ID: 915076281

View in Genome Browser
Species Human (GRCh38)
Location 1:153310618-153310640
Sequence CTGGAGACCCAGAATGAAGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 490
Summary {0: 1, 1: 0, 2: 3, 3: 49, 4: 437}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915076281 Original CRISPR CTGGAGACCCAGAATGAAGA AGG Exonic
901143263 1:7049415-7049437 CAAGAGACACAAAATGAAGATGG - Intronic
901189071 1:7393843-7393865 CTGGAGAGGGAGGATGAAGAGGG - Intronic
901364158 1:8731199-8731221 CTGGAGGTCCAGACTTAAGAGGG + Intronic
902468367 1:16631561-16631583 CTGGAGACAGAGGATGGAGAGGG - Intergenic
902505774 1:16938430-16938452 CTGGAGACAGAGGATGGAGAGGG + Exonic
902790639 1:18765515-18765537 CAGGAGACCCCGAGTAAAGATGG + Intergenic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
904208251 1:28869036-28869058 CTGCAGATCCAGACTGAAGCCGG + Intergenic
905232357 1:36522142-36522164 CTGGAGACCCAGTCTGAGGGGGG - Intergenic
906390146 1:45408070-45408092 CTTGAGACCTAGAAAGAAGTGGG - Intronic
906750526 1:48254896-48254918 ATTCTGACCCAGAATGAAGAGGG - Intergenic
906882199 1:49603719-49603741 CTGGAGACTCAGAATGGGGGAGG - Intronic
906933813 1:50194639-50194661 CTGGAGACCAAGAAAGAAGCAGG + Intronic
907438533 1:54464453-54464475 ATGGAGCCCTAGAATGAAGGGGG + Intergenic
908959377 1:69676936-69676958 CTGGAGACTCAGAAGGGAAAGGG - Intronic
910943077 1:92558121-92558143 CAGGAGTCCCAGAAGGAGGAAGG - Intronic
913451291 1:118994378-118994400 CTGCAAACCCAGCATGAAGCGGG - Intergenic
913473779 1:119217184-119217206 CTGGACAAGCAGAATGATGATGG - Intergenic
915076281 1:153310618-153310640 CTGGAGACCCAGAATGAAGAAGG + Exonic
915128931 1:153683890-153683912 GTGGGGACCCAGAGGGAAGAGGG + Intronic
915347219 1:155203637-155203659 CTGGAGCCCCAGAATAAAGATGG + Intronic
915723385 1:158000486-158000508 CTGGAGCTACAGAATGGAGAGGG - Intronic
916141463 1:161702913-161702935 CTGAAGACTCAGAACCAAGAGGG - Intergenic
916964005 1:169916584-169916606 ACGGAGACCCAGGATGAGGAGGG - Intergenic
917967361 1:180187062-180187084 CTGCAGACCCACACTGAGGAGGG - Intronic
918386423 1:184012929-184012951 CTGGAGATTCAAAAAGAAGAGGG + Intronic
918570483 1:185985779-185985801 ATGGAGACACAGAATGATGAAGG - Intronic
918725611 1:187918097-187918119 TTGGAGACTCAGAATGGGGAGGG + Intergenic
918809284 1:189094445-189094467 CTGGGGAGCCAGAAGGGAGATGG - Intergenic
919492261 1:198219540-198219562 TTGGAGACTCAGAATGGGGAAGG + Intronic
920045537 1:203129931-203129953 CTGGACACCCACACTGAGGACGG - Intronic
921297993 1:213722640-213722662 AGGGAGACCCAGAGTGAACAAGG + Intergenic
921333673 1:214065072-214065094 CAGATGACCCAGGATGAAGAAGG - Intergenic
922647199 1:227300658-227300680 GTGGAGACTCAGAAGGGAGAAGG + Intronic
923387503 1:233479747-233479769 CTGGCCACCCAGAAGGCAGAGGG + Intergenic
923744832 1:236690837-236690859 CTGGAGACACAGAGTGGTGATGG - Intronic
924106239 1:240652090-240652112 TGGGAGACCCAGAATGAAGTGGG + Intergenic
924107899 1:240667700-240667722 GTGAAGACGAAGAATGAAGAGGG - Intergenic
924819443 1:247474410-247474432 CTGAATTCCCAGAATGATGAAGG - Intergenic
1063414813 10:5864691-5864713 CTGGAGATCCATAATGGGGACGG - Intronic
1064001894 10:11670630-11670652 CTGGAGAACTAGGATGAAGTGGG - Intergenic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1064673254 10:17737008-17737030 CTGGAGACCCAGCTTGCATACGG - Intergenic
1064955500 10:20903856-20903878 ATGGAGACTCAGAAGGGAGAAGG + Intronic
1066277985 10:33887529-33887551 CTAGAGACCCAGACTGAGGTTGG - Intergenic
1066555257 10:36605476-36605498 ATGGTGACTCAGGATGAAGATGG + Intergenic
1067065413 10:43101563-43101585 CTGGAGGCTCAGGATGAAGAGGG - Intronic
1067792870 10:49301031-49301053 CTGGAGACCCTTACTGAAGAGGG + Intronic
1067902081 10:50252716-50252738 CTGCAGACCCAGGATCAGGATGG + Intergenic
1068584562 10:58782700-58782722 CTGGAAAACCTGATTGAAGAGGG + Intronic
1070560243 10:77560871-77560893 CTGGAGCCTCAGCTTGAAGAAGG - Intronic
1071068531 10:81665847-81665869 CTGGAGAGAGAAAATGAAGAAGG + Intergenic
1072555407 10:96511036-96511058 CTGTGGACTCAGAATGCAGAGGG - Intronic
1073609986 10:104933723-104933745 TGGGAGACCCAGCATAAAGATGG - Intronic
1074221675 10:111444369-111444391 ATGGAAACCCAGAGTGAAGCTGG + Intergenic
1074520956 10:114223414-114223436 CTGGAGCCCAAGATTGAGGAAGG - Intronic
1075090227 10:119440169-119440191 CTGCCCACCCAGAAGGAAGAGGG + Intronic
1075240542 10:120774552-120774574 GTGGAGACCCAGGATGGACAAGG + Intergenic
1075705226 10:124496641-124496663 CAGGGGACCCAGAAGGCAGACGG - Intronic
1075804722 10:125178242-125178264 CTGGTGTCTCAGACTGAAGAGGG + Intergenic
1076578503 10:131490425-131490447 CTGCAGAGCCAGAAAGTAGATGG + Intergenic
1078399587 11:11012502-11012524 CTAGAGGCCCAAAGTGAAGAAGG + Intergenic
1079186392 11:18241736-18241758 CTGGAGACTCAGAAAGATGGAGG + Intronic
1080479269 11:32629204-32629226 CTGAAGTCCCAGAAAGTAGAGGG + Intronic
1081200605 11:40210623-40210645 CTGGAGTCCCAGGATGGAAAGGG - Intronic
1081847965 11:46254127-46254149 CTGGGGATCCAGAAAAAAGAAGG - Intergenic
1082211074 11:49502124-49502146 TTGGAAAACCTGAATGAAGAAGG + Intergenic
1083153085 11:60805778-60805800 ATGGAGACGGAGAAGGAAGAGGG - Intergenic
1084096586 11:66915443-66915465 CTGGAGACACAGCAGGGAGAAGG - Intronic
1084534102 11:69746652-69746674 CTGGAGACCCATAAAAGAGAAGG - Intergenic
1085541059 11:77270165-77270187 AAGGAGACCCAGAGAGAAGAAGG + Intronic
1086554992 11:88098883-88098905 ATGAAGACCCAAAATGAAAATGG - Intergenic
1086638570 11:89122916-89122938 TTGGAAAACCTGAATGAAGAAGG - Intergenic
1089633318 11:119796778-119796800 CTAGAGACCCAGGAGGAACAGGG - Intergenic
1089760609 11:120720390-120720412 CTTGAGACCCAGAATGCAATGGG - Intronic
1089849363 11:121482953-121482975 CAGGAGACCAAGAAGGAAGTGGG - Intronic
1090051126 11:123380832-123380854 CTCCAGTCCCAGAATGAGGAGGG - Intergenic
1090927564 11:131262026-131262048 CTGGGGATACAGAATGAATAAGG + Intergenic
1091613406 12:2030876-2030898 CTGGAGACCCAGCAACAAGTTGG + Intronic
1092172499 12:6382924-6382946 CAGGAGACCCAGATTGTAGCTGG + Intronic
1092483263 12:8879553-8879575 CTGCAGACCCAAAATGTACATGG - Intronic
1092915453 12:13185208-13185230 CTGGAGACTCAGAAGGCGGAGGG + Intergenic
1093013216 12:14129872-14129894 CTGGAGACAACGAATGAAAACGG + Intergenic
1093456649 12:19371465-19371487 TTGGAGACTCAGAAGGGAGAGGG - Intronic
1095184613 12:39187047-39187069 CTGGGGACCCAGAAGGGAGATGG - Intergenic
1095772027 12:45970371-45970393 CTGGTTACACAGAAAGAAGAGGG + Intronic
1096004906 12:48161637-48161659 CTGGACACCCAGATTCAGGAGGG + Intronic
1097226490 12:57479443-57479465 CTGGAGACCCAGAAGGGAATAGG + Intronic
1097257343 12:57689293-57689315 ATGGAGACTCAGAAGGATGATGG + Intergenic
1097620952 12:61938893-61938915 TTGGAGACTCAGAAGGAGGAGGG + Intronic
1098579901 12:72087386-72087408 CTGAAGACACAGAAGAAAGATGG + Intronic
1099054687 12:77824473-77824495 TTGGAGCCCTAGAAGGAAGAGGG + Intergenic
1099553110 12:84073005-84073027 CTGAAGACCAAGAAAGAAGTAGG + Intergenic
1099892976 12:88611981-88612003 CTGGAGACCCAAAAAAAAGCTGG + Intergenic
1100874916 12:98951669-98951691 CTGTAGGCCCAGAGGGAAGAGGG - Intronic
1101273346 12:103171998-103172020 TTGGAGAACCAGAATGAATTAGG + Intergenic
1101810734 12:108105573-108105595 CTGTATTCCCAGAATGAAGCAGG - Intergenic
1102438918 12:112946703-112946725 CAGGGGACTCAGAAGGAAGAAGG - Intronic
1102588460 12:113939928-113939950 CTGGAGACCCAGAATTGATCTGG - Intronic
1103024387 12:117561936-117561958 CTGGAGATTCACAATGAACAAGG + Intronic
1103333292 12:120169953-120169975 CTGGAGCAACAGAATGAAGGAGG + Intronic
1103359679 12:120346323-120346345 CTGGCAACCCAGAAAGAAGACGG + Intronic
1106367412 13:29095402-29095424 CTGTCAACCCAGAATGAAGAGGG - Intronic
1106459600 13:29957284-29957306 CTCCAGCCCCAGTATGAAGAGGG - Intergenic
1108101790 13:46964814-46964836 ATGAAGACACAGAATAAAGAGGG - Intergenic
1108456815 13:50624054-50624076 CTGGAAACTCAGAAAGGAGAGGG - Intronic
1110901031 13:80824859-80824881 CTGGAGACTCAGAGTGGAGAGGG - Intergenic
1111372553 13:87336026-87336048 CTGGAGATCCATACTGAGGATGG - Intergenic
1112239357 13:97665669-97665691 CTGGAGAACAAGAGTGAAGAGGG + Intergenic
1112591814 13:100770351-100770373 CAGGACTCCCAGAAGGAAGAGGG - Intergenic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1113099965 13:106706866-106706888 CTGGGGACCCTGAATGTAGTAGG - Intergenic
1113116954 13:106884707-106884729 CTGGACACCCAGAGTGGAGGAGG - Intergenic
1114075899 14:19161032-19161054 GTGGACACCCAGGATCAAGATGG - Intergenic
1114086265 14:19238540-19238562 GTGGACACCCAGGATCAAGATGG + Intergenic
1114263294 14:21055197-21055219 CTGGAAACCTTGAATGCAGAAGG - Intronic
1114363568 14:22002878-22002900 CTGCAGACTCAGAAAGAAAACGG - Intergenic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116402028 14:44519361-44519383 CTGGAAACCAAAAATGAACAAGG - Intergenic
1118156605 14:63248683-63248705 GTGGAGCCACAGAATGAACAAGG + Intronic
1119400759 14:74360608-74360630 CAGGAAACCCAGACAGAAGAAGG - Intergenic
1119706409 14:76785474-76785496 CTGGAGACCAAGAAGGGAAATGG - Intergenic
1119957288 14:78812383-78812405 GTGGAAACCCAGCATGAAGGTGG + Intronic
1120299476 14:82688166-82688188 CTGGTGAGACAGAATGAAGAAGG + Intergenic
1120809259 14:88786330-88786352 GGGGAGACACAGAATAAAGAAGG - Intronic
1122384278 14:101333430-101333452 CTGGTGACCCAGAAGAAAAAGGG + Intergenic
1123125277 14:105941600-105941622 CTGTAGACCGAGAATGCAGGCGG - Intergenic
1202897803 14_GL000194v1_random:20159-20181 GTGGACACCCAGGATCAAGATGG + Intergenic
1124117713 15:26862915-26862937 CTGGAGACTTAGAAGGGAGAAGG + Intronic
1124266412 15:28238685-28238707 TTGGAGAACCATAATAAAGATGG - Exonic
1125975747 15:43950039-43950061 CTGCATACCAAGAAGGAAGAAGG - Intronic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1127360634 15:58241988-58242010 CTGCTGACCTAGAAAGAAGAGGG + Intronic
1127705339 15:61541360-61541382 TTAGAGACCCAGACTGAAGGAGG + Intergenic
1128498230 15:68210326-68210348 CTGGAGCCCCAGCAGGAAGGGGG - Intronic
1129200147 15:73993843-73993865 CTGGAGAGCGGGTATGAAGAGGG - Intronic
1130087278 15:80788040-80788062 CTGGAGACCCAGGATTCAGTAGG - Intronic
1130825469 15:87540572-87540594 CTGGAGACTCAGAAGGTAGGAGG + Intergenic
1131080837 15:89533476-89533498 ATGGAGACTCAGAATGCTGAGGG - Intergenic
1131620077 15:94058909-94058931 TTTGAGACCCAGAGTGAGGAAGG - Intergenic
1132463286 16:66101-66123 GTGGAGACCCAGATTGAGAAGGG + Intronic
1132976535 16:2713893-2713915 CAGCAGACCCAGAAGGAAGAGGG - Intronic
1133504395 16:6397093-6397115 TTGGAGTCCCAGAAAGAGGAAGG + Intronic
1135200129 16:20430030-20430052 TTGGAGACTCAGAAGGAAGAAGG + Intronic
1135218560 16:20593564-20593586 TTGGAGACTCAGAAGGAGGAAGG - Intergenic
1135253655 16:20922864-20922886 CTGGAGACCCAGAAGAAAGCTGG + Intronic
1135875760 16:26198596-26198618 CTGCATTCCCAGAATGAAGTCGG + Intergenic
1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG + Intergenic
1136448339 16:30337573-30337595 CCTGAGACCCAGAAAGAGGAAGG - Intergenic
1136704607 16:32176098-32176120 TTGGAGAACCATAATAAAGATGG - Intergenic
1136763306 16:32753308-32753330 TTGGAGAACCATAATAAAGATGG + Intergenic
1136804794 16:33117078-33117100 TTGGAGAACCATAATAAAGATGG - Intergenic
1137731536 16:50693803-50693825 GGGGAGTCCCAGAATGTAGATGG + Intronic
1137755998 16:50902739-50902761 GTGGAGACACAGAATGCAAAGGG + Intergenic
1137971708 16:52991915-52991937 CTGGAGACTCAGAATGGGGAGGG + Intergenic
1138278892 16:55757662-55757684 CTGGAGACCCAAATTCAAAAAGG - Intergenic
1138289642 16:55835926-55835948 CTGGAGACCCAAATTCAAAAAGG + Intergenic
1138300809 16:55928404-55928426 CTGGAGACTCAGAAGGTGGAAGG + Intronic
1138341265 16:56290521-56290543 CTGGAGACCCAGAATGAGTTTGG + Intronic
1139777086 16:69323149-69323171 CTGGGGGCCCAGAATGCAGGTGG + Intronic
1141780679 16:86158439-86158461 CTGGGGACACAGCATGAGGATGG + Intergenic
1142047534 16:87935258-87935280 CCTGAGACCCAGAAAGAGGAAGG + Intronic
1142133941 16:88443148-88443170 CTGGAGACCCAGGATGTGGACGG + Intergenic
1203065456 16_KI270728v1_random:1013629-1013651 TTGGAGAACCATAATAAAGATGG + Intergenic
1143646627 17:8234597-8234619 CTGGCCACCCTGAAAGAAGAAGG - Exonic
1144136700 17:12302117-12302139 CTGGAGACCGAGAAGGAGAATGG - Intergenic
1145102825 17:20090891-20090913 ATGGAGACCCATAAGGAATAGGG - Intronic
1145102831 17:20090920-20090942 CTGGAGACCCATAAGGAATAGGG - Intronic
1145708479 17:26945313-26945335 ATGGAGACCCAGACACAAGATGG + Intergenic
1146542442 17:33709093-33709115 ATGGAGACCCAGAAAGATGTAGG - Intronic
1147892485 17:43727147-43727169 CTGGGGACTCAGAATCAAGGAGG - Intergenic
1148530463 17:48385429-48385451 TTGGAGAGACATAATGAAGAAGG + Intronic
1148758184 17:49985606-49985628 CTGGAGACCCATGTTGGAGATGG + Intergenic
1149090246 17:52769396-52769418 ATGAAGACCCAGAAGGGAGAGGG + Intergenic
1150173778 17:63028141-63028163 CTGTAAACCAAGAATGAACAAGG + Intronic
1150646089 17:66978392-66978414 GAGGGGACCCAGAGTGAAGATGG + Intronic
1151404117 17:73875847-73875869 TTGGAAACCCAGAGTGAGGAGGG - Intergenic
1152260454 17:79263953-79263975 CTTGAGACACACAAGGAAGAAGG + Intronic
1153361463 18:4202340-4202362 CTGGAGCCTCAGAATGAGGAAGG + Intronic
1153415160 18:4838308-4838330 CTGGAGGCCCAGACTTGAGATGG - Intergenic
1155771342 18:29704342-29704364 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1155874206 18:31064836-31064858 CTGGAGTCCAGGAATGGAGATGG + Exonic
1158187861 18:54791942-54791964 ATGGAGAGCCAGAAGGGAGATGG - Intronic
1158554289 18:58462397-58462419 TTGGAGACTCAGAAGGAAGGTGG - Intergenic
1158768151 18:60481096-60481118 TTGGAGACTCAGAAGGAAGGAGG - Intergenic
1158787630 18:60734895-60734917 GTGAAGACACAGAAAGAAGATGG - Intergenic
1158857244 18:61554873-61554895 AAGGAAACCCAGAAGGAAGAGGG + Exonic
1160601845 18:80019670-80019692 CTGGAGACTAAGAAGGAACAAGG - Intronic
1160898794 19:1416364-1416386 CTGGAGACCAAGGGTGATGATGG + Intronic
1161752197 19:6106097-6106119 GGGAAGACCCAGAATGAAGTGGG - Intronic
1162639094 19:11993714-11993736 ATGGAGATCAAGAGTGAAGAGGG + Intergenic
1163736424 19:18984077-18984099 GTGGAGAGCCAGAAAGGAGAGGG + Intergenic
1164443850 19:28300544-28300566 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1167359069 19:49020319-49020341 CTGGAGACCCAGAAAGATAGGGG - Intergenic
1167366756 19:49058556-49058578 CTGGGGACCCAGAAAGATGGGGG - Exonic
1167567718 19:50267274-50267296 CTGCAGAGCCAGAATGGAGCTGG + Intronic
1167691752 19:50989258-50989280 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
1168102036 19:54146424-54146446 CTGGAGAGCCTGAATTGAGATGG + Intronic
1168469322 19:56627932-56627954 CAGGAGACCCAGGCTGCAGAGGG + Intergenic
1168505131 19:56927723-56927745 CTGAAGACCAGGAATGATGAAGG + Intergenic
1168559096 19:57368530-57368552 CAGGGGACCCTGAAGGAAGAGGG - Exonic
925722137 2:6839625-6839647 CTGGAGACTAAGAAGGAACAAGG - Intergenic
925750932 2:7090202-7090224 CTGCAGCCCCAGGATGCAGAGGG + Intergenic
926386152 2:12337746-12337768 CTGAAGAGCAAGCATGAAGATGG + Intergenic
926990082 2:18669671-18669693 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
927517864 2:23682542-23682564 CTGGTGCCCCAGGATGAAGCTGG + Intronic
929419376 2:41775438-41775460 CTGGAAACCAAGAACCAAGAGGG + Intergenic
930892919 2:56412005-56412027 CTGGAGACTCAGAAGGGTGAGGG + Intergenic
931217457 2:60260003-60260025 CAGGAGACCCAGGAGGAAGCTGG - Intergenic
931263237 2:60638345-60638367 CTGGAGTCCCTGCATGAGGAGGG + Intergenic
931636322 2:64343802-64343824 CCAGAGTCCCAGAAGGAAGATGG - Intergenic
932884138 2:75532663-75532685 CTGGAGCTCCAGAATGAAAGAGG + Intronic
932884416 2:75535766-75535788 TTGGAGACTCAGAATGGGGAAGG + Intronic
933315222 2:80706815-80706837 CGGGGGAGCCAGAAGGAAGATGG - Intergenic
933904903 2:86882292-86882314 TTGGAGACTCAGAAGGAGGAGGG + Intergenic
935535051 2:104284168-104284190 AGGTAGGCCCAGAATGAAGAAGG - Intergenic
936367325 2:111869870-111869892 TTGGAGACTCAGAAGGAGGAGGG - Intronic
936500426 2:113062172-113062194 CTGGACACCCAGGATGACGGGGG - Exonic
938490493 2:131758552-131758574 GTGGACACCCAGGATCAAGATGG - Intronic
941178601 2:162231973-162231995 CTGCAGAGCCAGCAGGAAGATGG - Intronic
942480626 2:176384498-176384520 CTGGATACCCAGACTTAAGGGGG - Intergenic
943436017 2:187866854-187866876 CTGGAGACCCAGGGAGAAGCTGG - Intergenic
943436024 2:187866910-187866932 CTGGAGACCCAGGGAGAAGCTGG - Intergenic
943436200 2:187868141-187868163 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
943436207 2:187868191-187868213 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
943436234 2:187868385-187868407 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
943436252 2:187868532-187868554 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
943436326 2:187869066-187869088 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
943436382 2:187869480-187869502 CTGGAGACCCAGAGAGCAGCTGG - Intergenic
943465696 2:188226636-188226658 GTGAAGACACAGAATGAAAATGG + Intergenic
943762464 2:191624796-191624818 GTGAAGACACAGAAAGAAGATGG - Intergenic
945929442 2:215840426-215840448 CTCGAGACCCAGACTGAATCAGG + Intergenic
946339647 2:219059275-219059297 CGGGAGACCCCGAAGGAAGGGGG + Intronic
946479532 2:220040798-220040820 CAGGAGACCCAGAAGGAGCAAGG - Intergenic
946807459 2:223485503-223485525 CTGGAGAGCAAGCATGGAGATGG - Intergenic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
947073258 2:226315025-226315047 CCTGAGACCCAGAAGGAAGAAGG - Intergenic
947448877 2:230186660-230186682 ATGGAGACTCAGAAAGGAGAGGG - Intronic
947709090 2:232300396-232300418 CTGGAGACCAAGAGTGGGGAGGG - Intronic
948286525 2:236790178-236790200 CTGGAAATCCAAAATGAAGATGG - Intergenic
948420403 2:237856573-237856595 CTGGAGCCCCTGGAGGAAGATGG - Intergenic
948669853 2:239561306-239561328 CTGGAGACTCAGAAAGGAGGTGG - Intergenic
1169083255 20:2810604-2810626 TTGGAGACTCAGAAGGAGGAGGG - Intergenic
1169232957 20:3905026-3905048 CTGGAGCCCCAGAATCAGGATGG - Intronic
1169373018 20:5043179-5043201 CTGGGGAGCCAGAAGGAAGCTGG - Intergenic
1169770098 20:9190641-9190663 CTGGAGACCAGGTATAAAGAAGG + Intronic
1172004786 20:31811627-31811649 CTCCATTCCCAGAATGAAGACGG + Intergenic
1172648243 20:36484757-36484779 CTGGAGCCCTAGAAGGAACAAGG + Intronic
1173074176 20:39800954-39800976 CTGGAGAACCAAAAGGAAGCAGG - Intergenic
1173275991 20:41583024-41583046 CTGGAGTCCCAGATGGCAGAAGG + Intronic
1173408814 20:42791467-42791489 CTGGAGACCCACAAAGCAGGTGG + Intronic
1173809802 20:45948856-45948878 CTGGAGATCCTAAATGAAGAGGG + Exonic
1174061087 20:47833592-47833614 CTGGAGACCCAGGGTGGAGCCGG + Intergenic
1174061279 20:47834711-47834733 CTGGAGACCCAGGGAGAAGATGG - Intergenic
1174070248 20:47894612-47894634 CTGGAGACCCAGGGAGAAGATGG + Intergenic
1174070689 20:47897107-47897129 CTGGAGACCCAGGGTGGAGCCGG - Intergenic
1174100410 20:48122622-48122644 CTGGAGACCCAGGGTGGAGCCGG + Intergenic
1174101074 20:48126596-48126618 CTGGAGACGCAGGGAGAAGATGG - Intergenic
1174149021 20:48473086-48473108 CTGGAGACCCAGAGAGGAGATGG - Intergenic
1174149047 20:48473244-48473266 CTGGAGACCCAGAGAGGAGATGG - Intergenic
1174149085 20:48473495-48473517 CTGGAGACCCAGAGAGGAGATGG - Intergenic
1174149524 20:48476308-48476330 CTGGAGACCCAGAAAGGAAATGG - Intergenic
1174149532 20:48476361-48476383 CTGGAGACCCAGAAAGGAGTTGG - Intergenic
1174149559 20:48476515-48476537 CTGGAGACCCAGAAAGGCAATGG + Intergenic
1174149593 20:48476707-48476729 CTGGAGACCCAGAAAGGAAATGG - Intergenic
1174149601 20:48476760-48476782 CTGGAGACCCAGAAAGGAGCTGG - Intergenic
1174149627 20:48476918-48476940 CTGGAGACCCAGAAAGGAACCGG - Intergenic
1174153370 20:48501549-48501571 CTGGAGACCCAGGGTGGAGCCGG + Intergenic
1174153602 20:48502870-48502892 CTGGAGAACCAGAAAGGAGCTGG - Intergenic
1174156146 20:48516614-48516636 CTGGAGACCCAGGGAGAAGATGG - Intergenic
1174464416 20:50706263-50706285 CTAGAGAGACAGAATGTAGAGGG + Intergenic
1174558306 20:51412339-51412361 CTTGTGACTCAGAATGCAGACGG - Intronic
1174584699 20:51599093-51599115 CAGCAGAAGCAGAATGAAGATGG - Exonic
1175239342 20:57535340-57535362 CTGAAGACCCAGAATTGAGGAGG - Intergenic
1175805161 20:61823560-61823582 GAGGAGACCAAGAATTAAGAAGG + Intronic
1176079680 20:63266006-63266028 CTGGGGTCTCAGGATGAAGACGG + Intronic
1176157483 20:63628932-63628954 TTGGAGCCCCAGAGTGAAGGAGG - Intergenic
1176617489 21:9036148-9036170 GTGGACACCCAGGATCAAGATGG + Intergenic
1176900637 21:14437651-14437673 CTTGAGAACAAGAATGATGAAGG + Intergenic
1177397666 21:20558327-20558349 CTGCATAACCAGAATGGAGATGG - Intergenic
1178365942 21:31988848-31988870 CTGGAAACCGAGAAAGAAAAAGG - Intronic
1179121562 21:38550538-38550560 GTGAAGACCCAGCAAGAAGATGG + Intronic
1179513953 21:41893649-41893671 CTGGAGAGCGTGAGTGAAGATGG - Intronic
1180291599 22:10854196-10854218 GTGGACACCCAGGATCAAGATGG - Intergenic
1180291703 22:10854653-10854675 GTGGACACCCAGGATCAAGATGG - Intergenic
1180494404 22:15883618-15883640 GTGGACACCCAGGATCAAGATGG - Intergenic
1180494508 22:15884075-15884097 GTGGACACCCAGGATCAAGATGG - Intergenic
1180764391 22:18235073-18235095 CTGGGGTCCAAGAATGAAGTAGG - Intergenic
1180771249 22:18389468-18389490 CTGGGGTCCAAGAATGAAGTAGG + Intergenic
1180802635 22:18639083-18639105 CTGGGGTCCAAGAATGAAGTAGG + Intergenic
1180853875 22:19034639-19034661 CTGGGGTCCAAGAATGAAGTAGG + Intergenic
1180883254 22:19221567-19221589 CTGGAGTCCCAGATTCAGGAAGG - Exonic
1181219086 22:21356178-21356200 CTGGGGTCCAAGAATGAAGTAGG - Intergenic
1181397610 22:22633062-22633084 CTGGGGGCCCAGAATGAACCTGG + Intergenic
1181500358 22:23312432-23312454 CTGGGGGCCCAGAATGAACCTGG + Intronic
1181535075 22:23537620-23537642 CTGGGGACCCAGAGAGAAGGAGG + Intergenic
1181651796 22:24262996-24263018 CTGGGGGCCCAGAATGAACCTGG - Intergenic
1181705580 22:24647743-24647765 CTGGGGGCCCAGAATGAACCTGG + Intergenic
1183269380 22:36851114-36851136 ATGGAGGCCGAGAGTGAAGAAGG - Intergenic
1183778541 22:39983796-39983818 GTGGAGACCGAGAAGGAAGTGGG - Intergenic
1184716980 22:46288038-46288060 CTGGAGACCCAGAGAAAAGTGGG + Intronic
1185050893 22:48553466-48553488 CTGGACACCCAGGAGGAGGATGG + Intronic
949159278 3:860529-860551 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
949159306 3:860776-860798 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
949159375 3:861318-861340 CTGGAGACCCAGAGAGCAGCTGG - Intergenic
949798857 3:7880863-7880885 CTGTAGTCCAAGAATGTAGATGG - Intergenic
950193205 3:10992307-10992329 CTGGTGACCCAGGATGAGGCCGG + Intergenic
950400296 3:12764634-12764656 CTGGAGGCCCAGGATGAGTAAGG - Intronic
950698995 3:14727128-14727150 CTGGACATTCAGACTGAAGATGG - Intronic
951418254 3:22451190-22451212 TTGGGGAGCCAGAATGCAGATGG + Intergenic
951685611 3:25340730-25340752 CTGGAGAACAAGAAGGAAGTAGG + Intronic
952199010 3:31106130-31106152 CTGGAGACTCAGAAGGGTGAAGG - Intergenic
954005349 3:47586268-47586290 CTGGAGTCCGAGAAGGAAAATGG - Exonic
955168533 3:56539976-56539998 TTGGAGACAGAGAATGAAGGAGG - Intergenic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
955603856 3:60677315-60677337 CTGGAGACTCAGAATGATGATGG - Intronic
956277634 3:67520329-67520351 CTGGATACCCAGAAAGAAAAAGG + Intronic
956695328 3:71914038-71914060 TTAGAGACTCAGAATGAGGAGGG - Intergenic
957024117 3:75160373-75160395 CTGGAGACAGGGATTGAAGAGGG - Intergenic
958461124 3:94397254-94397276 ATGAAGACCCAGAAGGATGAGGG + Intergenic
959167142 3:102794566-102794588 CTGGAAACACAGAAGGGAGAAGG - Intergenic
960072359 3:113445338-113445360 ATTGAGAAACAGAATGAAGAAGG - Exonic
960551590 3:118981924-118981946 TTACAGACCCAGAAAGAAGAGGG - Intronic
960814281 3:121657455-121657477 ATAAAGACCCAGACTGAAGAAGG - Intronic
961057882 3:123804343-123804365 GAGGAGACCCAGAAAGGAGAGGG + Intronic
961235072 3:125359185-125359207 CTGGAGACTCAGAGTGTTGAAGG - Intronic
962257104 3:133879933-133879955 CTGGAGAGCTAGACTGAAGCAGG + Intronic
964083704 3:152790356-152790378 CTGGCCACCCCAAATGAAGATGG - Intergenic
964966202 3:162496348-162496370 CTGGAGGCCTAGAAAGAAAATGG - Intergenic
968143015 3:196274016-196274038 CTGGACACCCAAAATCCAGAGGG + Intronic
969879470 4:10161208-10161230 CAAAAGACCTAGAATGAAGAGGG + Intergenic
970564733 4:17320686-17320708 TTGGAGAACCAAAAAGAAGAAGG - Intergenic
971676425 4:29635354-29635376 CTGGAGACCCAGAAGGATGAGGG + Intergenic
972349721 4:38225531-38225553 CAGGGGACCCAGAAGGCAGAAGG - Intergenic
974466059 4:62258087-62258109 CTGGAGACACAGAGAGAAAATGG - Intergenic
975953222 4:79800730-79800752 GTGAAGACACAGAAAGAAGATGG + Intergenic
976330662 4:83827720-83827742 ATGGAGACCCAAAATAAAGGAGG + Intergenic
978574818 4:110179130-110179152 CTGGAGGCCTAGAATTATGAAGG - Intronic
978655557 4:111061676-111061698 CTGGGGACAAAGAATGAGGATGG + Intergenic
978913685 4:114097081-114097103 TTGGAGACTCAGAATGGGGAAGG - Intergenic
978979861 4:114929995-114930017 ATGTAGCCCCAGAATGAAAAGGG + Intronic
979175934 4:117664055-117664077 CTGTAGTCCCAGAATGGAGTGGG + Intergenic
980410546 4:132413116-132413138 CAGGAGACACAGAGTGAAGGGGG - Intergenic
981889768 4:149721447-149721469 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
982004235 4:151049249-151049271 TAGGAGAGCCAGAAGGAAGATGG + Intergenic
982887672 4:160802469-160802491 TTGGAGACTCAGAATGGGGATGG + Intergenic
986011336 5:3718602-3718624 CTGAAGACCCAGAGAGAAGATGG + Intergenic
986465756 5:8021282-8021304 CTGGAGATTCAGAATGAGCAAGG - Intergenic
986746725 5:10751198-10751220 CTGGAAACCCAAAACGAAGAAGG - Intronic
988065433 5:26225306-26225328 CTGGAGACCCAGGGAGAAGCTGG - Intergenic
988065540 5:26226146-26226168 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
988065571 5:26226392-26226414 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
988065635 5:26226881-26226903 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
988065654 5:26227075-26227097 CTGGAGACCCAGACAGGAGCTGG - Intergenic
988065697 5:26227422-26227444 CTGGAGACCCAGAGGGGAGCTGG - Intergenic
988065721 5:26227617-26227639 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
990476253 5:56164154-56164176 GTGGAGACCCAGAAAATAGAAGG - Intronic
991513856 5:67412070-67412092 CTTGAAACTCAGAATGAAGATGG + Intergenic
991579091 5:68135505-68135527 TTGGAGACCCTGAATGTACAGGG + Intergenic
992073896 5:73173663-73173685 CTGGAGAACCATAAGGAGGAGGG - Exonic
992391888 5:76337239-76337261 CTGAAGACACAGAGAGAAGATGG - Intronic
992403615 5:76434347-76434369 TTGGAGACTCAGAAAGAGGAGGG - Intronic
992712716 5:79476485-79476507 CTGGAGACCCAGACTGGCAACGG - Intronic
993003878 5:82410566-82410588 GTGAAGACACAGAACGAAGATGG + Intergenic
995350510 5:111169724-111169746 CTGGGGACCCTGGTTGAAGATGG + Intergenic
995412266 5:111872169-111872191 CTGGAGACCCAGAGAGTTGATGG + Intronic
996390281 5:122952943-122952965 CTGGAGTCCCAGAAGGAAAGGGG + Intronic
996486598 5:124042268-124042290 CTGGGGAGCCAGAAGGGAGATGG - Intergenic
996837536 5:127810482-127810504 CTGTATACCCAGAAAGGAGAGGG + Intergenic
996871620 5:128199092-128199114 CTACAGACCCAGAGAGAAGAGGG - Intergenic
999471311 5:151857578-151857600 CTGGACACCCAGAAGGCAGAGGG - Intronic
999883497 5:155893556-155893578 CTAGAGAGGCATAATGAAGATGG + Intronic
1000393489 5:160749085-160749107 CTGGAGTCGCAGAAAGAACATGG - Intronic
1001168953 5:169398844-169398866 CTGAAGACCCAGAAGAAATAGGG + Intergenic
1002285348 5:178159096-178159118 GTAGATACCCAGAATGAAAATGG + Intergenic
1003623248 6:7720839-7720861 GGTGAGACCCAGAACGAAGAAGG - Intergenic
1003762762 6:9198908-9198930 CTGGTGACTCAGCAAGAAGAGGG - Intergenic
1005033134 6:21530038-21530060 CAGGAGACCCACACTGCAGAAGG - Intergenic
1005973596 6:30780254-30780276 CTGAAGGCCCAGAGTGAACAGGG - Intergenic
1006152756 6:31998079-31998101 CAAGAGACACAGAATGAAGAAGG - Intronic
1006159064 6:32030816-32030838 CAAGAGACACAGAATGAAGAAGG - Intronic
1006375753 6:33670916-33670938 CTGGGGACACAGAAGGAAGTGGG - Intronic
1007099042 6:39231940-39231962 ATGGAGAGCAAGAAGGAAGAAGG - Intergenic
1008680230 6:53864213-53864235 GTGGAGACCCAGGAGGCAGAGGG - Intronic
1008927275 6:56900131-56900153 CTGGAGTTCTAGAATGAGGATGG - Intronic
1009709998 6:67305925-67305947 CTGGAGACTCAGAAAGGAGGAGG - Intergenic
1009905881 6:69868782-69868804 CTGGAGGACCAGAAAGTAGATGG - Intronic
1012258286 6:97059123-97059145 GTGGAGACCCAGGATGAGGTAGG + Intronic
1012823142 6:104114154-104114176 ATGGAAACTCAGAATGATGAGGG - Intergenic
1013380629 6:109566704-109566726 CTGGAGACTCAGAAGGGAGCAGG + Intronic
1014251716 6:119122187-119122209 CTGGAGGTCCAGAATGGAGAGGG - Intronic
1014552617 6:122806660-122806682 CTGGAGAAGAAGAATGAACATGG - Intronic
1015060280 6:128956124-128956146 ATGGAGCCACAGGATGAAGATGG + Intronic
1015330889 6:131977890-131977912 CTGGGGGCTCAGAAGGAAGAGGG - Intergenic
1015916506 6:138222872-138222894 CTGGAGACTCAGAATGGGGGAGG - Intronic
1016099771 6:140084878-140084900 GTGAAGACACAGAAAGAAGATGG + Intergenic
1016110328 6:140215564-140215586 ATGGAGACTCAGAAGTAAGAGGG - Intergenic
1016150628 6:140737554-140737576 TTGGAGACTCAGAAAGGAGAGGG - Intergenic
1017272315 6:152522213-152522235 TTGGAGACTCAGAAGGATGAGGG - Intronic
1018272484 6:162095089-162095111 CTGAAGACCCAGTAGAAAGATGG - Intronic
1019861491 7:3662537-3662559 CTGGAGGTCCAGAGAGAAGAAGG + Intronic
1022297323 7:29068374-29068396 CTAGAGGCCAAGAATGAAAAGGG + Intronic
1024156295 7:46629177-46629199 CTGGAGACCCAGACCCAAGGAGG + Intergenic
1025233143 7:57216357-57216379 CTGGAGACCCAGGGAGAAGATGG + Intergenic
1025233652 7:57219346-57219368 CTGGAGACCCAGGGTGGAGCCGG - Intergenic
1026127615 7:67593418-67593440 CTGGTCACCCAGAAGGTAGAAGG + Intergenic
1026289083 7:68989791-68989813 ATGGAGACACAGATGGAAGAAGG - Intergenic
1027053249 7:75032649-75032671 CTGGAGACCGGGAGTGAAAATGG + Intronic
1028454940 7:91028051-91028073 CTGGAGACTCAGAAGCAGGAAGG - Intronic
1028832705 7:95344430-95344452 CTGGACCCCAAGGATGAAGAAGG + Intergenic
1029747384 7:102523937-102523959 CTGAACACCCAGACTGAAGTAGG + Intergenic
1029765337 7:102623027-102623049 CTGAACACCCAGACTGAAGTAGG + Intronic
1029806854 7:103007137-103007159 CTGGAGTCCCAAAAAGAGGAAGG + Intronic
1030301840 7:107982087-107982109 CTGCAGACCTAGGAAGAAGAGGG - Intronic
1031011850 7:116532924-116532946 CTGGACACCAAGGAGGAAGAAGG + Intronic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1032044012 7:128587700-128587722 CTGGAGGCCCAGCTTGAAGTGGG + Intergenic
1035418120 7:158706116-158706138 CTGGAGCCCCAGGATGAAATAGG - Intergenic
1035695362 8:1591746-1591768 CTGGAGATCCAGGATGCAGTTGG - Intronic
1036110791 8:5899709-5899731 GTGGAGACCCAGCGTGAAGGAGG - Intergenic
1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG + Intergenic
1036576805 8:10035152-10035174 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1036645178 8:10608126-10608148 GTGGAGACCCAGGAGGCAGAAGG - Exonic
1037250992 8:16894065-16894087 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
1037422949 8:18723592-18723614 CTGGAGATACAGAAGGAACAGGG - Intronic
1038432509 8:27511510-27511532 CTGGACACCCAGCTGGAAGATGG + Intronic
1038488823 8:27955115-27955137 CTGGAGCCCCTGGATGAACATGG - Intronic
1038972153 8:32647832-32647854 CCAGAGCCCCAGACTGAAGATGG + Intronic
1039351254 8:36766365-36766387 GTGGGGAACCAGAATGAAAAAGG - Intergenic
1039680725 8:39732652-39732674 CTTGATATCCAGAATGTAGAAGG + Intergenic
1042018967 8:64349384-64349406 CTGTAAATCCTGAATGAAGAAGG + Intergenic
1042148397 8:65756347-65756369 CTGGAGTCCCAGAAAGAAAAAGG - Intronic
1042482737 8:69322568-69322590 CTGGAGACCCAGAAAGGAGCTGG + Intergenic
1044927457 8:97221716-97221738 TTGAAGACACACAATGAAGAAGG + Intergenic
1045054901 8:98360381-98360403 ATGGAGACACAGAGGGAAGAAGG - Intergenic
1046065096 8:109186877-109186899 CAGGAGAGGCAGAATGGAGAGGG - Intergenic
1047106078 8:121731900-121731922 TTGGAGACTCAGAAGGAAGAGGG - Intergenic
1047343965 8:124009533-124009555 CTGGAGACCCAGGGAGAAGATGG + Intronic
1047948934 8:129911799-129911821 CAGGAGATCCAGAAGTAAGAAGG - Intronic
1048861986 8:138730351-138730373 CTGGAGACCCAGTATGGCGGTGG + Intronic
1048879166 8:138859016-138859038 CTGGGGACCGAGAAGGGAGATGG - Intronic
1049273141 8:141706716-141706738 CTGGAGATCCTGACTGCAGAAGG - Intergenic
1049427976 8:142545721-142545743 CTGGAGACACAGAGGGAAGCAGG - Intergenic
1052551488 9:29955834-29955856 ATGGAGACTCAGAATGGGGAGGG - Intergenic
1053487411 9:38470431-38470453 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1054349923 9:64012227-64012249 GTGGACACCCAGGATCAAGATGG + Intergenic
1054539720 9:66261710-66261732 GTGGACACCCAGGATCAAGATGG + Intergenic
1056507592 9:87271614-87271636 CTGAAGACACGGAGTGAAGAAGG - Intergenic
1056793966 9:89644234-89644256 CTGGAAACCCATGAAGAAGAGGG - Intergenic
1057608775 9:96521770-96521792 CTGGTGTCCCACAATGAAAAAGG + Intronic
1057667800 9:97059919-97059941 CTGCAGATCCAGAGTGAAGCTGG + Intergenic
1057693747 9:97309485-97309507 CAGGATACCCATGATGAAGAAGG + Exonic
1057761411 9:97877655-97877677 CTGGAGAAGAAGAAAGAAGATGG + Intergenic
1058363760 9:104182989-104183011 CTGGAGATGCAGAAACAAGAAGG + Intergenic
1058805744 9:108589800-108589822 ATGGAGAACAAGAGTGAAGAAGG + Intergenic
1059587293 9:115619898-115619920 CTGGAGGCCCAGGAGGAAAAGGG - Intergenic
1060969473 9:127730081-127730103 CTGGATTCACAAAATGAAGAAGG - Intronic
1062486202 9:136777530-136777552 CTGGAGACCCAGGGTGGAGCTGG + Intergenic
1062486259 9:136777835-136777857 CTGGAGACCCAGGGAGAAGCTGG - Intergenic
1186694325 X:12013637-12013659 CTGGATACCCAGGAGGCAGAGGG - Intergenic
1187348342 X:18488505-18488527 CTGGTCAACCAGAAAGAAGAAGG + Intronic
1188216522 X:27485332-27485354 CTGGTGAGCTACAATGAAGAAGG + Intergenic
1188303982 X:28539840-28539862 ATGCAGACACAGAAGGAAGATGG + Intergenic
1189091703 X:38090071-38090093 CAGGAAACCCAAAATGAAAAAGG + Intronic
1193979184 X:88159897-88159919 ATGGAGACTCAGAATGATGGTGG - Intergenic
1195817350 X:108903185-108903207 CTGGTTACCCAGGATGTAGAAGG - Intergenic
1197048661 X:122031291-122031313 TTAGAGACCCAGAAGGAGGAGGG - Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1198312120 X:135434017-135434039 CTGGAGACAGAGGATGGAGAGGG + Intergenic
1198417189 X:136432612-136432634 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1198639088 X:138736315-138736337 CTAGAAACCCAAATTGAAGATGG + Intronic
1199516987 X:148689146-148689168 GTGAAGACACAGAAAGAAGATGG - Intronic
1199780313 X:151052224-151052246 TTGGAGTGCCAGAATGAAAAGGG + Intergenic
1200710125 Y:6475873-6475895 ATGGGGAGCCAGAATGGAGATGG + Intergenic
1200910060 Y:8523971-8523993 ATGGGGAGCCAGAAGGAAGATGG - Intergenic
1200960203 Y:8989482-8989504 ATGGAGAGCCAGAAGGGAGATGG - Intergenic
1201023990 Y:9688835-9688857 ATGGGGAGCCAGAATGGAGATGG - Intergenic
1201150881 Y:11094985-11095007 GTGGACACCCAGGATCAAGATGG + Intergenic
1201516497 Y:14824082-14824104 GTGGAGAGAGAGAATGAAGAAGG + Intronic
1201793094 Y:17864011-17864033 GAGGAGACCTAGAAAGAAGAGGG + Intergenic
1201808460 Y:18041975-18041997 GAGGAGACCTAGAAAGAAGAGGG - Intergenic
1201942792 Y:19477794-19477816 CTGGAGGCCAAGAATTATGAGGG - Intergenic
1202111115 Y:21421701-21421723 ATGGGGACCCAGAAGGCAGATGG + Intergenic
1202183592 Y:22160047-22160069 ATGGGGAGCCAGAATGGAGATGG + Intergenic
1202207767 Y:22426354-22426376 ATGGGGAGCCAGAATGGAGATGG - Intergenic
1202354627 Y:24033255-24033277 GAGGAGACCTAGAAAGAAGAGGG + Intergenic
1202516151 Y:25636857-25636879 GAGGAGACCTAGAAAGAAGAGGG - Intergenic