ID: 915078852

View in Genome Browser
Species Human (GRCh38)
Location 1:153337469-153337491
Sequence AAACTAGCTCAGGGGGAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915078846_915078852 -2 Left 915078846 1:153337448-153337470 CCTTGCCAATGGAGTGCTGGTAA 0: 1
1: 0
2: 0
3: 8
4: 101
Right 915078852 1:153337469-153337491 AAACTAGCTCAGGGGGAATGAGG 0: 1
1: 0
2: 0
3: 13
4: 118
915078847_915078852 -7 Left 915078847 1:153337453-153337475 CCAATGGAGTGCTGGTAAACTAG 0: 1
1: 0
2: 1
3: 16
4: 92
Right 915078852 1:153337469-153337491 AAACTAGCTCAGGGGGAATGAGG 0: 1
1: 0
2: 0
3: 13
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915078852 Original CRISPR AAACTAGCTCAGGGGGAATG AGG Intronic
903583376 1:24389255-24389277 GAACTAGATCACGGGGAATGGGG + Intronic
904966433 1:34378001-34378023 AGACGAGTTCAGAGGGAATGAGG - Intergenic
905106515 1:35566273-35566295 AAGCAAGCTCAGGTGGAAGGAGG - Exonic
909758571 1:79260178-79260200 AAACTAACTCAGGGTTAATCTGG - Intergenic
915078852 1:153337469-153337491 AAACTAGCTCAGGGGGAATGAGG + Intronic
919886160 1:201936491-201936513 AAACTAGAGCAGGAGGAGTGGGG - Intronic
921938903 1:220819724-220819746 AAACAAGCTATTGGGGAATGGGG - Intergenic
1063926543 10:10983295-10983317 AAACTAGCTGAGGGTGCTTGGGG + Intergenic
1065821440 10:29529315-29529337 AAAATAGCACAGGAGGAAAGGGG + Intronic
1067516002 10:46945062-46945084 AAAATATCTTAGGGGTAATGGGG + Intronic
1067646246 10:48106748-48106770 AAAATATCTTAGGGGTAATGGGG - Intergenic
1067930847 10:50559954-50559976 TAAGTAGCTCAGAGAGAATGTGG + Intronic
1070191346 10:74114492-74114514 AAACTAGGTAAGGGAGAAAGAGG + Intronic
1070600896 10:77865614-77865636 AAATTAGGTCAGGATGAATGGGG + Intronic
1073882577 10:108000273-108000295 AAAGTAGGTCTGGGAGAATGGGG + Intergenic
1074472761 10:113742289-113742311 AAACTGGTTCAGGTAGAATGGGG - Intergenic
1075097724 10:119483605-119483627 AAGCAGGCTGAGGGGGAATGGGG - Intergenic
1076579986 10:131500957-131500979 ACACTAGCTCAGAGGGCATTTGG - Intergenic
1077982923 11:7319508-7319530 ACACTAGCTCAGTGGTAATTTGG + Intronic
1079106196 11:17573899-17573921 AAACTAGCTCAGAGAGAATCAGG - Intronic
1080760004 11:35239735-35239757 AAACTATCTCAGAGGCAAGGTGG + Intergenic
1089129179 11:116198982-116199004 ATCCTAGCTCAGAGGGAAAGGGG + Intergenic
1094523617 12:31218002-31218024 AAACATTCTCATGGGGAATGGGG - Intergenic
1095232791 12:39761599-39761621 AAGCTAGCTCTTGGAGAATGGGG + Intronic
1096469381 12:51866410-51866432 ACACTCGCTCAGGGGCAGTGTGG - Intergenic
1096634546 12:52949879-52949901 ACACTGGCTCTGGCGGAATGGGG + Intronic
1097586390 12:61520976-61520998 ACAATAGCTAAGGGGAAATGTGG - Intergenic
1103347943 12:120263998-120264020 AAAATAGCTCAGCTGGAAGGAGG - Intronic
1104569807 12:129915338-129915360 ATTCTAGCTCTGGGGGAGTGGGG - Intergenic
1106630607 13:31467942-31467964 TACCTAGTTCAGGGGGACTGAGG + Intergenic
1110664830 13:78104708-78104730 AAATCACCTCAGGGTGAATGGGG - Intergenic
1111117907 13:83804901-83804923 AAACAAGCTGAGGGGCATTGAGG + Intergenic
1116840743 14:49818849-49818871 AGACTAGCTCAAGGGGAAAAGGG + Intronic
1117348503 14:54857975-54857997 AAAATAGCTGAGCAGGAATGAGG + Intronic
1119758392 14:77134581-77134603 GAACCAGCTCTGGTGGAATGCGG - Intronic
1119986979 14:79149169-79149191 AAACTCTGTAAGGGGGAATGTGG + Intronic
1120140318 14:80923475-80923497 AAACTGGCTCAGAGGAAAAGAGG - Intronic
1126154704 15:45554802-45554824 TGGCTAGCTCTGGGGGAATGGGG - Intergenic
1127731688 15:61807849-61807871 AAAATAGCACAGGGTGAATGAGG - Intergenic
1128200077 15:65797608-65797630 GAACTAGGTCAGTGGGAATGGGG - Intronic
1132117999 15:99151625-99151647 AAACTAGCTCAGGTATAAAGGGG - Intronic
1133803984 16:9108952-9108974 AAAATTGCCCAGGGGAAATGAGG - Intronic
1134346223 16:13394178-13394200 AAACTAGTCCAGAGAGAATGAGG + Intergenic
1137430471 16:48414213-48414235 TAACTGGCTCAGGGGTACTGAGG - Intronic
1140114661 16:72031147-72031169 AAACTGGGCCAGGGAGAATGGGG + Intergenic
1141510851 16:84511181-84511203 AAACCTGCTCAGTGGGAACGCGG - Intronic
1143306889 17:5954455-5954477 AAAGTAGCCCAGGGTGCATGGGG - Intronic
1146562689 17:33884720-33884742 AATCTAGCTTAGGGGGTGTGGGG - Intronic
1147301709 17:39534371-39534393 AACCTAAATCAGGGAGAATGAGG - Exonic
1150759970 17:67952855-67952877 AGACTAGCACAGGGGGAAAGAGG - Intronic
1151101094 17:71556115-71556137 AAACTAGGACATGGGGAAAGTGG - Intergenic
1151190918 17:72397149-72397171 AAACTAGCTCATGGGGTAACTGG + Intergenic
1153952477 18:10068997-10069019 ATCCTAGCCAAGGGGGAATGAGG - Intergenic
1157044049 18:44075632-44075654 AAGCTAGATCAGGGGGAGTATGG + Intergenic
1163776888 19:19224226-19224248 AGACTAGCTCATGGGGAAGGAGG + Intronic
1166328204 19:42064110-42064132 AAACTAGGTCAGGGGCCAAGGGG - Intronic
1166687907 19:44807201-44807223 AAACTCACTCATGGGGAATGCGG - Intergenic
1168416727 19:56174107-56174129 AAACTAGCTAATGGGCAGTGAGG + Intergenic
926441845 2:12897322-12897344 GAACTAGCTCAGGAGGGCTGAGG + Intergenic
931804934 2:65795187-65795209 AAACTGGCTCAGGGGAAAGCTGG - Intergenic
932810033 2:74817503-74817525 AAACTTGCTAAGGGGAAGTGGGG - Intergenic
938420151 2:131139192-131139214 AAACTAGATAATGGGGAAGGTGG - Intronic
942214976 2:173709875-173709897 ATAGTAGCTAAGGTGGAATGGGG - Intergenic
944374155 2:199021321-199021343 GAACTCTCTCAGGAGGAATGAGG + Intergenic
946903682 2:224396160-224396182 AGGCTAGATCAGTGGGAATGTGG - Intronic
1169539795 20:6586958-6586980 AAACTACCGCAGGGGGCATGTGG + Intergenic
1172672759 20:36645712-36645734 AAACAAGCTCAAGGAGAAGGGGG - Intronic
1179318587 21:40269025-40269047 TAAATGGCTCTGGGGGAATGAGG - Intronic
1183165661 22:36145404-36145426 AAACTAGCCCAGGGGAGATCAGG + Intronic
1183193920 22:36340241-36340263 CTAATAGCTCTGGGGGAATGAGG + Intronic
1183922843 22:41183007-41183029 AAACAAGCTCAGGTGAAATAAGG + Intergenic
950350308 3:12343800-12343822 AAACAAGCTCAGAAAGAATGAGG - Intronic
952852170 3:37738432-37738454 ACACAAGCACAGTGGGAATGGGG + Intronic
953328790 3:42034811-42034833 AAACTAGCTCAGGTAGGAAGAGG - Intronic
955787234 3:62553397-62553419 AAACTAAGTCATGGGGAAGGTGG + Intronic
956478499 3:69649051-69649073 AAACTAAACCAAGGGGAATGGGG + Intergenic
956587111 3:70876797-70876819 AAACTTGCTCAGGGGGTCTGGGG - Intergenic
960898436 3:122530211-122530233 AAAATATGTCAAGGGGAATGTGG + Intronic
960985954 3:123281029-123281051 GGACTAGCTCAGTGGGGATGGGG + Intergenic
965143674 3:164870138-164870160 AAACTAAGGCCGGGGGAATGAGG + Intergenic
967271847 3:187739050-187739072 AAACTAGGTCAATGGGAAGGAGG - Intronic
967329672 3:188277885-188277907 AAACTAGCTGTTTGGGAATGGGG + Intronic
968680956 4:1919186-1919208 AAACTAGCACAGAGGGAAGTGGG + Intronic
970764651 4:19532806-19532828 AAACTAGCATAGAGAGAATGAGG - Intergenic
976532925 4:86175875-86175897 AAACAAGATCATGGAGAATGTGG - Intronic
977249753 4:94676689-94676711 AAACCAGCTGTGGGGGATTGAGG + Intergenic
977713201 4:100150644-100150666 AAACAACCTCAGGGGGATTCAGG - Intergenic
985250328 4:188017465-188017487 AAACAAGCTCAGAAGAAATGTGG + Intergenic
987587165 5:19870591-19870613 AAACTTGCTCAGGGGAGGTGTGG - Intronic
988487882 5:31681846-31681868 AAACTAGCTCAAGGGAGCTGGGG - Intronic
988802513 5:34709876-34709898 ACATTATCTCTGGGGGAATGAGG - Intronic
988925335 5:35984411-35984433 AAACAAGCTCAGAAAGAATGAGG - Intronic
990113557 5:52359382-52359404 AAACTGGCTCTGAGGGAAAGAGG - Intergenic
992322597 5:75628706-75628728 TAACTAGGCCAGGGGGAATTTGG + Intronic
992761862 5:79957548-79957570 AAACTAGCACAGTGGAAAGGAGG + Intergenic
996959112 5:129222904-129222926 AAACTAGCTCAATCAGAATGTGG - Intergenic
997549192 5:134737642-134737664 AAACAAGGTGAAGGGGAATGGGG + Intergenic
998197294 5:140085328-140085350 AAAGGGGCTCAGGGGGCATGAGG - Intergenic
1000250925 5:159494582-159494604 AAACTGGCTTAGGGTGAATTGGG + Intergenic
1003589379 6:7424405-7424427 AACCTTGCTCAAGGGAAATGGGG + Intergenic
1003888408 6:10541745-10541767 AAACTAGCTCAAAGGCAAAGAGG - Intronic
1008060046 6:46987379-46987401 AAAATAGCTCAGGGAAAATAAGG - Intergenic
1012400370 6:98837232-98837254 GAAAGAGCTCAGGGGAAATGTGG + Exonic
1013121029 6:107140872-107140894 GAACTAGCTAAAGGGGAAAGTGG + Intergenic
1013813851 6:114074369-114074391 CAACTAGCTCTTGGGGAGTGGGG - Intronic
1014557889 6:122855459-122855481 AAACTAATTCATGGGCAATGAGG + Intergenic
1016312720 6:142751765-142751787 TGGCTATCTCAGGGGGAATGGGG - Exonic
1016356119 6:143220079-143220101 AATCTAGCTTAGGGGGCAGGGGG + Intronic
1017424695 6:154308093-154308115 AAACTAGAACAGGGTGAAAGGGG + Intronic
1019686978 7:2387363-2387385 TAACCAGCTGAGGGCGAATGTGG + Intergenic
1021758167 7:23876090-23876112 AAACTTGCTCAGGTGCAAAGTGG + Intergenic
1029351710 7:100017714-100017736 AAACTACCTCTGGGTGAATATGG - Intronic
1029415454 7:100440375-100440397 AAAATAGCTTAGGAAGAATGTGG - Intergenic
1035066546 7:156109339-156109361 AAAATAGATCAGGAGGAACGGGG - Intergenic
1035657934 8:1325155-1325177 ACACCAGCTCTGGGGGACTGGGG - Intergenic
1044904691 8:96988724-96988746 AGACTTGCTAAGGGGGAAGGAGG + Intronic
1044941036 8:97344001-97344023 AAATTAGCTCAAGGGGAAAGGGG - Intergenic
1045889934 8:107143705-107143727 CATCTAGCTCAGGGTGAATTAGG - Intergenic
1046263637 8:111803035-111803057 AAACTCTCTCAGGGGAAATTGGG + Intergenic
1046701736 8:117408240-117408262 AAGGTAGCTCAGAGGGCATGTGG + Intergenic
1047753070 8:127897150-127897172 AAACTCGCTCAGGGGTAACGGGG - Intergenic
1048250462 8:132862715-132862737 AAACAAGGTCAGGGGGATTGGGG + Intergenic
1049620342 8:143595540-143595562 AAAGTGGCTGAGTGGGAATGTGG - Intronic
1050605652 9:7298400-7298422 AAACTACCTCAAATGGAATGAGG + Intergenic
1050863186 9:10462566-10462588 AAACTATCTTGGGGGAAATGAGG + Intronic
1050880825 9:10698258-10698280 AATCTAGCTCACAGGGAAAGAGG - Intergenic
1059040926 9:110814764-110814786 TAACTAGCTCAGGTTGAATTTGG - Intergenic
1060194163 9:121612509-121612531 AAACAAGCTCACGGGGACTGTGG - Intronic
1061092714 9:128435618-128435640 AGGATAGCTCAGGGGGATTGAGG - Intronic
1062614428 9:137389573-137389595 GTACCAGCTCAGGGGGCATGAGG + Intronic
1188759373 X:34007009-34007031 AAATTAGCTCTGGGGAACTGGGG + Intergenic
1192219358 X:69186698-69186720 AAAGTAGTGGAGGGGGAATGAGG + Intergenic