ID: 915078853

View in Genome Browser
Species Human (GRCh38)
Location 1:153337470-153337492
Sequence AACTAGCTCAGGGGGAATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915078846_915078853 -1 Left 915078846 1:153337448-153337470 CCTTGCCAATGGAGTGCTGGTAA 0: 1
1: 0
2: 0
3: 8
4: 101
Right 915078853 1:153337470-153337492 AACTAGCTCAGGGGGAATGAGGG 0: 1
1: 0
2: 1
3: 10
4: 127
915078847_915078853 -6 Left 915078847 1:153337453-153337475 CCAATGGAGTGCTGGTAAACTAG 0: 1
1: 0
2: 1
3: 16
4: 92
Right 915078853 1:153337470-153337492 AACTAGCTCAGGGGGAATGAGGG 0: 1
1: 0
2: 1
3: 10
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915078853 Original CRISPR AACTAGCTCAGGGGGAATGA GGG Intronic
904966432 1:34378000-34378022 GACGAGTTCAGAGGGAATGAGGG - Intergenic
906133438 1:43476678-43476700 AACTGGCTCAGGGGCAGGGAAGG + Intergenic
906420497 1:45662615-45662637 AAGTATCTCTGGGGAAATGAAGG + Intronic
907137522 1:52153820-52153842 AAGTAGATCATTGGGAATGATGG + Intronic
907221831 1:52912653-52912675 TACTTGTTCAGGGGGAAGGAGGG - Intronic
907518110 1:55006169-55006191 AACTGCCTCAGTGGGAAGGAAGG + Intronic
908396473 1:63729875-63729897 AATTAGCTCAGGGAGGAAGAAGG - Intergenic
911425192 1:97700890-97700912 AACTAGCTAATGTGGAAGGAGGG + Intronic
912714607 1:111974107-111974129 AACTAGCTCAATGCAAATGATGG - Intronic
915078853 1:153337470-153337492 AACTAGCTCAGGGGGAATGAGGG + Intronic
916722558 1:167495518-167495540 AACATGCTGAGGGGGAATAAGGG - Intronic
918084553 1:181234780-181234802 AGCTGGCTCAGAGTGAATGAGGG - Intergenic
918903121 1:190452405-190452427 AAGTAGCACAGGGCTAATGAAGG + Intronic
919192388 1:194239258-194239280 AAATGGCTATGGGGGAATGAGGG - Intergenic
919656222 1:200200041-200200063 AACTTGCTTAGAAGGAATGAAGG - Intergenic
923689206 1:236176467-236176489 AAGCAGCTCAGGGGGCAGGAAGG - Intronic
1068044455 10:51868294-51868316 AACTAGAGCAGAGGGCATGATGG + Intronic
1069747376 10:70724404-70724426 AGCTAGCTCAGGGGAGATCACGG - Intronic
1070096410 10:73341730-73341752 AAATAGCACAAAGGGAATGAAGG - Intronic
1071384168 10:85102893-85102915 GCCTAGTTCAGGGGCAATGATGG + Intergenic
1073320799 10:102615306-102615328 AATCAGCTCATGGGGAATGATGG - Exonic
1075678150 10:124311788-124311810 AATCAGCTCAAGGGAAATGAAGG - Intergenic
1079106195 11:17573898-17573920 AACTAGCTCAGAGAGAATCAGGG - Intronic
1081199333 11:40197637-40197659 GACTATGTCATGGGGAATGATGG - Intronic
1082171330 11:49008917-49008939 AACTATCTCAGAGGCAAGGATGG + Intergenic
1083298834 11:61729619-61729641 ATCCAGCTCAGAGGGGATGAGGG - Intronic
1085808130 11:79655396-79655418 AACTCGCTCAGCAGGAATCATGG + Intergenic
1088264533 11:107976697-107976719 AAGTAGCTCACTGGGAGTGATGG + Intergenic
1088498753 11:110460366-110460388 AACAAGGACAAGGGGAATGATGG - Intronic
1089492390 11:118892215-118892237 TTCTGGCTCTGGGGGAATGAGGG - Intronic
1090033568 11:123228803-123228825 AACTAACTCAGGGAGAGAGAGGG + Intergenic
1091329877 11:134723940-134723962 ACCTAGGTCAGGGAGAAAGAGGG - Intergenic
1098118280 12:67204393-67204415 TACGAACTCAGGGGAAATGAAGG + Intergenic
1101724615 12:107378636-107378658 AGACAGCTCAAGGGGAATGAGGG - Intronic
1102333207 12:112053656-112053678 AACTAGATCAGAAGGAAAGAAGG + Exonic
1107071764 13:36277625-36277647 AACTAGCTCAAGGGAAGTAAAGG + Intronic
1112429771 13:99341242-99341264 AACTACCCCAGGGGTAAAGAAGG - Intronic
1112535078 13:100245907-100245929 CAATACCTGAGGGGGAATGAAGG + Intronic
1114773494 14:25455529-25455551 AACCACATCAGGGGGAAGGAAGG - Intergenic
1114813789 14:25931499-25931521 AACTAGCTGATGAGGAATGAAGG + Intergenic
1118536833 14:66776010-66776032 AACAAGGTCATGGGGAAGGAAGG + Intronic
1120901810 14:89581804-89581826 AAATGGCTCAGTGTGAATGATGG - Intronic
1121729203 14:96174583-96174605 AACCATCTCATGGGGTATGATGG + Intergenic
1123807831 15:23893407-23893429 AATTATTTCTGGGGGAATGAAGG + Intergenic
1125721131 15:41845686-41845708 AAAGAGCTCAGAGGGGATGAAGG - Exonic
1130016149 15:80187957-80187979 ACCTAACTCAGGAGGAAGGAGGG - Intergenic
1132579677 16:679308-679330 AACCAGCTCAGGGGGATTGGTGG + Intronic
1133803983 16:9108951-9108973 AAATTGCCCAGGGGAAATGAGGG - Intronic
1133971820 16:10573596-10573618 ACCAAGCTCAGGGAAAATGAGGG + Intronic
1134638107 16:15808073-15808095 TACTAGCCCAGGGGTATTGATGG - Intronic
1136377473 16:29873743-29873765 AACAAGGTCAGGGGGAGCGAGGG + Intronic
1137430470 16:48414212-48414234 AACTGGCTCAGGGGTACTGAGGG - Intronic
1137492656 16:48945752-48945774 AACTAGCTCAGCGGGCATTAAGG - Intergenic
1143652638 17:8273304-8273326 AGTTAGCTGAGGTGGAATGAAGG - Intergenic
1146891549 17:36509558-36509580 AACTACATCAGGGGGTATGGTGG - Intronic
1147685222 17:42283184-42283206 AACTAGCTCAGCGGGAAGAGCGG + Intergenic
1151352941 17:73542435-73542457 AAACAGCTCAGCAGGAATGAGGG + Intronic
1151968865 17:77446851-77446873 AACTGGCTCAAGGGGAAAAAAGG + Intronic
1152990798 18:362099-362121 GGCTAGCTCACGGGGAAGGATGG - Intronic
1153447325 18:5188509-5188531 AAGGGGCTCAGGGGGAAGGATGG - Intronic
1156926904 18:42593091-42593113 AACTAGCTCTCTGGGGATGATGG - Intergenic
1157582136 18:48779783-48779805 AACCAGCCCAGTGGGAAGGAAGG - Intronic
1158589565 18:58768411-58768433 ACCTAGCCCAGAGGGCATGATGG + Intergenic
1165187348 19:34033493-34033515 AAGTAGCTCAGGGGTAAAGATGG - Intergenic
1166068278 19:40373091-40373113 AACTTGCTCAGGGGGACCTAGGG - Intronic
926678909 2:15649420-15649442 AAGTAGCTGAGGAGAAATGAGGG + Intergenic
926822614 2:16869817-16869839 CACAAGCACAGGGGGCATGATGG - Intergenic
928184887 2:29101454-29101476 ATCCAGCATAGGGGGAATGATGG + Intronic
930613137 2:53565236-53565258 CACTAGCTGAGGTGAAATGAGGG + Intronic
931947705 2:67329481-67329503 AATTTTCTCTGGGGGAATGATGG + Intergenic
938099524 2:128489379-128489401 AACCAGCTAAGGTGGAATGTAGG - Intergenic
940861319 2:158773326-158773348 AGCTGGCTCAGGGGCAGTGAAGG - Intergenic
942043693 2:172087008-172087030 AGCTAGGGCAGAGGGAATGAGGG - Intronic
942215189 2:173712575-173712597 AGGTAGCTCAGGTGCAATGATGG + Intergenic
1169846186 20:9994439-9994461 AACTAGGCTATGGGGAATGATGG + Intronic
1171111127 20:22483467-22483489 CACTAGCTCAAGGAAAATGATGG - Intergenic
1173724242 20:45286262-45286284 AGCTAGCTCTGAGGGAAGGAGGG + Intergenic
1177492588 21:21846885-21846907 CACTTGCTAAGTGGGAATGAAGG + Intergenic
1177840038 21:26225471-26225493 AACCAGCCAAGTGGGAATGAAGG + Intergenic
949626671 3:5874972-5874994 ATCTAACCCAGGTGGAATGATGG + Intergenic
950350307 3:12343799-12343821 AACAAGCTCAGAAAGAATGAGGG - Intronic
950454926 3:13087028-13087050 AACCAGCTGGGGGTGAATGAGGG - Intergenic
952173561 3:30836216-30836238 GGCTAGCTCAGGGAGCATGAAGG - Intronic
952685175 3:36139355-36139377 AACTAGCCCAGGTGTAATAAAGG - Intergenic
953328789 3:42034810-42034832 AACTAGCTCAGGTAGGAAGAGGG - Intronic
953389599 3:42526686-42526708 AAGTGGTTAAGGGGGAATGAGGG - Intronic
955022129 3:55131759-55131781 ACCCAGCTGAGGAGGAATGATGG - Intergenic
955224477 3:57049751-57049773 AACTAGCTCTGGGGGAATGGAGG + Intronic
956587110 3:70876796-70876818 AACTTGCTCAGGGGGTCTGGGGG - Intergenic
960852340 3:122069231-122069253 AACTAGCTCTGACTGAATGAAGG - Intronic
960891806 3:122456558-122456580 AAAGATCTCAGGGGAAATGAGGG + Intronic
963931160 3:151005568-151005590 AAATATCTCAGGGAGAATGAAGG - Intergenic
965056291 3:163721582-163721604 AACAAGCCCAGTGGGCATGAGGG - Intergenic
967271846 3:187739049-187739071 AACTAGGTCAATGGGAAGGAGGG - Intronic
967525641 3:190489240-190489262 AATTAGATCAGGGGGAAGGAAGG - Intergenic
968291654 3:197543868-197543890 AACTCGCTCAGTGTGAATGCAGG + Intronic
968543418 4:1180383-1180405 AACAAACTCTGGGGGAATGGAGG + Intronic
971359319 4:25922353-25922375 CACCAGCTCAGGAGGAAGGATGG + Intronic
972137208 4:35907338-35907360 AACTAGGTCAGAGGGTATAATGG - Intergenic
972659126 4:41097085-41097107 AAATAGCTCAGATGAAATGATGG - Intronic
973252985 4:48080006-48080028 AACTATCTCAGGGAGAATAAAGG - Exonic
974692226 4:65311281-65311303 AAGTATCTCAGAGGAAATGAGGG - Intergenic
975318360 4:72980911-72980933 AAGTAGCTCAAAGGCAATGAAGG + Intergenic
975971978 4:80050458-80050480 AACTAACCCAGGGCTAATGATGG - Intronic
977249754 4:94676690-94676712 AACCAGCTGTGGGGGATTGAGGG + Intergenic
977713200 4:100150643-100150665 AACAACCTCAGGGGGATTCAGGG - Intergenic
983406826 4:167341922-167341944 AACTAGATCAAGTAGAATGATGG - Intergenic
985154969 4:186977946-186977968 AACTAGCTAAAGAGGAATGTTGG + Intergenic
988925334 5:35984410-35984432 AACAAGCTCAGAAAGAATGAGGG - Intronic
991594552 5:68289037-68289059 AACTAACTCAGGGAGAAGGCAGG - Intronic
992073614 5:73171516-73171538 ATCTAGCTCAGTGGGAAAAAGGG + Intergenic
992322598 5:75628707-75628729 AACTAGGCCAGGGGGAATTTGGG + Intronic
997952711 5:138254532-138254554 GCCAAGCTAAGGGGGAATGAGGG - Intronic
1002120227 5:176997901-176997923 AACTAGGTGAAGGGGAATGTTGG - Intronic
1002549733 5:179978594-179978616 AAGTAATGCAGGGGGAATGAGGG - Intronic
1003975002 6:11334005-11334027 AATTAGCTGATGGGGTATGAGGG - Intronic
1013352717 6:109319793-109319815 GACAAGGTGAGGGGGAATGAAGG - Intergenic
1018096952 6:160396512-160396534 AAATAAATCAGTGGGAATGAAGG - Intronic
1018377746 6:163229604-163229626 AACTAACTGAAGGGGAACGATGG - Intronic
1024532241 7:50402982-50403004 AACTGACTCAGGGGGATGGATGG - Intronic
1035257571 7:157641233-157641255 AACTAGCCAAGGGGGAGAGAGGG + Intronic
1041658696 8:60379585-60379607 AACTAGTTCCAGGGGAAAGAAGG + Intergenic
1041714948 8:60924226-60924248 AAATACCTCAGGGGAAACGATGG - Intergenic
1045904136 8:107323115-107323137 AAAGAGCTCAGGGAGAAGGAAGG - Intronic
1046773975 8:118144381-118144403 AACTCTCTCAGTGGGGATGAGGG - Intergenic
1047440074 8:124870026-124870048 AACTAGTTCAGGAGTAGTGATGG - Intergenic
1048009091 8:130442693-130442715 CAGTAGCTCAGGGAGAAGGATGG - Intronic
1050880824 9:10698257-10698279 ATCTAGCTCACAGGGAAAGAGGG - Intergenic
1051117768 9:13716756-13716778 AACAAGTTCAAGGGGAAGGAAGG - Intergenic
1053277668 9:36795445-36795467 AACTAACTCTGGGGTAATCAAGG - Intergenic
1055507957 9:76966999-76967021 ATTTTGCTCAGAGGGAATGATGG - Intergenic
1056888416 9:90466924-90466946 AACTAGGACAGGAGGAAAGAGGG + Intergenic
1203779313 EBV:92048-92070 GAGGAGCTCATGGGGAATGATGG - Intergenic
1186201404 X:7158602-7158624 AACCACAGCAGGGGGAATGAGGG + Intergenic
1188004517 X:25007674-25007696 AACTGGCCCAGGTGGAATGCCGG - Intronic
1191840016 X:65506080-65506102 AAGTAGCTCAGGGGTTGTGAGGG + Exonic
1192219359 X:69186699-69186721 AAGTAGTGGAGGGGGAATGAGGG + Intergenic
1196982278 X:121228042-121228064 AACTTGCACAGGGCGAAGGAGGG + Intergenic
1198668931 X:139056667-139056689 AAATAGCTCAGGAAGAATTAAGG - Intronic