTTCCCATTCCAGG - Intronic
954800232 3:53183081-53183103 GTGCTTTCCCTTCCCCCTCCTGG + Intronic
954969764 3:54641535-54641557 GAGAATTTCCTTCCCTTTCTAGG - Intronic
955265534 3:57440041-57440063 GAGTATTCCCTTTTCTCTGCAGG - Intronic
955381492 3:58441969-58441991 GAGAATCCCCTTCCTTTTCCAGG - Intergenic
955909793 3:63848170-63848192 GAGAATCCCCTTCCCTTTCCAGG + Intronic
956188407 3:66584332-66584354 CAGATTTCCCTTCCTTCTCAAGG + Intergenic
957747707 3:84366262-84366284 GAGAAAACCCTTCACTCACCTGG - Intergenic
957773774 3:84729027-84729049 GAGAATCCCCTTCCATTTCCAGG + Intergenic
958423011 3:93949914-93949936 GGGAATTCCCTTTCCTAGCCAGG + Intronic
959728539 3:109573725-109573747 GAAAATTCCCTTTCCTCTGCAGG - Intergenic
959809495 3:110598893-110598915 GAGAATGCCCTTCCCTTTCCAGG + Intergenic
960744669 3:120873966-120873988 GAGAATCCCCTTACTTTTCCAGG - Intergenic
961794277 3:129398473-129398495 GTGAATCCCCCTCCCTTTCCAGG + Intergenic
962182816 3:133226316-133226338 GAGAATTCCCTTGCCTTTCCAGG - Intronic
962924801 3:139981995-139982017 GAGCATTCCCTTTCCTCTATTGG + Intronic
963058071 3:141203764-141203786 GAGAATCTCTTTCCCTTTCCAGG - Intergenic
963756426 3:149239309-149239331 GAGAATCCTCTTCCCTTTCCAGG - Intergenic
963842209 3:150119323-150119345 GAGAATCTCCTTCCCTTTCTAGG + Intergenic
964291674 3:155187859-155187881 GAGAATTTCCTTTCCTATCATGG + Intergenic
964304792 3:155328133-155328155 GAAAATCCCCTTCCCTTTCTAGG + Intergenic
964757180 3:160098691-160098713 GAAAATGCCACTCCCTCTCCTGG - Intergenic
965675345 3:171189248-171189270 TAGAATTTCCTTCCTTCTCAAGG + Intronic
966715052 3:183006311-183006333 GAGAGTTCCCTTCTCTCCCCTGG - Intergenic
966754320 3:183354326-183354348 GAGAATCCCCTTCCCTTTCCAGG + Intronic
966840728 3:184084938-184084960 CAGAATTTCCTTGCCTCTCATGG + Intergenic
966929686 3:184668097-184668119 CAGAATTCCCTTCCTTCTTACGG - Intronic
967131967 3:186478766-186478788 GACTTTTCCCTTCCCACTCCAGG + Intergenic
968716972 4:2167406-2167428 GGGAATTCCCTCCCCTCAGCAGG - Intronic
969220233 4:5754340-5754362 GGGAACTCCCTTCCTTCTCCTGG - Intronic
969462313 4:7335340-7335362 TAAAATTCCCTTCACTCCCCAGG - Intronic
970191781 4:13524614-13524636 GAGAGTTCGCATCCCTATCCAGG - Intergenic
970354412 4:15237804-15237826 CAGAATTCCCTGGCTTCTCCTGG - Intergenic
970565901 4:17332660-17332682 GAGATCTCCCTCCACTCTCCTGG - Intergenic
972293343 4:37713005-37713027 CAGAATCCCCTTCCCTTTCCAGG + Intergenic
972565941 4:40269085-40269107 GAGAATCCTCTTCCCTTTCCAGG + Intergenic
972984775 4:44749900-44749922 GGGAATTCCCTTTCCTAGCCAGG - Intergenic
973336534 4:48962265-48962287 GAGAATCCCTTTCCCTTTCCAGG - Intergenic
973534850 4:51870946-51870968 GTCAATTCCCTTCCCTTGCCTGG + Intronic
973574092 4:52268445-52268467 GAGAATTCCCTTCCCTTTCTAGG + Intergenic
974488103 4:62529656-62529678 GAGAATTTCTTTCCTTTTCCAGG - Intergenic
974772134 4:66430066-66430088 TAGATTTCCTTTCCCTCTCTTGG + Intergenic
975059807 4:69983906-69983928 GAGAATCCCCTTACCTTTTCAGG - Intergenic
975188017 4:71425943-71425965 GAGATTCCCTTTCCCTTTCCAGG - Intronic
975240560 4:72052682-72052704 GAGAATCCCTTTCCCTTTCCAGG + Intronic
975682641 4:76891912-76891934 GTCATGTCCCTTCCCTCTCCTGG + Intergenic
975703012 4:77084523-77084545 GAGAATCCCCTTTCCTTTCCAGG - Intergenic
976696062 4:87920893-87920915 GAGAATCCCCTTCCATTTCCAGG + Intergenic
977992936 4:103466429-103466451 GAGAATACCCATTCCTTTCCAGG - Intergenic
978117727 4:105041875-105041897 CAGAATTCCTTTCCCCATCCTGG + Intergenic
978490849 4:109310409-109310431 GAGAATCCCCTTCCCTTTTCAGG + Intergenic
979966057 4:127077579-127077601 GGGAACTCCCTCCCCTCTCCAGG - Intergenic
980736718 4:136899773-136899795 GAGAATCCCCTTTCCTTTCAAGG - Intergenic
980908782 4:138975270-138975292 GAGAATTCCCTTCCCTTTCCAGG + Intergenic
981069091 4:140516213-140516235 GAGAATCTCCTTCCCTTTCCAGG + Intergenic
981490730 4:145336699-145336721 GAGAATCCCTTTCCCTTTCCAGG + Intergenic
981692318 4:147523248-147523270 GATTATTCCCTTCCATTTCCAGG - Intronic
981805970 4:148715542-148715564 GAGAATCCTCTTCCCTTTGCAGG - Intergenic
981903291 4:149891279-149891301 GAGAATCCCCTTCCCTTTCCAGG - Intergenic
982009471 4:151092849-151092871 GAGAATCCCCTTCCCTTTCCAGG - Intergenic
982415029 4:155120978-155121000 GAGAATTCCTTTCCATTTCCAGG + Intergenic
982428346 4:155293615-155293637 GAGAATTCCTTTTCCTTTCCAGG - Intergenic
982703086 4:158677503-158677525 GAGAATTCTCTTCCCTTTCTAGG - Intronic
984213263 4:176876883-176876905 TAGAATTCCCTTCCTATTCCTGG + Intergenic
984962142 4:185108136-185108158 AAGAATCCCCTTCCCTTTTCAGG - Intergenic
985393578 4:189516785-189516807 GAAAAATACCTTCCCTCGCCAGG + Intergenic
985482988 5:129148-129170 GAGAATCTCCTTCCCTTTCTAGG + Intergenic
986125739 5:4881044-4881066 GACAATTGCCTTGCCTCTCCCGG + Intergenic
986286804 5:6365260-6365282 GAGATGTCCCTTCCCTGTTCGGG + Intergenic
986682937 5:10250265-10250287 GAGAATGCACTTCCCTTTCTCGG - Exonic
986689546 5:10302892-10302914 GAGAATCCCCTTCCCTTTCCAGG + Intronic
986719054 5:10547130-10547152 GGGAATTCCCTTCCCTCCCATGG + Intergenic
987096643 5:14556370-14556392 GAGGATCCCCTTCCCTTTCCAGG - Intergenic
987144999 5:14983233-14983255 GAGAATTTCCTTCCCTTACTAGG + Intergenic
987265806 5:16253755-16253777 GAGAATTCCCTTCTCTTTCCAGG - Intergenic
987486599 5:18534181-18534203 GAGAATCCACTTCCCTTTCTAGG + Intergenic
987586152 5:19859474-19859496 GAGAATCTCCTTCCCTTTCCAGG + Intronic
987676938 5:21087061-21087083 GAGAATCCCCTTCCCTTTCTGGG + Intergenic
987680512 5:21130331-21130353 GAAAATCCCCTTCCCTTTCCAGG - Intergenic
987701050 5:21398749-21398771 GAGGATACCCTTCCACCTCCAGG + Intergenic
988595232 5:32585035-32585057 GTGAACTCCCTTACATCTCCAGG + Intronic
988830724 5:34984537-34984559 CAGAATTCCCTTCCCTTTTAAGG + Intergenic
989422144 5:41252641-41252663 GAGAGTCTCCTTCCCTTTCCAGG + Intronic
989477495 5:41891051-41891073 GAAAATTCCCTTCCCTTTCCAGG + Intergenic
990159557 5:52922602-52922624 CAGAATGCCAATCCCTCTCCAGG + Intronic
990942393 5:61215799-61215821 GAGAATTCCCATCCCAGTCCAGG + Intergenic
991011217 5:61884731-61884753 GAGAATTTCCATTCCTGTCCAGG - Intergenic
991202139 5:64006857-64006879 GAGAATCTCCTTCCCTTTCTAGG + Intergenic
991314272 5:65282511-65282533 GAGAATCCCCTTCCCTTTCCAGG - Intronic
992541890 5:77774318-77774340 GAGAACCCTCTTCCCTGTCCAGG + Intronic
993271983 5:85808519-85808541 GAGAATCCCCTTTCCTTTTCAGG - Intergenic
993457504 5:88142939-88142961 GAGAATTCCCTTTCCTCCAAAGG + Intergenic
995083450 5:108080954-108080976 GAGAATCCCTTTCCCTTTCCAGG - Intronic
995596856 5:113756608-113756630 GAGAATCCCTTTCCCTTTCTAGG + Intergenic
996741090 5:126799596-126799618 TAGTATTCCCTTCCTTCTTCTGG - Intronic
996995966 5:129696980-129697002 GGGAATCCCCTTCCCTTTCCAGG - Intronic
997810573 5:136963741-136963763 GACAATTTCCTTCCCTTTCTGGG - Intergenic
998032608 5:138884435-138884457 GAGAATCTCCTTCCCTTTCTAGG - Intronic
999060007 5:148623686-148623708 CAGAATTCCATTCCCACTTCAGG - Intronic
999195061 5:149776273-149776295 GCAAATTCCTTTCCCTCTCTGGG + Intronic
999260164 5:150233418-150233440 GCTAATTCCCTTCTCCCTCCTGG + Intronic
999415089 5:151388067-151388089 GAGAACCCCCTTCCCTTTCTAGG + Intergenic
999582040 5:153049692-153049714 GAGAATCCCTTTCCCTTTCCAGG + Intergenic
999671078 5:153959700-153959722 CAGAAGCCTCTTCCCTCTCCTGG + Intergenic
999751490 5:154631239-154631261 GAGAAATCCCCCCACTCTCCCGG - Intergenic
999801765 5:155045070-155045092 GAGAATCCTCTTCCCTTTCCAGG + Intergenic
999870128 5:155741335-155741357 GAGAATTCCCTTCTTTTTCCAGG - Intergenic
999956702 5:156710865-156710887 GAGAATCTTCTTCCCTTTCCAGG - Intronic
1000601008 5:163274430-163274452 GATAATCCCCTTACCTTTCCAGG - Intergenic
1001036923 5:168303654-168303676 GAGAAGTCCCTTCGGTCTTCTGG - Intronic
1001076989 5:168637209-168637231 GAGAAGCCCCTTCCCTTTCCAGG - Intergenic
1001948852 5:175801937-175801959 GTTAGTTCCCTTCCCTCTCTGGG - Intronic
1002167045 5:177354488-177354510 GAGAATGCCTTTACCTTTCCCGG - Intergenic
1002637776 5:180616620-180616642 AAGGATTCCCATCCATCTCCAGG + Intronic
1002652660 5:180712977-180712999 GATAATTCCGTTCCCTTTCCAGG + Intergenic
1003070486 6:2941722-2941744 GATAATCTCCTTCCCTTTCCGGG - Intergenic
1003285472 6:4730235-4730257 AAGAATTTCCTTCCCTCACTTGG - Intronic
1003304693 6:4915760-4915782 GAGAATCTCCTTCCCTTACCAGG + Intronic
1003402030 6:5798395-5798417 GAAAATTCTCTTGCCCCTCCTGG + Intergenic
1003787052 6:9498220-9498242 GAGAATTCCCTTCTCATTCCAGG - Intergenic
1004574835 6:16885824-16885846 GAGAATCTCCCTCCCTTTCCGGG + Intergenic
1005785071 6:29236635-29236657 TAGAATTCGCTACCCTTTCCAGG + Intergenic
1005820702 6:29596347-29596369 GAGAATCCCCTTCCCCTTCCAGG + Intronic
1006677335 6:35773886-35773908 GAGAAGTCCCTGCCTTCTCTGGG + Intergenic
1007292756 6:40799693-40799715 GATACTCCCCTGCCCTCTCCCGG + Intergenic
1007789491 6:44301008-44301030 GAGATTCCCCATCCCTGTCCTGG + Intronic
1008464227 6:51812713-51812735 GAGAATCGCATTCCATCTCCAGG + Intronic
1008649891 6:53551426-53551448 GAGAATCCCCTTCCCTTTCCAGG + Intronic
1008669596 6:53753821-53753843 GATAATTCCTTTCCCTTTCCTGG - Intergenic
1008754420 6:54777218-54777240 GAGAGTCTCCTTCCCTTTCCAGG - Intergenic
1009479933 6:64144050-64144072 GGGAATTCCTTTCCCTCAGCTGG - Intronic
1009511253 6:64552379-64552401 GAGAATCCTTTTCCCTTTCCAGG + Intronic
1010124787 6:72419285-72419307 GTGCATTCCCTTCACCCTCCTGG - Intergenic
1011066347 6:83330902-83330924 GAGAATTTTCTTCTCTCCCCTGG + Intronic
1011400497 6:86956226-86956248 AAGAATCCTCTTCCCTTTCCAGG + Intronic
1011490961 6:87891522-87891544 GAGAAATACCTTCCCTCTCATGG + Intergenic
1011654025 6:89533291-89533313 GACAAGTCCCTAACCTCTCCGGG - Intronic
1012203857 6:96437198-96437220 GAGAATTCCCTTTCCTAGCAAGG + Intergenic
1012315348 6:97778728-97778750 GAGAATCTCCTTCCCTTTTCAGG + Intergenic
1012996383 6:105979835-105979857 GACAAGTCCCTTCACTGTCCTGG - Intergenic
1013184174 6:107743627-107743649 GAGAAGTCTCATCTCTCTCCGGG - Intronic
1013369600 6:109457199-109457221 CTGAATTCCCTCGCCTCTCCTGG - Intergenic
1014242726 6:119035549-119035571 GAGAATCCCCCTCCCTTTCCAGG + Intronic
1014848792 6:126314044-126314066 GAGAATCCCCTTCTCTTTCCAGG + Intergenic
1015513756 6:134064682-134064704 GTGAATACCCTTCCATGTCCAGG - Intergenic
1015681667 6:135815215-135815237 GAGAATCCCCTTCCCTTTCCAGG - Intergenic
1015751951 6:136569279-136569301 GAGAATCCCCTTCCCTTTCCAGG + Intronic
1016490727 6:144598545-144598567 GAGAATCCCCTTCCCTTTCCAGG - Intronic
1016521510 6:144951805-144951827 GAGAATCTCCTTCCCTTTCTAGG + Intergenic
1016923728 6:149318915-149318937 GCAAATTCCCTCCGCTCTCCTGG - Intronic
1017622571 6:156314412-156314434 GAAAAATCCCTTTACTCTCCTGG - Intergenic
1017778675 6:157699575-157699597 GAGAATCCCCTTCCCTTTCTAGG - Intergenic
1018433287 6:163740353-163740375 GAGAAGTCCATTCTCTCTCATGG + Intergenic
1018555695 6:165048802-165048824 GAGAATCTCCTTCCCTTTCCAGG + Intergenic
1018595729 6:165478677-165478699 GAGAAACCCTTTCCCTTTCCAGG + Intronic
1018777088 6:167027573-167027595 GAGAATGCCCTTCCCTCTTCTGG + Intronic
1019014518 6:168870313-168870335 GAGAATCCCTCTCCCTTTCCAGG + Intergenic
1019068475 6:169322381-169322403 GAGAATCCCCTTCCCTTTCCAGG - Intergenic
1019342207 7:513595-513617 GAGATCTCCCTGCCCCCTCCTGG + Intronic
1019572867 7:1721321-1721343 GAAAATCCCTTTCCCTCTCAGGG + Intronic
1019653067 7:2171199-2171221 GAGAGTGCCCTTCGCTCTGCTGG - Intronic
1022764981 7:33401796-33401818 TAGAATCCCCTTCCCTTTCCAGG - Intronic
1023308634 7:38858150-38858172 GAGAATCCCCTTCCCTTTCCAGG - Intronic
1023350324 7:39313947-39313969 GAGAATTCCCTACCATCTAAAGG + Intronic
1023687423 7:42750796-42750818 GAGAATTCCCTTTTCTGCCCTGG - Intergenic
1024388422 7:48779938-48779960 GAGAATCCCCTTCTCTTTCTAGG - Intergenic
1024485006 7:49907979-49908001 GACAATCCCCTTCCCTTTCCAGG - Intronic
1024716494 7:52085508-52085530 GAGAATTCTTTTCCCTTTCCAGG - Intergenic
1024928781 7:54647222-54647244 GAGAAGCCTCTTCCCTTTCCGGG - Intergenic
1025005919 7:55354736-55354758 GGGAATCCCCTTCCATTTCCAGG + Intergenic
1025819066 7:64946456-64946478 AAGAATTCCCTTCCCAGCCCAGG - Intergenic
1025956333 7:66185973-66185995 GAGACTTGTCTCCCCTCTCCTGG + Intergenic
1026086359 7:67266425-67266447 GAGAATCCCCTTCCCCTTCCAGG + Intergenic
1026301972 7:69105978-69106000 GAGAATCTCCTTCCCTTTCCAGG + Intergenic
1026366798 7:69656297-69656319 GAGAATTCACTTCACTCTGGTGG - Intronic
1026398499 7:69984677-69984699 TAGAAATCCTTTCCCTGTCCTGG + Intronic
1026535691 7:71236869-71236891 GATCATTCCCTTCCCCGTCCTGG - Intronic
1026537775 7:71254361-71254383 GAGAATCCTCTTCCCTTCCCAGG - Intronic
1026563063 7:71466552-71466574 GAGAATTCCCTTCCCTTCCTAGG + Intronic
1026690788 7:72548404-72548426 CAGAATCCCCTTCCCTTTCCAGG - Intergenic
1026918046 7:74134466-74134488 GGGAAATCCCTGCCCTTTCCTGG + Intergenic
1027974604 7:85135308-85135330 GAGAGTTCCTTTCCCTCAACTGG + Intronic
1028185757 7:87784265-87784287 GAGAATTTCCTTACCTCTAAAGG - Intronic
1029106712 7:98183184-98183206 GAGAATGCCTTTCCCTTTCTAGG + Intronic
1029355421 7:100048300-100048322 GAGAATCCCCTTCCCTTTCCAGG + Intergenic
1029500947 7:100929386-100929408 GAGAGTCCCCTTCCCTTTCCAGG - Intergenic
1029861997 7:103582585-103582607 AAGAAATTCCTTCCCTATCCAGG + Intronic
1030558124 7:111052220-111052242 GAGAATCCCTTTCCCTTTCCAGG + Intronic
1032674280 7:134114128-134114150 GAGAATCCCCTTCCATTTCCAGG + Intergenic
1033162305 7:139008552-139008574 GAGAATCCCCTTCCCTCTCCAGG + Intergenic
1033213423 7:139477394-139477416 GAGAATTCCCTTCCTTTTTAAGG - Intronic
1034060114 7:148079576-148079598 GAGAATCCCTTTCCATTTCCAGG - Intronic
1034123247 7:148646186-148646208 GAGAATGCCCCATCCTCTCCCGG + Intergenic
1035122016 7:156576716-156576738 CGGAATTCCCTTTCCTCTTCAGG + Intergenic
1035359929 7:158304877-158304899 GAGAATCCCTTTTCCTTTCCAGG - Intronic
1035716448 8:1758908-1758930 CAGAATCCCCTTCCCTTTCCAGG - Intronic
1037138244 8:15489484-15489506 GAGAAACCTCTTCCCTTTCCAGG - Intronic
1037387670 8:18360787-18360809 GACAATCTCCTTCCCTTTCCAGG + Intergenic
1037653332 8:20860919-20860941 GAGAATCCCCTTTCCTTTCCAGG + Intergenic
1037946705 8:22994184-22994206 GACAATATCCTTCCCTCTCTGGG - Intronic
1038293881 8:26273471-26273493 GAGAATTCCTTTCCCTTTCTGGG + Intergenic
1038905483 8:31897501-31897523 GAGAATCCCTTTCCTTTTCCAGG + Intronic
1039881407 8:41627546-41627568 TAGGATTTCCTTCTCTCTCCTGG + Intergenic
1040037543 8:42885211-42885233 CAGAATTTCCTTCCTTCTCAGGG + Intronic
1040713974 8:50224899-50224921 GAGAATCCCCTTCTCTTTTCAGG + Intronic
1040945241 8:52877170-52877192 GAGAATCTCCCTCCCTTTCCAGG - Intergenic
1041850743 8:62389082-62389104 CAGCTCTCCCTTCCCTCTCCAGG - Intronic
1042394473 8:68276521-68276543 GGGAATTCCCTTTCCTAGCCAGG + Intergenic
1042765858 8:72321354-72321376 GGGAATTCCCTTTCCTAGCCTGG + Intergenic
1042820331 8:72923290-72923312 GAGAATTCCTTTCCATTTCTAGG - Intronic
1042979047 8:74505385-74505407 GAGAATCCCTTTTCCTTTCCAGG + Intergenic
1043002826 8:74780374-74780396 GAGAATCTCCTTCCCTTACCAGG + Intronic
1043509558 8:80936214-80936236 CAGAATTCCCTTCCTTCTTGAGG + Intergenic
1044031421 8:87242269-87242291 GAAAATCGCCTTCCCTTTCCAGG + Intronic
1044274104 8:90280223-90280245 GAGAATCCCCTTACCTTTCTAGG - Intergenic
1044309470 8:90677005-90677027 GAGAATCCCCTTCCCTCTCCAGG - Intronic
1044396551 8:91720162-91720184 GAGAATCCCCTCCCCTTTTCAGG - Intergenic
1045030572 8:98131425-98131447 CAGAATTCCCTTCCCTTTTAAGG + Intronic
1045126010 8:99089785-99089807 GAGAATCCCTTTCCCTTTCCTGG - Intronic
1045317800 8:101058529-101058551 GAGAGTTCTCTACCCACTCCTGG + Intergenic
1046121690 8:109855596-109855618 GAGAATCCCCCTCCCTTTCCAGG + Intergenic
1048332229 8:133478709-133478731 GAGGAAGCCCTGCCCTCTCCTGG + Intronic
1048777969 8:137968410-137968432 GAGAATCCCCTTCCCTTTCCGGG + Intergenic
1049429451 8:142552779-142552801 GAGAATCCTCCTCCCTTTCCAGG - Intergenic
1049552081 8:143264698-143264720 AAGAATCCCCTTCCCCCACCAGG - Intronic
1049730052 8:144172184-144172206 GAGAATCTCCTTCCGTTTCCAGG + Intronic
1049959926 9:728563-728585 GTGAATCCCCTTACCTGTCCAGG + Intronic
1050989875 9:12137175-12137197 GAGGATCCCCTTGCTTCTCCAGG + Intergenic
1051889054 9:21924721-21924743 GAGCCTTCCCTTCCCTACCCAGG + Intronic
1052051133 9:23850677-23850699 GGGGCTTCCCTCCCCTCTCCTGG - Intergenic
1053286556 9:36852932-36852954 AAGATTTCCCTTTCCTCTGCTGG - Intronic
1053461716 9:38276669-38276691 GGCAAGTCCCTTCCCTGTCCTGG - Intergenic
1055013808 9:71594674-71594696 GAGAATCCCCTTTCCTTCCCAGG + Intergenic
1056453142 9:86735829-86735851 GAGAATCCCCTTCCCTTTCCAGG + Intergenic
1056600869 9:88045818-88045840 GAAAATCCCCTTCCCTTTCCAGG + Intergenic
1056715615 9:89025871-89025893 GAGAATCCCTTTCCCTTTCCAGG + Intronic
1056723053 9:89088024-89088046 GAAAATCCCCTTCTCTTTCCAGG + Intronic
1057143513 9:92742884-92742906 AAGAATTCCCTTCCCTTTCATGG + Intronic
1057422196 9:94921543-94921565 GAGAATTTCCTTCCCTCCCTTGG - Intronic
1057580041 9:96279596-96279618 GAGAATCCCCTTCCCTTTCCAGG - Intronic
1058247261 9:102642872-102642894 GAGAATTCCTTACTCTCTCCAGG + Intergenic
1058711325 9:107681927-107681949 GAGAACACCCTTCCTCCTCCCGG + Intergenic
1059739015 9:117131508-117131530 GAGAATCTCCTTCCCTTTCTAGG + Intronic
1059822683 9:117991590-117991612 TATCATTCCCTTCACTCTCCAGG - Intergenic
1060149889 9:121281853-121281875 GAGAGTTGCTTTCCCTCTCAAGG + Intronic
1060548933 9:124476196-124476218 GCAAGTTCCCTTCCCTCTCTGGG + Intronic
1061447781 9:130651019-130651041 GAGAATTCCATTCCCCTACCTGG - Intergenic
1061516830 9:131094986-131095008 CATAATGCACTTCCCTCTCCAGG - Intergenic
1061794177 9:133074906-133074928 GAGAATCTCCTTCCCTTACCAGG + Intronic
1062064449 9:134518582-134518604 GAGAAATGGCTTCCCTGTCCAGG - Intergenic
1062067351 9:134535875-134535897 CAGAATTCCCCTCCCTCTCAGGG - Intergenic
1062153810 9:135034858-135034880 CAGAATTCCCTTCCCTTCCAAGG + Intergenic
1185995991 X:4949989-4950011 GAGAATGCCTTTCCCTTTCCAGG + Intergenic
1186075469 X:5873987-5874009 GAGACTTTCCTGCCCTTTCCTGG - Intronic
1186182806 X:6989412-6989434 GAGAAATTCCTTCCTTATCCTGG - Intergenic
1186463123 X:9764425-9764447 CTGAAATCCCTTCCCTATCCAGG - Intronic
1186811942 X:13198922-13198944 GAGAATGCCCTTCTCTTCCCAGG + Intergenic
1187348405 X:18489054-18489076 GATAATCCCCTTCCCTTTCCAGG + Intronic
1187883370 X:23866138-23866160 GAGCTTCCCCCTCCCTCTCCTGG - Intronic
1187948672 X:24451108-24451130 GGGAATTGCTTTCCCTCCCCAGG + Intergenic
1188074104 X:25754463-25754485 AAGAATCCCCTTCCCTTTCCAGG + Intergenic
1188508159 X:30905979-30906001 GAGAGTCCCCTTCCCTTTCCAGG + Intronic
1188521481 X:31042999-31043021 GAGAGTCCCTTTCCCTTTCCAGG - Intergenic
1188751247 X:33908167-33908189 CAGAATCCCCTTTCCTTTCCAGG + Intergenic
1188937789 X:36198529-36198551 GAGAATCCCCTTTCCTTTTCCGG - Intergenic
1189785285 X:44553831-44553853 GAGCATCCCCTTCCCTTTCCAGG - Intergenic
1189957111 X:46287220-46287242 GAGAATGCCCTTCCCTTTCCAGG - Intergenic
1190360333 X:49643393-49643415 GAGAATCCCCTTCCTTTTCCAGG + Intergenic
1190687969 X:52890998-52891020 GAGAATCCCTTTCCCTTTCCAGG - Intergenic
1190698013 X:52964794-52964816 GAGAATCCCTTTCCCTTTCCAGG + Intronic
1190915423 X:54808354-54808376 GAGACTGCCCTCCCCTCTCTAGG - Intronic
1191016131 X:55811956-55811978 GGGAATTCCCTTTTCTCGCCAGG - Intergenic
1191775485 X:64808600-64808622 GGGAATTCCCTTCCCAGTCAAGG + Intergenic
1192007619 X:67234315-67234337 GGGAATTCCCTTTCCTAGCCAGG + Intergenic
1192341775 X:70269032-70269054 GAGAAGTTCCTTCTCTCTCAGGG + Intronic
1192571249 X:72207678-72207700 GTGAAATGCCTTCCCTTTCCAGG - Exonic
1193302620 X:79908607-79908629 GAGAATTCTCTTCCCTTTTCAGG + Intergenic
1193372126 X:80711514-80711536 GAGAATCCCTTTCTCTTTCCAGG + Intronic
1194481780 X:94435679-94435701 GAGGATCCTCTTCCCTCTCCAGG - Intergenic
1195292128 X:103439446-103439468 GAGAATTCCCTATCCTTTCCAGG - Intergenic
1195495645 X:105529881-105529903 GAGAATTTCCTTCCCTTTTAAGG + Intronic
1195557903 X:106248277-106248299 GAGAATCCCCTTCCCTTTCCAGG - Intergenic
1195558131 X:106250723-106250745 GAAAATCCCCTTCCCTTTCCAGG + Intergenic
1195922751 X:109999850-109999872 GAGAATCTCCTTCCCTTTCCAGG + Intergenic
1196338015 X:114561927-114561949 TAGAATTTCCTTCCCTTTTCAGG - Intergenic
1196613669 X:117742986-117743008 GAGAAGTGCCTTCCTTCACCAGG - Intergenic
1197143067 X:123138219-123138241 GAGAATTTCATCACCTCTCCTGG + Intergenic
1197691430 X:129504802-129504824 GAGAATTTCCACCCCTCTACAGG - Exonic
1198077330 X:133206014-133206036 GAGAATCCCTTTCCCTTTCCAGG - Intergenic
1198126917 X:133653959-133653981 GACAAGTCATTTCCCTCTCCTGG + Intronic
1198219077 X:134583525-134583547 GGTAAGTCCCTTCCCTCTCCTGG + Intronic
1199538599 X:148932055-148932077 GTCAATTCCCTTTCCTCTCTGGG + Intronic
1199984465 X:152940681-152940703 GAGAATCTCCTTCCCTTTCCAGG - Intronic
1200834292 Y:7717929-7717951 GAGTGTCCCCTTCCCTCTTCTGG - Intergenic
1201148302 Y:11079055-11079077 GAGAATCCCCTTACCTTTCCAGG + Intergenic
1202387841 Y:24342175-24342197 GAGCATCCCCTTCCCTCATCTGG + Intergenic
1202482946 Y:25327953-25327975 GAGCATCCCCTTCCCTCATCTGG - Intergenic