ID: 915075972

View in Genome Browser
Species Human (GRCh38)
Location 1:153308288-153308310
Sequence ATGAAGAAAGAGAAGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3713
Summary {0: 1, 1: 0, 2: 27, 3: 361, 4: 3324}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915075972_915075976 13 Left 915075972 1:153308288-153308310 CCAGCCTCCTTCTCTTTCTTCAT 0: 1
1: 0
2: 27
3: 361
4: 3324
Right 915075976 1:153308324-153308346 CTTTTTCTCTCCTTAGGCTGAGG 0: 1
1: 0
2: 1
3: 29
4: 313
915075972_915075975 7 Left 915075972 1:153308288-153308310 CCAGCCTCCTTCTCTTTCTTCAT 0: 1
1: 0
2: 27
3: 361
4: 3324
Right 915075975 1:153308318-153308340 TCTCTTCTTTTTCTCTCCTTAGG 0: 1
1: 1
2: 5
3: 153
4: 1293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915075972 Original CRISPR ATGAAGAAAGAGAAGGAGGC TGG (reversed) Intronic
Too many off-targets to display for this crispr