ID: 915074746

View in Genome Browser
Species Human (GRCh38)
Location 1:153298887-153298909
Sequence ATATAAAGCAAGGTGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 1, 2: 0, 3: 17, 4: 223}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915074740_915074746 -1 Left 915074740 1:153298865-153298887 CCTTGCTCCATGTTTGCCTTGGA 0: 1
1: 0
2: 1
3: 17
4: 204
Right 915074746 1:153298887-153298909 ATATAAAGCAAGGTGGAGCTGGG 0: 1
1: 1
2: 0
3: 17
4: 223
915074741_915074746 -8 Left 915074741 1:153298872-153298894 CCATGTTTGCCTTGGATATAAAG 0: 1
1: 0
2: 0
3: 16
4: 160
Right 915074746 1:153298887-153298909 ATATAAAGCAAGGTGGAGCTGGG 0: 1
1: 1
2: 0
3: 17
4: 223
915074735_915074746 3 Left 915074735 1:153298861-153298883 CCCCCCTTGCTCCATGTTTGCCT 0: 1
1: 0
2: 1
3: 27
4: 372
Right 915074746 1:153298887-153298909 ATATAAAGCAAGGTGGAGCTGGG 0: 1
1: 1
2: 0
3: 17
4: 223
915074737_915074746 1 Left 915074737 1:153298863-153298885 CCCCTTGCTCCATGTTTGCCTTG 0: 1
1: 0
2: 1
3: 33
4: 369
Right 915074746 1:153298887-153298909 ATATAAAGCAAGGTGGAGCTGGG 0: 1
1: 1
2: 0
3: 17
4: 223
915074738_915074746 0 Left 915074738 1:153298864-153298886 CCCTTGCTCCATGTTTGCCTTGG 0: 1
1: 0
2: 4
3: 114
4: 926
Right 915074746 1:153298887-153298909 ATATAAAGCAAGGTGGAGCTGGG 0: 1
1: 1
2: 0
3: 17
4: 223
915074736_915074746 2 Left 915074736 1:153298862-153298884 CCCCCTTGCTCCATGTTTGCCTT 0: 1
1: 0
2: 3
3: 32
4: 307
Right 915074746 1:153298887-153298909 ATATAAAGCAAGGTGGAGCTGGG 0: 1
1: 1
2: 0
3: 17
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915074746 Original CRISPR ATATAAAGCAAGGTGGAGCT GGG Intronic
900279835 1:1859629-1859651 ATGTAAAGAAAGGGGGAGCAGGG + Intronic
900947930 1:5841701-5841723 AAAAAAAGCAAGTTGGAGCAGGG + Intergenic
901253190 1:7797337-7797359 AGAAAGAGCAAGGTGGGGCTGGG + Intronic
902097353 1:13957667-13957689 AGAGAAAGCAAGGTGGGGATGGG + Intergenic
902143075 1:14373083-14373105 ATAAAAAGAAAGCTGGAGGTAGG + Intergenic
902567998 1:17327192-17327214 ATATAAAGCAAGGCTGGGCATGG - Intronic
902789570 1:18758269-18758291 ATGGAAGGCAAGGTGGATCTTGG - Intergenic
902934630 1:19755949-19755971 AGCAAAAGCAAGGTGGGGCTGGG + Intronic
904249748 1:29214672-29214694 TTTTAAAGCAAGTTTGAGCTGGG + Intronic
904361231 1:29973432-29973454 ATGTACAGCAAGGTGATGCTTGG + Intergenic
905389688 1:37628487-37628509 ACATGAAGCAAGAGGGAGCTGGG + Intronic
908095326 1:60731484-60731506 CCATAAATCAAGGTGTAGCTGGG - Intergenic
910038915 1:82823752-82823774 ATTTGAAGCAGGGTGGAGTTGGG - Intergenic
910107902 1:83651459-83651481 ATATTAAGCAAGGTGGCCTTTGG + Intergenic
910113973 1:83712387-83712409 TTATCATGCAAGGTGGAGGTGGG + Intergenic
915074746 1:153298887-153298909 ATATAAAGCAAGGTGGAGCTGGG + Intronic
916912534 1:169366672-169366694 ATATAGAGCAATGTGTAGGTTGG + Intronic
917028836 1:170668004-170668026 ATATCAACCAAGGTGGGGGTGGG - Intronic
917550978 1:176028659-176028681 AAAAAAAGCAATCTGGAGCTAGG + Intronic
918067758 1:181113061-181113083 ATATAAATAAAGGGGGAGCCAGG - Intergenic
921495586 1:215836844-215836866 ATAGAAGGCAAGGTGGGGCGTGG - Intronic
923020113 1:230156686-230156708 TTAGAAAGCAATGTGGAACTCGG + Intronic
923120826 1:230989430-230989452 ATATAAAGTGAGGAAGAGCTGGG - Intronic
924238886 1:242022461-242022483 TTATGTAGCAAGGGGGAGCTGGG - Intergenic
924616521 1:245616435-245616457 ACCTAAAACAAGGTGGTGCTTGG + Intronic
1063487091 10:6430148-6430170 AAATAAAGCAAGGTTGGGCTGGG - Intronic
1064583916 10:16820370-16820392 AAATCAAGCAAGATGGAGCTGGG + Intergenic
1065179182 10:23107765-23107787 ATATAAACCCAGGCTGAGCTGGG - Intronic
1066801424 10:39196485-39196507 ATGAAAAGAAAGGTGGAACTCGG + Intergenic
1066872073 10:40531337-40531359 ATGAAAAGAAAGGTGGAACTCGG - Intergenic
1067321753 10:45227402-45227424 AAATCAAGCAAGATGGACCTGGG + Intergenic
1068031956 10:51715712-51715734 ATATAAGGCAGGGTGAATCTTGG - Intronic
1069924967 10:71843087-71843109 AAATAAAGCAAGGTGGGGTGGGG + Intronic
1070704153 10:78625361-78625383 ATTTAAAGCATGTTGGATCTGGG + Intergenic
1071107663 10:82117094-82117116 AGATAAAGCAAGGTGGCTATCGG - Intronic
1071602406 10:86964764-86964786 AGAGAAAGCAAGGAGGAGCAAGG + Intronic
1073309506 10:102530124-102530146 AGCTAGAGAAAGGTGGAGCTGGG + Intronic
1073973979 10:109078365-109078387 GTATCAAAAAAGGTGGAGCTAGG - Intergenic
1074763880 10:116686641-116686663 AGAAAAAGCAAGGTGGGCCTGGG + Intronic
1075505738 10:123020163-123020185 ATATAAAGGAAGGGGGAGAAAGG + Intronic
1075516367 10:123111893-123111915 ATTTAATGCAAGGTGAAGCTGGG - Intergenic
1076559488 10:131351856-131351878 TTTTAATGCAAGGTGGAGCTGGG - Intergenic
1077331448 11:1985608-1985630 ATATGAAGCAAGCTGGACTTGGG - Intergenic
1077340550 11:2024557-2024579 ACATAAAGAAAGATGGAGCCTGG - Intergenic
1077740059 11:4835758-4835780 CTATAAAATGAGGTGGAGCTGGG + Intronic
1078150200 11:8752155-8752177 AAATTAAGCAAGGTTGAGCCGGG + Intronic
1080492424 11:32780839-32780861 ATATACAGGAAGGTGGAACCAGG + Intronic
1084850567 11:71936364-71936386 AAAAAAAGCAAGGGTGAGCTGGG - Intronic
1085886247 11:80525632-80525654 ACATAAAGCAGGGTGGAGGTAGG + Intergenic
1086962232 11:92990177-92990199 ATATAAAGCAGACTGGACCTAGG - Intergenic
1089407171 11:118207674-118207696 ACATAAAGCAAGTTGGAGCACGG + Intronic
1202814429 11_KI270721v1_random:40784-40806 ATATGAAGCAAGCTGGACTTGGG - Intergenic
1202823535 11_KI270721v1_random:79746-79768 ACATAAAGAAAGATGGAGCCTGG - Intergenic
1091641067 12:2237900-2237922 ACGTAAATAAAGGTGGAGCTAGG - Intronic
1093781316 12:23140554-23140576 ATATAAAGCAAGGGGGAAACAGG - Intergenic
1093943684 12:25083710-25083732 CAATAAATTAAGGTGGAGCTAGG - Intronic
1096806281 12:54143109-54143131 ACACAGAGCAAGGGGGAGCTGGG - Intergenic
1097998722 12:65918340-65918362 TTATAAAGAGAAGTGGAGCTTGG + Intronic
1098005429 12:65992233-65992255 ATATAAAGTTATGTGGGGCTAGG + Intergenic
1099498337 12:83379971-83379993 TTATAAAGCTAAGTGGAGTTTGG + Intergenic
1100576489 12:95896324-95896346 CTATAACGCAATGTGAAGCTGGG - Intronic
1102224632 12:111219104-111219126 ATTTAAAGTAATGTGGCGCTTGG - Intronic
1107840061 13:44448709-44448731 TTATAAAGCAAAATGGACCTTGG + Intronic
1109080253 13:57890552-57890574 AAAAAAAGAAAGATGGAGCTGGG - Intergenic
1109107157 13:58267847-58267869 ATAAAAATCAAGGTCTAGCTGGG - Intergenic
1111307380 13:86433417-86433439 ATATAAATCAAGGTGCAATTTGG - Intergenic
1114067197 14:19071441-19071463 CTCTAAAGCAAGATGGAGCTGGG + Intergenic
1114095065 14:19328587-19328609 CTCTAAAGCAAGATGGAGCTGGG - Intergenic
1115374469 14:32658733-32658755 ATATGAAGCACAGTGGAGTTTGG + Intronic
1115553963 14:34529553-34529575 ATATAAATAAATGTGTAGCTTGG - Intronic
1118501399 14:66365715-66365737 AGATATAGCAATGTGGATCTGGG - Intergenic
1119851531 14:77869955-77869977 TTATAAAGAAAAGTGGGGCTGGG - Intronic
1119893134 14:78197924-78197946 ATATAAAGCAATATGAAGCATGG + Intergenic
1121043016 14:90765724-90765746 ATATAAAGCTTGCAGGAGCTAGG + Intronic
1121487659 14:94331095-94331117 ATAAACAGCCAGGTGGGGCTTGG - Intergenic
1122385084 14:101339344-101339366 ATATGTCGCAAGGTGCAGCTGGG + Intergenic
1122474374 14:101996466-101996488 ATACAAAGCAAGGTGGAGCTGGG - Intronic
1127135486 15:55918078-55918100 ATATAAAGAAATGTGCAGCTTGG - Intronic
1128778525 15:70342283-70342305 ATATTAAGCAAGGGAGAGCCAGG - Intergenic
1129441745 15:75586130-75586152 ATAAAAAGCAAGGAGGGGCCAGG - Intergenic
1130983169 15:88826771-88826793 ATATAAATCAAGGGGGATATGGG - Intronic
1130994910 15:88898265-88898287 ACATAAAGAAAGATGGGGCTGGG + Intergenic
1131685527 15:94763495-94763517 CTATATAACAAGGTGCAGCTAGG + Intergenic
1136039521 16:27566874-27566896 AGATAAAGGAAGGTGCAGATGGG - Intronic
1137250728 16:46738616-46738638 AAAGAAAGCAAGGTGGAGAATGG + Intronic
1137463294 16:48685601-48685623 AAGTATAGCAGGGTGGAGCTAGG + Intergenic
1137548591 16:49421269-49421291 AACTAAAGCAAGGTGGAGGGTGG + Intergenic
1138102011 16:54259754-54259776 ATTGAAAGGAAGGTGGAGGTGGG + Intronic
1138281649 16:55776502-55776524 ATGAAAGGCAAGGTGGAGCTGGG - Intergenic
1138367501 16:56493088-56493110 GTAAAAAGCAAGGTGGAGGCTGG + Intronic
1140749226 16:78008235-78008257 CTATAAAGCAAGCTGGAGACTGG - Intergenic
1142787781 17:2237803-2237825 ATAAAAAGCAAGTTCAAGCTTGG + Intronic
1142796888 17:2314946-2314968 ATTAAAAGAAAGGTGGAGCTGGG + Intronic
1142822905 17:2486127-2486149 ATATAGTTCAAGGTGAAGCTGGG + Intronic
1143159691 17:4861057-4861079 AGACAGAGCAAGGCGGAGCTGGG - Intronic
1144912755 17:18696561-18696583 GTATAAATCAATGTAGAGCTGGG + Intergenic
1147300063 17:39519252-39519274 AAAGAAAGCAAGCTGGAGGTTGG - Intronic
1147370064 17:39986389-39986411 AAAGAAATCAAGGAGGAGCTGGG - Intronic
1149444462 17:56703095-56703117 ATATTAAGGAAGGTGGGGCATGG + Intergenic
1150062189 17:62077962-62077984 ATATAAAGGAAGGGGGAGAAGGG + Intergenic
1155431934 18:25768660-25768682 TTCTAAAGTAAGGTGGATCTGGG - Intergenic
1155511086 18:26578023-26578045 AAGAAAAGCAAGGTGGAGATGGG - Intronic
1155658306 18:28217717-28217739 ATTTAAAGCAGGGTGGTGTTTGG + Intergenic
1156134030 18:34014423-34014445 ATATAAAGTAAAATGCAGCTGGG + Intronic
1158912836 18:62084809-62084831 ATAAAAAGCAAGGTGCAGGCTGG + Intronic
1161848837 19:6728314-6728336 ATTTAAAGCAGGGAGGAGCATGG - Intronic
1161931808 19:7345563-7345585 ATATAAATCAATGTCTAGCTGGG - Intergenic
1162846880 19:13399699-13399721 AGAAAAAGAAAGGTGGAGGTTGG - Intronic
1165880727 19:39041003-39041025 ATAAGAAGCCAGCTGGAGCTGGG - Intergenic
925898133 2:8488778-8488800 AAAGAGAGCAAGATGGAGCTGGG + Intergenic
928283906 2:29972418-29972440 ATATACAGCAAGGTGGCTCCAGG + Intergenic
928913050 2:36442085-36442107 ATATAAAGCAAGAAACAGCTGGG - Intronic
929055294 2:37871425-37871447 ATATCAAGCAACATGGAGCTTGG - Intergenic
929873492 2:45777301-45777323 ATATAAAGGAAGGGGGACCAAGG - Intronic
932884745 2:75539393-75539415 AGATAGGGCATGGTGGAGCTTGG - Intronic
933871184 2:86567066-86567088 GTATAAAACAAGGTGTATCTTGG - Intronic
936880288 2:117242364-117242386 ATAGAAAGCATGATGGAGTTAGG - Intergenic
937038353 2:118801352-118801374 GCATGAAGCAGGGTGGAGCTGGG - Intergenic
937448843 2:121983305-121983327 ATAAAAAGAAAGTTGGGGCTGGG - Intergenic
938747773 2:134296271-134296293 ATATAAAACTAGCTGGACCTGGG + Intronic
939393327 2:141597260-141597282 AGATAAAGCAAGTTGGAATTGGG - Intronic
940130453 2:150375490-150375512 GTATAAAGCTATGTGGAGGTGGG + Intergenic
942417968 2:175778489-175778511 ATATAAAGCACAGGGGTGCTAGG + Intergenic
944994784 2:205281329-205281351 TCATAGAGCAAGGTGGAGCCAGG + Intronic
946441822 2:219703365-219703387 AAATAAAGCAAGGTTAAGCAAGG + Intergenic
947431394 2:230031605-230031627 ATATAAAAGAAAGTAGAGCTAGG + Intergenic
948779004 2:240305480-240305502 GTATAGAGCCACGTGGAGCTAGG - Intergenic
1169569980 20:6895662-6895684 ATATTATACCAGGTGGAGCTAGG - Intergenic
1170146597 20:13181722-13181744 ATCTAAAAAGAGGTGGAGCTGGG - Intergenic
1173761104 20:45561427-45561449 ATAGAAAGTAAGGTAGTGCTTGG - Intronic
1174660049 20:52204502-52204524 ATATAGAGATCGGTGGAGCTAGG + Intergenic
1174723174 20:52835380-52835402 AAATATGGCAAGGTGGAGCATGG + Intergenic
1177999856 21:28148902-28148924 AGATTAAGCAAGTTTGAGCTGGG + Intergenic
1178935104 21:36854946-36854968 ATGTAAATCAAGGGGGAGTTGGG + Intronic
1180485673 22:15794008-15794030 CTCTAAAGCAAGATGGAGCTGGG + Intergenic
1182284555 22:29237479-29237501 ACATAAAGAAAGGAGGAGCATGG - Intronic
1183205625 22:36417018-36417040 ATAAAAGTCCAGGTGGAGCTGGG - Intergenic
951103533 3:18716818-18716840 ATTTTAAGCTAGGTGGAGTTTGG + Intergenic
951129612 3:19026198-19026220 ATATAAAGCATGGTGAGTCTAGG - Intergenic
951808787 3:26676980-26677002 ATATAAAGCAGGGTTGGGCAAGG + Intronic
952088839 3:29859639-29859661 ATAACAAGCAAGGCGTAGCTAGG - Intronic
955502653 3:59600274-59600296 ATATAATAAATGGTGGAGCTGGG + Intergenic
955597531 3:60607976-60607998 ATATAAGGCAAGTGGGAGCAGGG - Intronic
955914577 3:63893898-63893920 AGTGAAAGCAAGGTGGAACTGGG + Intronic
956091933 3:65677319-65677341 GTATAGAGCAAGGTGGAGATGGG + Intronic
956440829 3:69278882-69278904 ATAAAAAGCAATTTGGAGCAGGG - Intronic
956533407 3:70247731-70247753 ATATAAAGCAAGTGGGACCAAGG + Intergenic
957015363 3:75057061-75057083 ATATAAATCTAGGTGGGGTTGGG - Intergenic
957844008 3:85707120-85707142 GTATAAAGTAAGGTTGGGCTTGG - Intronic
958032208 3:88125507-88125529 ATCTAAAGCAAAGTAGAGGTTGG + Intronic
965425530 3:168518054-168518076 ATACCAAGCAAGGCGGAGCCAGG - Intergenic
965597854 3:170425590-170425612 GAAGAAAGCAAGGTGGGGCTGGG + Intronic
966544587 3:181131530-181131552 ATACAAAACAAGGCAGAGCTGGG - Intergenic
970157035 4:13152033-13152055 ACACAGAGCAAGATGGAGCTAGG + Intergenic
970950910 4:21754275-21754297 AAATAAAGCAAGGTAGAGAGAGG - Intronic
971467563 4:26980057-26980079 ATTTAAAGAAAAGTGGGGCTGGG - Intronic
971498112 4:27289266-27289288 ATATAAAAGGATGTGGAGCTTGG - Intergenic
973820171 4:54656462-54656484 CTGTGAAGCAAGGAGGAGCTAGG - Intergenic
974224383 4:59019514-59019536 ATAAGAAGCAAGGAGGAGGTGGG - Intergenic
976497252 4:85744579-85744601 AGATAAAGAGAGGTTGAGCTGGG + Intronic
977701300 4:100026028-100026050 ATTTAAATCAATCTGGAGCTGGG - Intergenic
977931083 4:102749623-102749645 ATATAATGGATGGTGGAGCAAGG - Intronic
977987337 4:103398771-103398793 ATATAAGGTAAGGTGCATCTTGG + Intergenic
978700365 4:111636641-111636663 AGATAAAGCAAGCTGGTGCCCGG + Intergenic
979325179 4:119370740-119370762 CTATCCTGCAAGGTGGAGCTTGG - Intergenic
982940160 4:161540490-161540512 AAATAAATCAAGGTGAAACTAGG - Intronic
983055885 4:163098307-163098329 ATAGAAAGCAAAGTAGAACTTGG - Intergenic
983243084 4:165255764-165255786 CTATCCTGCAAGGTGGAGCTTGG - Intronic
985895335 5:2747477-2747499 ACATTAAGCAAGTTGGTGCTGGG + Intronic
986336126 5:6757183-6757205 CTATAAAGCAAGTTGCAGCAGGG + Intergenic
986595133 5:9413436-9413458 GTATTGAGCAAGATGGAGCTAGG + Intronic
987247091 5:16060065-16060087 ATTTAACGCAAGGAGGACCTTGG - Intergenic
988309868 5:29543330-29543352 AAATACAGCAAGGGTGAGCTTGG - Intergenic
988829461 5:34973216-34973238 AGATAAAGCAAGGTACAGGTAGG + Intergenic
989416361 5:41181984-41182006 GTATAAAACAAGGTGGGACTTGG - Intronic
994082668 5:95724890-95724912 ATATAAAGAATTATGGAGCTGGG + Intronic
995833242 5:116376472-116376494 ACAGAAAGCAAGGTATAGCTGGG + Intronic
996545489 5:124674088-124674110 ATAAAAATCATCGTGGAGCTTGG + Intronic
997021038 5:130002079-130002101 CTATAAACAAAGGTGGTGCTTGG + Intronic
997295255 5:132764858-132764880 AGCTAAAGCCATGTGGAGCTAGG - Intronic
997491308 5:134278892-134278914 ATTGAAAGAAAGCTGGAGCTGGG - Intergenic
998108899 5:139486280-139486302 AGATAAAGTAAGCTGGGGCTTGG + Intergenic
999100905 5:149025160-149025182 AATGAAAGCAGGGTGGAGCTGGG + Intronic
999647898 5:153737336-153737358 ATATGAAACAATTTGGAGCTCGG + Intronic
1002114558 5:176948739-176948761 ATTCAAAACATGGTGGAGCTGGG + Intronic
1003252985 6:4448244-4448266 ATAGAAAGGAAGATGGTGCTGGG - Intergenic
1004473236 6:15947539-15947561 AGGTAAAGAAAGGTGGAGGTAGG + Intergenic
1005002631 6:21258416-21258438 ATTTAAAACAGAGTGGAGCTAGG - Intergenic
1006269193 6:32950859-32950881 AAAAACAGCAAGGTGGGGCTAGG + Intronic
1006434351 6:34018547-34018569 AGACAAAGAAAGGTGGAGTTGGG - Intergenic
1009252718 6:61327200-61327222 ATAAAAAGAAAGGTTCAGCTCGG - Intergenic
1009257404 6:61429021-61429043 ATAAAAAGAAAGGTTCAGCTCGG - Intergenic
1011881478 6:92033645-92033667 AAACAAGGCAAGGTGTAGCTAGG - Intergenic
1013280693 6:108634278-108634300 ATATAAAGGAGGGTGAAGATGGG + Intronic
1013845154 6:114441458-114441480 ATAAAGAGCAAGAAGGAGCTGGG + Intergenic
1014341435 6:120212461-120212483 ATATAAAGCAAGTTGCCACTAGG + Intergenic
1015475302 6:133653726-133653748 ATTTAAAGCAGGGTGGTGTTTGG + Intergenic
1015693302 6:135951205-135951227 ATAAAAAGGAAGGTGGAGAGGGG - Intronic
1016464488 6:144312128-144312150 ATATAAAGCAATTTGGGGCCAGG + Intronic
1018511317 6:164527379-164527401 ATATAAAACAATGTGCAGCCGGG + Intergenic
1018867511 6:167757863-167757885 ATATTTAGCACGGTGGAGCGGGG + Intergenic
1019837411 7:3402278-3402300 TTATAAAGGATGGTGAAGCTTGG + Intronic
1021946767 7:25735392-25735414 ATAAAAAGAAAGGTGGAAATGGG - Intergenic
1023496780 7:40806305-40806327 ATTTAAAGCAGGGTGGATTTAGG - Intronic
1024557011 7:50612530-50612552 ATATTAAACAGGGTAGAGCTAGG - Intronic
1028785465 7:94787335-94787357 ATATAAAGTAAGATGATGCTAGG + Intergenic
1028951118 7:96636196-96636218 ATATAACACAAGGTGAAGCAAGG + Intronic
1029366187 7:100118063-100118085 AAAAAAAGCAAAGTGGAGCCAGG + Intronic
1030583184 7:111385144-111385166 AAATAAGGCAAGGTGGAGGTGGG + Intronic
1032626886 7:133601069-133601091 ATATAAACAAAGGGGAAGCTGGG - Intronic
1033398853 7:141002008-141002030 AGACAAGGCTAGGTGGAGCTCGG + Intergenic
1034398748 7:150847556-150847578 CTATATACAAAGGTGGAGCTAGG - Intronic
1035939472 8:3881338-3881360 ATAAAAAGCAAGTTGGGGCCGGG + Intronic
1036443347 8:8800764-8800786 AGATAAAAGCAGGTGGAGCTGGG - Intronic
1036515079 8:9436555-9436577 ATATAAAGAAAGGTGAGGCCGGG + Intergenic
1038349702 8:26764618-26764640 ATATAAAGAAAAGAGGAGGTGGG - Intronic
1039239216 8:35536700-35536722 ATAAAAAGCAAGGTGTGGCTGGG + Intronic
1041243396 8:55868697-55868719 AGATAATACATGGTGGAGCTAGG + Intergenic
1041723792 8:60999675-60999697 TAATAAAGCAAGAGGGAGCTAGG + Intergenic
1042367714 8:67955532-67955554 ATACAAAGCAAGGAGCACCTGGG - Intronic
1043039246 8:75240279-75240301 AGATAAAGCAAAGAGGAGCATGG - Intergenic
1045551598 8:103177628-103177650 AAATAGGGCAAGGTGGTGCTTGG + Intronic
1047685912 8:127304541-127304563 AAATTAATCAAGTTGGAGCTGGG - Intergenic
1048341477 8:133542477-133542499 ATATAAAGAAAGGAAGGGCTGGG + Intronic
1049330405 8:142047467-142047489 AGAAAAAGCACGGTGGAGCAGGG - Intergenic
1050208695 9:3228232-3228254 AAAAAAAGCAAGGTGGACTTAGG - Intronic
1055231758 9:74074738-74074760 ATTAGAAGCAAGGTGGAGTTGGG + Intergenic
1055685285 9:78766817-78766839 ATGGAAAGCAAGGAGGAGCCAGG - Intergenic
1056842420 9:90009267-90009289 ATATTAACCAAGGTGTAGATTGG + Intergenic
1058650455 9:107171060-107171082 ATAGAAGTCAATGTGGAGCTGGG - Intergenic
1058970046 9:110072824-110072846 GTATCAACCAAGGTAGAGCTGGG - Intronic
1059457653 9:114409825-114409847 AAATAAAGCAAGGTGGAGTGGGG - Intronic
1059891541 9:118809971-118809993 TGAGAAAGCAAGGTGGAGGTGGG + Intergenic
1187584017 X:20639806-20639828 ATATAAACCATGGTGAAGGTGGG - Intergenic
1188728304 X:33612006-33612028 GTATTAAGCAAGGTGGAGAAAGG + Intergenic
1188744953 X:33830119-33830141 ATAAAAAGCAGGGTGGAGTGAGG - Intergenic
1190992391 X:55565989-55566011 AGGAAAAGCAAGGTGGAGCCAGG + Intergenic
1192749489 X:73973926-73973948 ATATAAAGCAAGATGAAGAAAGG - Intergenic
1194574026 X:95589360-95589382 ATATACAGCAGGGTGAAGCATGG - Intergenic
1195482817 X:105367147-105367169 ATAAAAAGCAAAGGGGAGCAGGG - Intronic
1199455412 X:148022206-148022228 AGATAAAGAAAAGTGGAGGTGGG - Intronic
1200499674 Y:3930791-3930813 ATATAAAGGAACTTGTAGCTAGG - Intergenic