ID: 915078847

View in Genome Browser
Species Human (GRCh38)
Location 1:153337453-153337475
Sequence CTAGTTTACCAGCACTCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 92}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915078847_915078853 -6 Left 915078847 1:153337453-153337475 CCAATGGAGTGCTGGTAAACTAG 0: 1
1: 0
2: 1
3: 16
4: 92
Right 915078853 1:153337470-153337492 AACTAGCTCAGGGGGAATGAGGG 0: 1
1: 0
2: 1
3: 10
4: 127
915078847_915078858 7 Left 915078847 1:153337453-153337475 CCAATGGAGTGCTGGTAAACTAG 0: 1
1: 0
2: 1
3: 16
4: 92
Right 915078858 1:153337483-153337505 GGAATGAGGGAGGCAGGGTAGGG 0: 1
1: 0
2: 16
3: 209
4: 1710
915078847_915078857 6 Left 915078847 1:153337453-153337475 CCAATGGAGTGCTGGTAAACTAG 0: 1
1: 0
2: 1
3: 16
4: 92
Right 915078857 1:153337482-153337504 GGGAATGAGGGAGGCAGGGTAGG 0: 1
1: 2
2: 30
3: 907
4: 10094
915078847_915078855 1 Left 915078847 1:153337453-153337475 CCAATGGAGTGCTGGTAAACTAG 0: 1
1: 0
2: 1
3: 16
4: 92
Right 915078855 1:153337477-153337499 TCAGGGGGAATGAGGGAGGCAGG 0: 1
1: 0
2: 6
3: 64
4: 1003
915078847_915078852 -7 Left 915078847 1:153337453-153337475 CCAATGGAGTGCTGGTAAACTAG 0: 1
1: 0
2: 1
3: 16
4: 92
Right 915078852 1:153337469-153337491 AAACTAGCTCAGGGGGAATGAGG 0: 1
1: 0
2: 0
3: 13
4: 118
915078847_915078860 13 Left 915078847 1:153337453-153337475 CCAATGGAGTGCTGGTAAACTAG 0: 1
1: 0
2: 1
3: 16
4: 92
Right 915078860 1:153337489-153337511 AGGGAGGCAGGGTAGGGAGAGGG 0: 1
1: 3
2: 30
3: 320
4: 3434
915078847_915078854 -3 Left 915078847 1:153337453-153337475 CCAATGGAGTGCTGGTAAACTAG 0: 1
1: 0
2: 1
3: 16
4: 92
Right 915078854 1:153337473-153337495 TAGCTCAGGGGGAATGAGGGAGG 0: 1
1: 0
2: 2
3: 23
4: 271
915078847_915078856 2 Left 915078847 1:153337453-153337475 CCAATGGAGTGCTGGTAAACTAG 0: 1
1: 0
2: 1
3: 16
4: 92
Right 915078856 1:153337478-153337500 CAGGGGGAATGAGGGAGGCAGGG 0: 1
1: 0
2: 5
3: 170
4: 1472
915078847_915078859 12 Left 915078847 1:153337453-153337475 CCAATGGAGTGCTGGTAAACTAG 0: 1
1: 0
2: 1
3: 16
4: 92
Right 915078859 1:153337488-153337510 GAGGGAGGCAGGGTAGGGAGAGG 0: 1
1: 2
2: 44
3: 483
4: 3252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915078847 Original CRISPR CTAGTTTACCAGCACTCCAT TGG (reversed) Intronic
901248435 1:7752705-7752727 CATGGTTACCAGCACTCCAAGGG - Intronic
902601846 1:17545262-17545284 CCTGTTTACCAGCACACCACTGG + Intronic
907777439 1:57531717-57531739 AAATTTTACCAGCACACCATTGG - Intronic
909761288 1:79290585-79290607 CAAGTTTAGAATCACTCCATTGG - Intergenic
911579648 1:99619994-99620016 GAAGTTTTCCAGCACTCCGTAGG - Intergenic
912963229 1:114214413-114214435 ACAGTTTACCAGCACCCCACTGG - Intergenic
913042812 1:115044481-115044503 CTACTTTTCCTGTACTCCATTGG - Intergenic
915078847 1:153337453-153337475 CTAGTTTACCAGCACTCCATTGG - Intronic
916030908 1:160876806-160876828 TTTGTTTCCCAGCACTGCATTGG - Exonic
920014857 1:202898595-202898617 CTAGTTTACAGGCAATACATGGG + Intronic
1068461445 10:57334968-57334990 ATAGTTTACCAGAACCACATCGG + Intergenic
1073876885 10:107934608-107934630 CTATTTTAACAACATTCCATTGG + Intergenic
1074935522 10:118175984-118176006 TCAGTTTACCAGCACACCATTGG - Intergenic
1075532147 10:123238723-123238745 GCAGTTTACCAGCACACCAGTGG + Intergenic
1075899922 10:126033269-126033291 CCAGTTTGCCAGCATACCATTGG + Intronic
1076276743 10:129205934-129205956 CTATTTTACAAGCAAACCATTGG - Intergenic
1076506871 10:130984162-130984184 CAAGCTCACCAGCACACCATGGG - Intergenic
1081345497 11:41980875-41980897 CTAGTTCAGCACCACTCCAAAGG - Intergenic
1085235427 11:75010753-75010775 CTAGTTTTCCAGGCCTCCAAGGG + Exonic
1086949323 11:92875547-92875569 CTGGTTTACCAGCACACCCCTGG - Intronic
1092517396 12:9229363-9229385 ATACTTTACCAGCACTGCAAGGG + Intergenic
1095928587 12:47604169-47604191 CTGGTTTACCAGCACACCACTGG - Intergenic
1102962796 12:117104208-117104230 CTTGTTTACCAGCTCACCACTGG - Intergenic
1106030665 13:25999295-25999317 TCAGTCTACCAGCTCTCCATGGG + Intronic
1107571671 13:41666653-41666675 CTAGTTTACTAGCACGCCACCGG + Intronic
1108936362 13:55886017-55886039 CTAATTTTCCAGCACTGCAGTGG - Intergenic
1110767260 13:79295071-79295093 CTAGTTTGCCAACAATCCCTGGG + Intergenic
1112798522 13:103084348-103084370 CTATTTTATCTGCACTTCATAGG + Intergenic
1125360020 15:38855254-38855276 CTACTGTACCATCACTCCACTGG + Intergenic
1126539721 15:49808474-49808496 CTGGTTTACCAGCACACCACTGG + Intergenic
1133112686 16:3558005-3558027 CCAGTTTACCAGTACACCACTGG - Intronic
1134374810 16:13662040-13662062 CTAGTCAACCAGCACTCCACAGG + Intergenic
1134540374 16:15059208-15059230 TTAGTTTCTCAGCACTCCAAGGG + Intronic
1139380660 16:66528544-66528566 CAAGTTTGCTAGCATTCCATTGG - Intronic
1145011241 17:19369480-19369502 CTACTTTACCAGCACATCACTGG + Intronic
1148984134 17:51606812-51606834 CTGGTCTACCAGCACACCAATGG - Intergenic
1152990498 18:359317-359339 CTAGTTTACCGGCATGCCACTGG + Intronic
1159605906 18:70474628-70474650 CCAGTTTACCAGCACAACACTGG - Intergenic
1159764516 18:72471700-72471722 CTAATTTACAAGCACTACACAGG + Intergenic
1162206354 19:9059054-9059076 CCATTTTACAAGCACTCCAGGGG + Intergenic
925346264 2:3174104-3174126 CTACTTTACCACGACCCCATTGG + Intergenic
928069513 2:28200732-28200754 CTAGTTTACCAGGTATCTATGGG + Intronic
929299685 2:40288732-40288754 CTAGTTTACCAGCACACCAGTGG + Intronic
930224845 2:48781519-48781541 CTGGTTTACCAGCACAGCACTGG - Intergenic
930384410 2:50675534-50675556 CTAGTTTATCATCACTCCACTGG - Intronic
931704244 2:64934038-64934060 CTGGTTGACCAGCACTCCCTGGG - Intergenic
932117736 2:69068460-69068482 CTATTTGACCAGCTCTTCATGGG - Intronic
939256690 2:139752895-139752917 ATAGCTTACTAGTACTCCATTGG + Intergenic
939694360 2:145305969-145305991 ATAATTTACCAGCACTTCCTGGG + Intergenic
940527619 2:154837495-154837517 CTACTTCACCACCACTCCAGAGG - Intronic
941107703 2:161377615-161377637 CTAGGTTAAAAGAACTCCATAGG - Intronic
944358339 2:198820630-198820652 CCAGTTTACCAGCACACCCCTGG - Intergenic
944636238 2:201678520-201678542 CTATTTCACCAGCACCCCACTGG - Intronic
946987859 2:225293052-225293074 CTAGTTTAAGATCACACCATGGG - Intergenic
947589608 2:231378091-231378113 AATGTTTACCAGCACTCCACTGG + Intergenic
1169580431 20:7016700-7016722 CTAGCTTACCATCACTCAGTTGG - Intergenic
1176983414 21:15408767-15408789 CATGTTTCCCAGCACCCCATAGG - Intergenic
1179062508 21:37992134-37992156 ATTGTTCACCAGCTCTCCATGGG + Intronic
1182741815 22:32573143-32573165 CCAGTTTGCCAGCACACCACTGG + Intronic
955091213 3:55752455-55752477 CTGGTTTACCAGCGCTCTATTGG + Intronic
955583126 3:60446457-60446479 CTGGTTTACACACACTCCATAGG + Intronic
958609563 3:96407417-96407439 CTCATTTACCAACATTCCATAGG + Intergenic
960824655 3:121770265-121770287 CTAGTCTACCAGCATGCCAGAGG + Exonic
965836979 3:172863573-172863595 CCAGTTTTCCAGCACACCTTTGG - Intergenic
965850537 3:173017504-173017526 CCAGGTTACCAGCATACCATTGG - Intronic
981887742 4:149697566-149697588 CAAATTTACCAGCACACCATTGG + Intergenic
982596433 4:157391093-157391115 CCAATTTACCAGCACACCATTGG - Intergenic
983803372 4:171963633-171963655 TTAGGTTACCATCACTCCTTAGG - Intronic
987080921 5:14424615-14424637 ATAGTTTACCACAACTCCAGTGG + Intronic
987181238 5:15370680-15370702 CAACTTTACCAGCCCTCCAGAGG + Intergenic
991184544 5:63792141-63792163 CTAGGTTACCAGCACTCTGAGGG + Intergenic
992798721 5:80276515-80276537 CTAGTTTACCTGCACACAAGGGG + Intergenic
996072574 5:119150314-119150336 CTAGTTTACCAGGACTCAGCCGG + Exonic
999116425 5:149168150-149168172 CTAGTTCACCAGTTCTCTATTGG - Intronic
1001746841 5:174098864-174098886 CTAGTTCTCCAGCGCTACATTGG - Intronic
1005662433 6:28012402-28012424 CTAGTCTACCAGCATGCCAGAGG - Intergenic
1006784834 6:36659355-36659377 CTGGTTTACCAGCACACTACTGG - Intergenic
1007367990 6:41408003-41408025 CTAGTCTACCAGCTCCCCAGGGG + Intergenic
1008362587 6:50638991-50639013 CTATTTTGCCACCATTCCATTGG - Intergenic
1013738581 6:113256984-113257006 CTGGTTTACCAGCATACCACTGG + Intergenic
1014166283 6:118228729-118228751 CTCTTTTACCAGAACTCCAAAGG - Intronic
1014996507 6:128152312-128152334 CTAGTTTACCATCAGTACTTTGG - Intronic
1020211067 7:6158597-6158619 CTGTTTCCCCAGCACTCCATGGG - Intronic
1038315684 8:26482586-26482608 CTCATTTACCTGCAGTCCATGGG - Intronic
1042218205 8:66448496-66448518 CCAGTTTACTAGCACACCACTGG - Intronic
1042738048 8:72010952-72010974 CTAGCTTGCCAGCACACCGTTGG + Intronic
1043112695 8:76207935-76207957 TGAGTTTACTAGCAATCCATGGG - Intergenic
1044400386 8:91763995-91764017 CAGGTTTACCAGCACAACATTGG + Intergenic
1047035182 8:120930421-120930443 TTTGTTTACCAGCACACCACTGG + Intergenic
1047771389 8:128032893-128032915 CTCTTTTGCTAGCACTCCATTGG + Intergenic
1048640517 8:136353579-136353601 CTAGTGTACCAGCTCACCAGGGG + Intergenic
1048722385 8:137340736-137340758 CTTCTTTACCAGCACTCAAAAGG + Intergenic
1051290625 9:15542063-15542085 CTAGTTTACTAGCATGCCACTGG + Intergenic
1055000855 9:71447253-71447275 CTAGGTTACCCGCACTGGATGGG + Intergenic
1055732418 9:79292046-79292068 CTCTGTTACCAGCACTCCATGGG - Intergenic
1057310579 9:93940587-93940609 GTTGTTTCCCAGAACTCCATGGG + Intergenic
1057387684 9:94618918-94618940 CCAGTTTACCAGCACATCACTGG + Intronic
1060398385 9:123332534-123332556 GCAGTTTACCAGCACACCACTGG - Intergenic
1060504642 9:124188657-124188679 CTGGTCTACCAGCACTCCACTGG + Intergenic
1187649497 X:21386481-21386503 CCATTTTACAAGCACTCCATTGG - Intronic
1189588350 X:42485036-42485058 CTACATTACCACCACCCCATAGG + Intergenic
1189914807 X:45846424-45846446 GTAGATTTCCAGCACTCCAGAGG - Intergenic
1191636051 X:63378278-63378300 CAGGTTTACCAGCACACCACTGG - Intergenic
1194797402 X:98228621-98228643 CTAATTTACCTGTACTCCATTGG + Intergenic
1195252257 X:103060657-103060679 TTATTTTACCTGCACTCCATAGG + Intergenic
1197054927 X:122106390-122106412 CTAGTTTACAAGCCCACCAATGG - Intergenic
1197426445 X:126302866-126302888 TTAGATTACCAGGACTCTATTGG - Intergenic
1197651613 X:129071618-129071640 CCAATTTACCAGCACACCACAGG + Intergenic
1198515430 X:137401769-137401791 CCAGTTTACCAGTACTCCACTGG - Intergenic
1198536967 X:137595890-137595912 TTATTTTACCAGTGCTCCATCGG + Intergenic