ID: 915075567

View in Genome Browser
Species Human (GRCh38)
Location 1:153306036-153306058
Sequence CAGCGACAACAGCAGGATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 225}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915075563_915075567 -5 Left 915075563 1:153306018-153306040 CCAAACCAGAAAACACAGCAGCG 0: 1
1: 0
2: 1
3: 8
4: 132
Right 915075567 1:153306036-153306058 CAGCGACAACAGCAGGATGGTGG 0: 1
1: 0
2: 1
3: 25
4: 225
915075564_915075567 -10 Left 915075564 1:153306023-153306045 CCAGAAAACACAGCAGCGACAAC 0: 1
1: 0
2: 0
3: 14
4: 153
Right 915075567 1:153306036-153306058 CAGCGACAACAGCAGGATGGTGG 0: 1
1: 0
2: 1
3: 25
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915075567 Original CRISPR CAGCGACAACAGCAGGATGG TGG Intronic
901040281 1:6359335-6359357 CAGCTCCATCAGCAGGATGCAGG - Intronic
902394502 1:16125301-16125323 CAGCGACATCAAGAGGATTGGGG - Exonic
903327120 1:22575682-22575704 CAGCAAGAAGAGCAGGGTGGAGG + Intronic
903577019 1:24345360-24345382 CAGGGAGAAAAGCAGGCTGGGGG - Intronic
905546449 1:38804094-38804116 CAGCGGCCACAGCGGGAGGGTGG - Intergenic
907916539 1:58874989-58875011 CTGCAACAACAGCAGCCTGGTGG - Intergenic
909405325 1:75282080-75282102 CAGTGACAACAGCTGGAAAGGGG + Intronic
911829262 1:102530111-102530133 CAGGGAGGGCAGCAGGATGGAGG - Intergenic
912823820 1:112887711-112887733 CAGCCAAAGCAGCAGGAAGGCGG - Intergenic
913213861 1:116603735-116603757 CATCTTCAACAGCAGGAAGGAGG - Exonic
913366643 1:118047216-118047238 GAGTGACATCAGCAAGATGGTGG + Intronic
913985854 1:143565430-143565452 CTGCGACAGCAGCTGGATAGCGG + Intergenic
915075567 1:153306036-153306058 CAGCGACAACAGCAGGATGGTGG + Intronic
916524824 1:165599636-165599658 AAGCGACTTCAGCAGAATGGAGG - Intergenic
917665144 1:177218906-177218928 AAGTGACATCAGCAAGATGGTGG - Intronic
918444363 1:184602133-184602155 CAGTGACAATAGCAGGGTGAGGG - Intronic
919721327 1:200839695-200839717 CAGGGAAAAAAGCAGGAGGGAGG + Intronic
920072043 1:203308976-203308998 AAGGGGCAACAGCAGGAGGGTGG - Exonic
920459525 1:206128582-206128604 CAGCTACAACAAGAGGAGGGAGG + Intergenic
921399630 1:214707268-214707290 TAACGAGAACAGCAGCATGGTGG - Intergenic
921764431 1:218953504-218953526 CAGCAGCAGCAGCAGGAGGGAGG + Intergenic
922171516 1:223159571-223159593 CAGCACCAACAGCAGGAAAGAGG - Intergenic
923791871 1:237118525-237118547 CAGAGACAACGGTAGAATGGTGG + Intronic
1067256994 10:44651126-44651148 TAAAGACAACAGCAGGGTGGAGG - Intergenic
1068721153 10:60247544-60247566 CGGAGACAAAAGTAGGATGGTGG - Intronic
1069800990 10:71081362-71081384 CAGTTAGAGCAGCAGGATGGAGG - Intergenic
1069808110 10:71138560-71138582 CGGGGACCACAGCAGGAGGGCGG - Intergenic
1072599918 10:96915908-96915930 CAGCGACGGCGGCAGGATGTAGG + Intronic
1076731648 10:132442423-132442445 AAGGGACAGCAGCAGAATGGAGG + Intergenic
1076925430 10:133481441-133481463 CATGGACAACAGCAGAGTGGTGG + Intergenic
1077386881 11:2273603-2273625 GAGTGACAACAGAGGGATGGGGG + Intergenic
1077415389 11:2422226-2422248 CAGGGACACCACCAGGTTGGGGG + Exonic
1078203285 11:9204074-9204096 CAGAGACCAGAGCAGCATGGAGG - Exonic
1079079924 11:17407008-17407030 CAACGACAGGAGCAGGATGCCGG + Exonic
1079099284 11:17530893-17530915 CAGCGGCAGCAGCTGGAAGGAGG + Intronic
1080120064 11:28666866-28666888 CAGTGAGCACAGCAGGAGGGAGG + Intergenic
1081380380 11:42407510-42407532 CAGCGCCACCAGCAGGAGAGTGG + Intergenic
1081871512 11:46384683-46384705 CACCGATTACAGCAGAATGGGGG + Intergenic
1083475114 11:62910316-62910338 CAGCGACAGCAGCGGCCTGGAGG + Exonic
1083642146 11:64151260-64151282 CAGCGACATCACCAAGCTGGAGG - Exonic
1086731709 11:90257764-90257786 TAAAGACATCAGCAGGATGGAGG - Intergenic
1089099838 11:115953131-115953153 GAGTGACATCAGCAAGATGGTGG - Intergenic
1089301065 11:117498760-117498782 CAGCCACAACATCAGGAGCGGGG - Intronic
1093103104 12:15051832-15051854 CATCTACAACAGTAGGTTGGTGG - Intergenic
1093899319 12:24612315-24612337 GAGTGACTACAGCAAGATGGTGG + Intergenic
1094208911 12:27869849-27869871 CAGTGCCAGCAGGAGGATGGCGG + Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096715223 12:53487126-53487148 CAGCTACATGAGCAGGATGCAGG - Exonic
1097358557 12:58631293-58631315 CAGTGATATCAGCAAGATGGTGG + Intronic
1097872172 12:64610638-64610660 CAGCGGCTACAGCAGCCTGGAGG + Exonic
1098518154 12:71402704-71402726 GAGTGACATCAGCAAGATGGTGG + Intronic
1099363749 12:81742073-81742095 CAGCAAGAACACCAGGATGGTGG + Intronic
1100823861 12:98456867-98456889 CAGCGTGAGCAGCAGGATGAAGG + Intergenic
1101167300 12:102052014-102052036 GTGGGACAACAGCAAGATGGGGG + Intronic
1101981017 12:109406914-109406936 CCTCGATAACAGCAGGGTGGTGG + Intronic
1102415386 12:112757962-112757984 CAGCTGCCACAGCAGGATGGTGG - Intronic
1104689589 12:130815348-130815370 CAGGAACTACAGGAGGATGGAGG - Intronic
1105217091 13:18294286-18294308 CATCTTCAACAGCAGGAAGGAGG - Intergenic
1106509002 13:30396949-30396971 TAGAGACAACAGCAGAATGGTGG - Intergenic
1108639708 13:52371709-52371731 CAGCAGCAGCAGCAGGATGGGGG + Intergenic
1110352347 13:74523369-74523391 CAGTAACAACAGCAGGAAAGGGG - Intergenic
1112393786 13:99009688-99009710 CAGACACACAAGCAGGATGGGGG + Intronic
1112598073 13:100828048-100828070 CAACAAGAACAGGAGGATGGAGG - Intergenic
1114325901 14:21588362-21588384 CAGCGACAAAGGCAGGAGGTGGG + Intergenic
1116496450 14:45566431-45566453 CAGTGACAGCATCATGATGGTGG - Intergenic
1117547083 14:56802294-56802316 CAGCAACAACAGCAGAATGGAGG - Exonic
1117644490 14:57837321-57837343 CAGCGAAAAGAGCAGAAGGGAGG + Intronic
1118439509 14:65799862-65799884 CAGCCTCAACAGCAGGCAGGAGG + Intergenic
1119204482 14:72783883-72783905 CAGGGGCAGCGGCAGGATGGGGG + Intronic
1121521069 14:94586650-94586672 CAGCCAGAACAGGAGGACGGTGG + Intronic
1122361477 14:101169393-101169415 CATTGACATCAGCAGGGTGGGGG + Intergenic
1122820439 14:104342134-104342156 CAGCGCCACCTGCAGGCTGGAGG + Intergenic
1123105802 14:105840566-105840588 CAGCCACATCAGGAGGATGTTGG + Intergenic
1123768938 15:23509850-23509872 CAGGGGCAACAGCAGAATTGGGG + Intergenic
1127474076 15:59315772-59315794 CAGCAACAGCAGCAGCATTGGGG - Intronic
1129296974 15:74604935-74604957 CAGCCACAGGAGCAGGATGCAGG - Intronic
1130330523 15:82918656-82918678 CAGGGAGAACAGCAGCAGGGAGG - Intronic
1133290352 16:4716567-4716589 CAGAGTCAAAAGTAGGATGGGGG - Intronic
1133365805 16:5208715-5208737 GAGGGACAACAACACGATGGAGG - Intergenic
1135109814 16:19681845-19681867 CAACCACAAAAGCAGGATCGCGG - Intronic
1138581787 16:57946333-57946355 CAGCCCCAAAAGCAGGAAGGAGG + Intronic
1139503048 16:67383837-67383859 CACCTACAATAGAAGGATGGTGG - Intronic
1140836770 16:78801717-78801739 GAGGGACAATGGCAGGATGGGGG - Intronic
1141904085 16:87011510-87011532 CAGTGAGATCAGCAGGTTGGAGG - Intergenic
1142209193 16:88799877-88799899 CAGAGACCACCTCAGGATGGGGG - Intergenic
1143376868 17:6472172-6472194 CAGGGAGAACAGCAGGAGCGAGG - Intronic
1143926966 17:10379796-10379818 CAGCAATGTCAGCAGGATGGTGG + Intergenic
1144137756 17:12314618-12314640 CAGTGGCAGCAGCAGGAGGGTGG + Intergenic
1144634249 17:16893972-16893994 CAGCGCCAGCAGCAGGAGGGCGG - Intergenic
1145168363 17:20633867-20633889 CAGCGCCAGCAGCAGGAGGGCGG - Intergenic
1146961263 17:36982031-36982053 CAGAGAGAAAAGCAGAATGGTGG - Intronic
1147193442 17:38749811-38749833 CAGCCACACCAGCGGGACGGGGG + Exonic
1149130443 17:53294857-53294879 AAGTGACATCAGCAAGATGGAGG + Intergenic
1149516991 17:57288286-57288308 CAGCGACAACAGCTGGGTCCAGG - Intronic
1151188197 17:72379136-72379158 CAATGGGAACAGCAGGATGGGGG + Intergenic
1151214427 17:72568006-72568028 AAGCTACAACAGCCGGAAGGAGG + Intergenic
1155612707 18:27684762-27684784 CAGCCAAAACAGTAGGATTGGGG + Intergenic
1156156560 18:34309588-34309610 CAGCAATAGCAGCAAGATGGTGG - Intergenic
1159385318 18:67717244-67717266 TAGAGACTACAGCTGGATGGAGG + Intergenic
1160847299 19:1172268-1172290 GATGGAGAACAGCAGGATGGGGG - Intronic
1160899219 19:1418796-1418818 GAGCGACAACAGCAGATTGAAGG - Intronic
1160974245 19:1784897-1784919 CAGGACCACCAGCAGGATGGAGG + Exonic
1161404352 19:4083302-4083324 CAGGGGAGACAGCAGGATGGTGG + Intergenic
1161585272 19:5102341-5102363 CAGAGGCAACTGCAGGAAGGAGG - Intronic
1162341647 19:10094860-10094882 CAGTGACACCAGTAGGATGCTGG - Exonic
1168644272 19:58050057-58050079 GAGCGACATCACCAAGATGGTGG - Intronic
926971744 2:18473602-18473624 CTGAGACAGCAGCAGCATGGAGG - Intergenic
927022097 2:19028102-19028124 AAGAAACAACAGCAGCATGGTGG + Intergenic
927922812 2:26986554-26986576 CAGCTGCAACAGAAAGATGGGGG + Intronic
928398181 2:30959097-30959119 CAGCGGCAGCAGCAGGAGAGAGG - Intronic
929590562 2:43143061-43143083 CAGCAGCAGCAGCAGGAGGGAGG - Intergenic
929595896 2:43175633-43175655 CAGGGGCAAGAGAAGGATGGAGG + Intergenic
929738044 2:44572173-44572195 CAGAGACAAAAGTAGAATGGTGG - Intronic
930974252 2:57436087-57436109 TAGTGACATCAGCAAGATGGTGG - Intergenic
931336935 2:61354968-61354990 CAGCAACAACAGAGGGATGTGGG - Intronic
933336322 2:80964198-80964220 CAGCAGCAGCAGCAGCATGGTGG + Intergenic
934297233 2:91752396-91752418 CATCTTCAACAGCAGGAAGGAGG + Intergenic
934579400 2:95426563-95426585 AAGGGACAAGAGCAGGAAGGAGG - Intergenic
934600043 2:95650161-95650183 AAGGGACAAGAGCAGGAAGGAGG + Intergenic
936533388 2:113292165-113292187 AAGGGACAAGAGCAGGAAGGAGG + Intergenic
939143070 2:138378912-138378934 CAAGGACATCAGCAGGATAGTGG + Intergenic
939703091 2:145419090-145419112 AAGTGACATCAGCAAGATGGTGG + Intergenic
944299274 2:198104194-198104216 CAGGGACTACATGAGGATGGAGG - Intronic
946256303 2:218444706-218444728 CAGTGACAACAGTGGGGTGGTGG + Intronic
946431980 2:219631014-219631036 CAGCAGTAGCAGCAGGATGGGGG + Intronic
1169778929 20:9288004-9288026 CAGCTCCACCAGCAGGATTGTGG + Intronic
1170359721 20:15532781-15532803 TAAGGACAACACCAGGATGGGGG - Intronic
1170374137 20:15681407-15681429 CAAAGACTTCAGCAGGATGGGGG - Intronic
1170791211 20:19511051-19511073 CAGGGTCAGCAGCAGGGTGGGGG - Intronic
1172452586 20:35038028-35038050 CAGAGAAAAAAGCAGAATGGTGG + Intronic
1173112740 20:40208719-40208741 TAACGAAAACAGCATGATGGTGG + Intergenic
1173871698 20:46346167-46346189 CGGCCCCACCAGCAGGATGGTGG + Intronic
1175082566 20:56433329-56433351 TAGAGAGAACAGCATGATGGAGG + Intronic
1175194804 20:57235656-57235678 CAGAGGCAACAGCATGATCGAGG + Intronic
1176019348 20:62954578-62954600 CCGCGCCCCCAGCAGGATGGAGG + Intronic
1177720759 21:24903778-24903800 CAGCCACAACAACAGGGTAGGGG - Intergenic
1178884600 21:36475380-36475402 CTGCGGCTACAGCAGGAGGGTGG - Intronic
1179791394 21:43757793-43757815 CCGCCACACCAGCAGGAAGGAGG + Exonic
1180802105 22:18636761-18636783 CATCGACGCCAGCAGGAAGGTGG + Intergenic
1181097746 22:20517508-20517530 CAGTGAAAAGAGCAGGGTGGTGG - Intronic
1181219618 22:21358498-21358520 CATCGACGCCAGCAGGAAGGTGG - Intergenic
1181584674 22:23846621-23846643 CAGCGGCCACAGCAGGAAGTGGG - Intergenic
1181829059 22:25544754-25544776 CAGTAACAACAGCAGCGTGGTGG - Intergenic
1181933879 22:26426246-26426268 CAGCGAGAGCAGGAGGATGCAGG + Intergenic
1184005988 22:41709496-41709518 CAGCGACGGCAGCGGGATGTAGG + Intronic
1184474080 22:44711328-44711350 CAGAGGGAACAGCAGGATGGAGG + Intronic
1184825906 22:46950649-46950671 AAGGAACAACAGGAGGATGGTGG + Intronic
1185342247 22:50296865-50296887 CAGTGACACCAGCAGGGGGGCGG + Intronic
952196056 3:31076258-31076280 GAGCGTGAAAAGCAGGATGGTGG + Intergenic
952641804 3:35605092-35605114 CAGCAACAACATCAGGAGGAAGG + Intergenic
954430739 3:50469754-50469776 CAGGGGCAATAGCTGGATGGTGG - Intronic
956609144 3:71104392-71104414 CAGCAACAGCAGCAGAAGGGCGG - Intronic
960688145 3:120314231-120314253 CAGCAGCAGCAGCAGCATGGTGG - Intergenic
964027132 3:152088161-152088183 CAGGAAAAACAGCAGGATGGGGG + Intergenic
968354791 3:198097565-198097587 CAGAAACAACAATAGGATGGTGG + Intergenic
969049012 4:4359434-4359456 CTGCCACAAGAACAGGATGGGGG - Intronic
971744716 4:30565340-30565362 TCACGAGAACAGCAGGATGGGGG - Intergenic
973116777 4:46470776-46470798 CAGAGACATCATCAGCATGGCGG - Intronic
974385869 4:61201582-61201604 CAGAGAAAGCAGCAGGAGGGTGG - Intronic
974967801 4:68784253-68784275 TAGTGACATCAGCAAGATGGTGG - Intergenic
975002935 4:69247603-69247625 GAGTGACATCAGCAAGATGGTGG - Intergenic
975011217 4:69354961-69354983 GAGTGACATCAGCAAGATGGTGG - Intronic
977921614 4:102650634-102650656 CATCGACAACATCACGAAGGTGG - Exonic
978205547 4:106076396-106076418 CAGCAACAGCAGCAGTATTGTGG + Intronic
978652786 4:111027297-111027319 CAGTGACAACAGGAAGAAGGAGG - Intergenic
980792028 4:137632454-137632476 CAGCAGCAGCAGCAGCATGGGGG - Intergenic
981511962 4:145567021-145567043 CAGCAGCAGCAGCAGCATGGCGG - Intergenic
982584093 4:157215393-157215415 GAGCTACATCAGCAAGATGGTGG - Intronic
983813101 4:172088806-172088828 CAGAGATAACAGCAGGGTAGGGG + Intronic
988455950 5:31387421-31387443 CGGAGAAAACAGGAGGATGGAGG + Intergenic
990330031 5:54716282-54716304 GAGTGACATCAGCAAGATGGTGG + Intergenic
991162665 5:63523148-63523170 CAGTGACAACTTCAGTATGGTGG - Intergenic
991310013 5:65228453-65228475 GAGTGACATCAGCAAGATGGTGG + Intronic
992035874 5:72775548-72775570 CAGTGACATCAGCAAGATTGTGG + Intergenic
993010500 5:82477293-82477315 CAGTGACAAGAGCAGAAAGGGGG - Intergenic
994279512 5:97885215-97885237 GAGTGACATCAGCAAGATGGTGG + Intergenic
996468927 5:123836855-123836877 CAGCAACTATAGCAGCATGGTGG - Intergenic
998546490 5:143032306-143032328 AAGCCTCAACTGCAGGATGGTGG + Intronic
998918562 5:147042374-147042396 CAGGTACAACAACAGGGTGGGGG + Intronic
1002319377 5:178365897-178365919 CAGTGAACACAGCAGGAAGGGGG + Intronic
1004516906 6:16328187-16328209 CAGCGACAACCACCGGGTGGAGG - Exonic
1006516648 6:34549276-34549298 CAGAGACAGGAGCAGAATGGTGG + Intronic
1007543456 6:42671754-42671776 AAATGACAACTGCAGGATGGAGG - Intronic
1009980112 6:70717685-70717707 CAGTGACATCAGCAAGATGATGG - Intronic
1010678966 6:78777008-78777030 CCATGACAGCAGCAGGATGGAGG + Intergenic
1017971753 6:159317822-159317844 AAGGGGCAAAAGCAGGATGGAGG + Intergenic
1018681620 6:166270192-166270214 CAGGGAGGACAGGAGGATGGAGG + Intergenic
1018837741 6:167497922-167497944 TCACGACAACAGCAGCATGGGGG - Intergenic
1020034939 7:4959088-4959110 CGGCGGCAGCAGCAGGTTGGAGG + Exonic
1020469192 7:8516615-8516637 CAAGGCCAACAGCAGAATGGGGG + Intronic
1021952078 7:25785176-25785198 CAGTGGCAACATCAAGATGGTGG - Intergenic
1023908721 7:44539445-44539467 CAGGGACAAAAGCAAGATGGTGG - Exonic
1024637731 7:51304148-51304170 CAGCCACACCTGCATGATGGAGG + Intronic
1024825052 7:53381478-53381500 CAGTGACAGCAGCAGGCTGATGG - Intergenic
1026681096 7:72467259-72467281 CAGCCCCACCAGCAGGATTGGGG - Intergenic
1026867659 7:73833365-73833387 CTGCAACAACAGCGGGGTGGGGG - Intergenic
1028639850 7:93029834-93029856 CAGTGACAATGGCAGGAAGGTGG - Intergenic
1028791069 7:94853586-94853608 CAGGGAGAAGAGAAGGATGGGGG - Intergenic
1028918248 7:96283556-96283578 CAGTGCCAACAGCATGCTGGGGG - Intronic
1031975287 7:128089783-128089805 CAGCAGGAACAGCAGGATGGTGG - Intronic
1032954119 7:136950775-136950797 CAACAACAACAACAGGTTGGGGG - Intronic
1034310522 7:150083786-150083808 GAGAGAAAACAGCAGTATGGAGG - Intergenic
1034457233 7:151177437-151177459 CAGAGAGGAGAGCAGGATGGTGG - Intronic
1036306946 8:7609982-7610004 TAGGGAGAACAGCAGGATAGGGG + Intergenic
1036893153 8:12608976-12608998 TAGGGAGAACAGCAGGATAGGGG - Intergenic
1037997722 8:23365662-23365684 CAGCGGCTGGAGCAGGATGGAGG - Intronic
1038432153 8:27509056-27509078 TAGAGAAAAAAGCAGGATGGGGG - Intronic
1039514309 8:38119311-38119333 AAGCGCAAACAGCAGGATGGAGG + Exonic
1040535879 8:48309402-48309424 GAGTGACATCAGCAGGATGGAGG + Intergenic
1040676368 8:49756034-49756056 CAGTAACAACAGCAGGGAGGAGG - Intergenic
1041683611 8:60620734-60620756 CAGGGAGGACAGCAGGCTGGGGG + Exonic
1041691395 8:60691486-60691508 CAGTGAGAAAAGGAGGATGGGGG - Intronic
1044313882 8:90727060-90727082 CAGCGGCAGCAGCAGCATGGTGG - Intronic
1047493071 8:125390222-125390244 CAGCGGCAGCAGCAGCGTGGGGG - Intergenic
1049098116 8:140560692-140560714 CTGTGACAGCAGCAGGCTGGGGG + Intronic
1050928472 9:11296463-11296485 CAGCAGCAACAGCAGCACGGTGG + Intergenic
1055760219 9:79599089-79599111 CAGTGCCAAGAGGAGGATGGAGG + Intronic
1057412028 9:94825288-94825310 CAGGCAAAACAGCAGGATGCGGG - Intronic
1060723685 9:125994203-125994225 CAGAGCTAAGAGCAGGATGGAGG - Intergenic
1061133592 9:128721418-128721440 GAGGGACAGCAGCAGGAAGGTGG + Exonic
1062178909 9:135180160-135180182 CAGTGACAACAGGAGGAGTGAGG + Intergenic
1062415648 9:136448280-136448302 CAGAGACACCAGGAGAATGGAGG + Intronic
1062415656 9:136448317-136448339 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415665 9:136448355-136448377 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415676 9:136448392-136448414 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415687 9:136448429-136448451 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415695 9:136448466-136448488 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415706 9:136448504-136448526 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415714 9:136448541-136448563 CAGAGACGCCAGGAGGATGGAGG + Intronic
1062415731 9:136448612-136448634 CAGACACACCAGGAGGATGGAGG + Intronic
1062415740 9:136448650-136448672 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415748 9:136448686-136448708 CAGAGACACCAGGAGAATGGAGG + Intronic
1062415758 9:136448724-136448746 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415769 9:136448762-136448784 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415778 9:136448800-136448822 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415786 9:136448836-136448858 CAGAGACACCAGGAGGATGGAGG + Intronic
1062582821 9:137235983-137236005 CAGGTACCACAGCAGGATGCCGG - Exonic
1185754037 X:2638496-2638518 CCGCCACAACAGCACCATGGGGG - Intergenic
1186533913 X:10327878-10327900 CAGCGTCAACTAGAGGATGGAGG + Intergenic
1189294707 X:39910202-39910224 CAGCGTCAACAGCAGGCAGCAGG + Intergenic
1190711452 X:53073522-53073544 TAGCTACAACAGCAGCCTGGGGG - Intronic
1190968517 X:55326442-55326464 CAGGCTCAACAGCAGAATGGGGG - Intergenic
1191225741 X:58040910-58040932 CAGCAACAGTAGCAGCATGGTGG - Intergenic
1193821603 X:86171698-86171720 CAGCAGCAACAGCAGCATGTGGG - Intronic
1195963540 X:110409618-110409640 CAGCAACAACAGAAAAATGGGGG - Intronic
1196320656 X:114335612-114335634 AAGTGACATCAGCAAGATGGTGG - Intergenic
1197453613 X:126649143-126649165 CAGCTAGCACAGCAGGTTGGTGG - Intergenic
1197894855 X:131301977-131301999 CAATGAAAATAGCAGGATGGGGG + Intronic
1199977592 X:152903595-152903617 CAGAGACAACTGCAGGATGAGGG + Intergenic
1199988323 X:152968583-152968605 CTGGGCCAGCAGCAGGATGGTGG + Intronic