ID: 915078854

View in Genome Browser
Species Human (GRCh38)
Location 1:153337473-153337495
Sequence TAGCTCAGGGGGAATGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 271}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915078846_915078854 2 Left 915078846 1:153337448-153337470 CCTTGCCAATGGAGTGCTGGTAA 0: 1
1: 0
2: 0
3: 8
4: 101
Right 915078854 1:153337473-153337495 TAGCTCAGGGGGAATGAGGGAGG 0: 1
1: 0
2: 2
3: 23
4: 271
915078847_915078854 -3 Left 915078847 1:153337453-153337475 CCAATGGAGTGCTGGTAAACTAG 0: 1
1: 0
2: 1
3: 16
4: 92
Right 915078854 1:153337473-153337495 TAGCTCAGGGGGAATGAGGGAGG 0: 1
1: 0
2: 2
3: 23
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915078854 Original CRISPR TAGCTCAGGGGGAATGAGGG AGG Intronic
900094769 1:935902-935924 GAGCACAGGGGGCCTGAGGGCGG + Intronic
901029939 1:6301148-6301170 TAGCTGTGGGGGAAGGAGGAGGG + Intronic
903335840 1:22623944-22623966 GAGCTCAGGGGGAAGCAAGGCGG + Intergenic
903563510 1:24246730-24246752 TAGCTCAGGGGGAAACAGGGTGG - Intergenic
904265173 1:29314449-29314471 GAGCTGAGGGGGAAGGAGAGTGG - Intronic
904333586 1:29783363-29783385 GAGCTCAGGGGCCATGAGGATGG + Intergenic
905970966 1:42142112-42142134 GAGCTCAGGGGGAAGGTGGGAGG + Intergenic
907285735 1:53378310-53378332 CAGCTCAGGGGATACGAGGGTGG + Intergenic
907717860 1:56944336-56944358 TGCCTCAGGGAGAATTAGGGAGG - Intronic
910378244 1:86596575-86596597 TGGCTGAAGGGGAAGGAGGGAGG - Intergenic
911227184 1:95318955-95318977 GGGCTCTGGGGAAATGAGGGTGG + Intergenic
913668690 1:121074353-121074375 TAGCTCAGGGGAATTAAAGGAGG + Intergenic
914020434 1:143861796-143861818 TAGCTCAGGGGAATTAAAGGAGG + Intergenic
914658934 1:149769708-149769730 TAGCTCAGGGGAATTAAAGGAGG + Intergenic
915078854 1:153337473-153337495 TAGCTCAGGGGGAATGAGGGAGG + Intronic
917237719 1:172912807-172912829 TGGCTCAGGTGGCATGTGGGAGG - Intergenic
918037950 1:180893873-180893895 TAACTATGGGGCAATGAGGGTGG + Intergenic
918399866 1:184152790-184152812 CAGCTCAGTGGGGATGAGGAAGG - Intergenic
919681492 1:200439897-200439919 TAGCTCAGAGAGGATGATGGTGG + Intergenic
919790921 1:201290480-201290502 TAGTTCCTGGGGAATGGGGGAGG - Intronic
919861690 1:201742883-201742905 GAGCTTGGGAGGAATGAGGGAGG + Intronic
920307830 1:205030398-205030420 TAGCTCATGTGGAAGGTGGGGGG - Intergenic
920867785 1:209767813-209767835 AAGCTTTGTGGGAATGAGGGGGG + Intronic
920924502 1:210328959-210328981 CAGCTCCGGGGGAAAGAGGGTGG + Exonic
921749415 1:218775544-218775566 TCTCTCTGGGGGAATGAGGAGGG - Intergenic
922885347 1:229016039-229016061 CAGCTCAGGGGGAATGTAAGAGG + Intergenic
923306882 1:232696718-232696740 TATCTCAAGGGGAATGGGGCTGG - Intergenic
924015035 1:239711927-239711949 TAGCTAAAGGGGAATGGGGCTGG - Intronic
924380759 1:243462115-243462137 TAGCACAGAGGGAATGAAGGGGG + Intronic
924777840 1:247122942-247122964 TAGGTCATGGGGAATTAGGTTGG - Intronic
1070219183 10:74422819-74422841 GAGGTCAGGGTGACTGAGGGTGG + Intronic
1073425694 10:103454368-103454390 TAGCCCAGGTGGGATGAGGGTGG - Exonic
1075449993 10:122544634-122544656 GAGCTGAGGGTGATTGAGGGGGG + Intergenic
1076722557 10:132399053-132399075 AGGCTCAGGGGAGATGAGGGAGG - Intronic
1077127051 11:944877-944899 TAGGTTGGGGGGAATGAAGGTGG + Intronic
1077233457 11:1468849-1468871 TAGCTAAGGGGGATGGGGGGGGG + Intergenic
1077597160 11:3543773-3543795 GGGCTCAGGGGGAAGGTGGGAGG - Intergenic
1078008117 11:7547746-7547768 TAGCTTAGAGGGAATGAGAATGG - Intronic
1078355845 11:10630834-10630856 TAGCTAATGGGGAATCAGAGAGG - Intronic
1078357948 11:10646881-10646903 TAGCTGAAGGAGAATGAGGAAGG - Intronic
1078760146 11:14245188-14245210 TAGGGCAGTGGGAGTGAGGGAGG + Intronic
1079372907 11:19867243-19867265 TGGCTTAGAGGGAATGAGGGAGG - Intronic
1082080171 11:48006636-48006658 ATGCTCAGTAGGAATGAGGGAGG - Intronic
1083427575 11:62596530-62596552 TAGCTAAGGGGGGCAGAGGGAGG + Exonic
1084253090 11:67917744-67917766 GGGCTCAGGGGGAAGGTGGGAGG - Intergenic
1084960179 11:72712403-72712425 GGGCTCAGTGGGAAGGAGGGTGG + Intronic
1085027641 11:73245949-73245971 TAGCTCAGGCAGGCTGAGGGAGG - Intergenic
1085807982 11:79653990-79654012 TATCTGAGAGGGAAGGAGGGAGG - Intergenic
1085989539 11:81825267-81825289 AAGGTGAGGGGGAAGGAGGGAGG + Intergenic
1087219368 11:95529442-95529464 TAGCTCTGGAAGAATGATGGTGG + Intergenic
1089538167 11:119173407-119173429 TAGCTTAGGGCCAATCAGGGCGG - Intronic
1089653369 11:119929851-119929873 TTGCTCATGGGGAATGACTGAGG - Intergenic
1090439800 11:126716046-126716068 GAGGTGAGGGGGAATGTGGGAGG + Intronic
1091169317 11:133506392-133506414 ATGCTCAGGGGTAATGAGCGCGG + Intronic
1092489514 12:8932785-8932807 TGGCTGAGGGGCAGTGAGGGTGG - Exonic
1092741682 12:11636534-11636556 TACCAAAGGGGGAATGAGAGTGG - Intergenic
1094348563 12:29498049-29498071 AAGCTCAGGGGCAATGAAGCTGG + Intergenic
1094365408 12:29674640-29674662 CAGCTCAGGAGGAGGGAGGGAGG + Intronic
1094693421 12:32792753-32792775 GAGATCAGGGAGAATGAGTGAGG + Intronic
1095236447 12:39801945-39801967 AAGCTCTGTGGGAATGAGGATGG - Intronic
1096358988 12:50967257-50967279 CAGCTCTGTGGGAATGAGGCAGG - Intronic
1096372869 12:51083402-51083424 TAGCCCGGTGGGAAGGAGGGAGG + Exonic
1096946421 12:55413387-55413409 TGGCTGAGGGGCAGTGAGGGTGG + Intergenic
1098150007 12:67537194-67537216 TGGCTCAAGGGGGATGACGGTGG - Intergenic
1099242213 12:80151694-80151716 TAGAACAGAGGGAATGATGGTGG + Intergenic
1100358152 12:93851278-93851300 TGGCCCAGGGTGAATGAGGTTGG + Intronic
1100788571 12:98105630-98105652 TAGCTCACGCAAAATGAGGGTGG - Intergenic
1103004136 12:117408309-117408331 CAGCTCCTGGGGAAGGAGGGGGG - Intronic
1103085867 12:118061337-118061359 TTGCTCAGGGGAAACGGGGGCGG + Intronic
1103347942 12:120263994-120264016 TAGCTCAGCTGGAAGGAGGCTGG - Intronic
1103482188 12:121257889-121257911 TAAATCAGGTGGCATGAGGGAGG + Intronic
1103715922 12:122945288-122945310 TAGCTGCGGAGGAATGAGGAGGG - Intronic
1103964620 12:124630891-124630913 TAGCTCTGTGGGAATGTGAGAGG + Intergenic
1103989011 12:124785963-124785985 CTGCTCAGGGGGATTGAGGGGGG - Intronic
1105479560 13:20761846-20761868 TAATTCAGGTGGAATGTGGGAGG + Intronic
1105531262 13:21222553-21222575 CAGCTCAGGGGAATGGAGGGTGG - Intergenic
1106630610 13:31467946-31467968 TAGTTCAGGGGGACTGAGGAGGG + Intergenic
1107971217 13:45644645-45644667 TAGATCAAAGGAAATGAGGGAGG + Intergenic
1108573750 13:51773618-51773640 CTGCTCAGAGGGAATGAGGACGG - Intronic
1112617357 13:101019035-101019057 TGGCTCAGAGGGAATGGTGGAGG + Intergenic
1112922667 13:104634775-104634797 AAGGTGAGGGGCAATGAGGGTGG - Intergenic
1115027807 14:28764494-28764516 GAGCTAAGGGAGAAGGAGGGAGG + Intergenic
1115057469 14:29147550-29147572 TAGTTCAGTGGTAATGTGGGTGG + Intergenic
1115649089 14:35390415-35390437 TAGCTGGGAGAGAATGAGGGAGG - Intergenic
1117194858 14:53329647-53329669 CAGCAGAGGGGGAATGAGGATGG - Intergenic
1117352551 14:54895822-54895844 TAGCTCATGGGCTAGGAGGGAGG - Intronic
1117429189 14:55635592-55635614 TTGCTCAGGCTGACTGAGGGAGG + Intronic
1117453578 14:55875928-55875950 AAGATCAGGGGAAGTGAGGGTGG - Intergenic
1118538896 14:66801632-66801654 TAGCTCAAGGAGAGAGAGGGGGG - Intronic
1119268402 14:73279186-73279208 TAGCTGAGTGGGAACTAGGGAGG - Intronic
1120901807 14:89581801-89581823 TGGCTCAGTGTGAATGATGGGGG - Intronic
1122035933 14:98949429-98949451 TAGCTCAGGGGGAAAGGAGGGGG + Intergenic
1126646729 15:50882320-50882342 CAGCTCAAGGGGAATGCAGGTGG - Intergenic
1127704960 15:61537355-61537377 TAGGTCAGGGAGGATGAGGATGG + Intergenic
1128605685 15:69035264-69035286 TAGCTCAGGAGGATGCAGGGAGG + Intronic
1129377119 15:75140666-75140688 AAGATCAGGGGAAAGGAGGGGGG + Intergenic
1129671503 15:77610351-77610373 GGGCTCTGGGGGAATGTGGGTGG + Intergenic
1129733664 15:77946911-77946933 TAACTCAGTAGGACTGAGGGGGG + Intergenic
1130410102 15:83639953-83639975 CAGCTCAGGTGGTTTGAGGGAGG + Intergenic
1130763877 15:86850578-86850600 GAGCCCAGAGGAAATGAGGGTGG - Intronic
1130931084 15:88428450-88428472 TAGCTTGTGGGGACTGAGGGTGG - Intergenic
1131215743 15:90533840-90533862 AGGCTCAGGGGGAGTGGGGGAGG + Intronic
1131798757 15:96047808-96047830 AAGCGCAGGGGGAATAAGGAGGG - Intergenic
1132214732 15:100054159-100054181 TTCCACAGGGGGAAGGAGGGAGG + Intronic
1132681381 16:1143686-1143708 AAGCCCAAAGGGAATGAGGGGGG + Intergenic
1133294482 16:4744679-4744701 TAGCTCAGCAGGGCTGAGGGGGG - Intronic
1134002326 16:10792469-10792491 TAGCTCAGGAGGCCTGGGGGTGG - Intronic
1136274695 16:29172121-29172143 TAGCCCAGGGAGACAGAGGGTGG + Intergenic
1137752607 16:50877960-50877982 CAGCTCAGAGGCAATGAGTGTGG + Intergenic
1138095169 16:54205749-54205771 TAGCTGATGAGAAATGAGGGTGG - Intergenic
1138636429 16:58342401-58342423 CAGGGCAGGGGGAATGAAGGGGG - Intronic
1138815692 16:60200532-60200554 TGGATCCGGGGGGATGAGGGTGG + Intergenic
1139291318 16:65860523-65860545 TAGTTGAGGGGGAGTGTGGGTGG - Intergenic
1140698190 16:77555954-77555976 GTGCTCAGGGGGAATGCGTGAGG - Intergenic
1140966997 16:79976534-79976556 TAGCTGAAGGGCAATGTGGGAGG - Intergenic
1141154224 16:81585926-81585948 GAGCTCATGGAGAATGGGGGAGG - Intronic
1142078989 16:88137879-88137901 TAGCCCAGGGAGACAGAGGGTGG + Intergenic
1143373778 17:6455687-6455709 CAGCGCAGGGGGAAGAAGGGAGG + Intronic
1143604530 17:7974719-7974741 TACCTCAGGTGGAAGGAGAGAGG + Intergenic
1143997768 17:11022831-11022853 GGACTCAGGGGGAATGTGGGAGG + Intergenic
1144958775 17:19033144-19033166 GGGCTCAGGGTGAATGTGGGGGG + Intronic
1144976384 17:19141380-19141402 GGGCTCAGGGTGAATGTGGGGGG - Intronic
1145935889 17:28714574-28714596 AAGCTCTGGAGGAATGAGGGTGG + Exonic
1145946290 17:28777343-28777365 TACCTTTGGGGGAATCAGGGTGG - Intronic
1147318467 17:39632263-39632285 GAGCCCAGGAGGCATGAGGGAGG + Intronic
1148217342 17:45840314-45840336 TAGCTGAGGGGGCAGTAGGGTGG + Intergenic
1150862782 17:68818305-68818327 TAACTCATGGGGGATGAGGGGGG + Intergenic
1151213914 17:72564484-72564506 AAGCTCAGGGGGATGGATGGAGG + Intergenic
1151577290 17:74959133-74959155 TGGCTCTGGGGGATGGAGGGGGG - Intronic
1152444097 17:80330590-80330612 AATCTCAGGGGGAAGGAGGATGG - Intronic
1152468104 17:80476850-80476872 GAGCTCAGGGGGAAGGAAGTCGG + Intronic
1152519056 17:80844898-80844920 TTGCTCGGGGGGAAGGTGGGTGG - Intronic
1152677964 17:81651307-81651329 TGGCTGTGGGGGAAGGAGGGTGG + Intronic
1153619043 18:6959277-6959299 GAGCTCAGAGGGAATGTGGGAGG - Intronic
1153952474 18:10068993-10069015 TAGCCAAGGGGGAATGAGGAGGG - Intergenic
1155507938 18:26549555-26549577 TTGCTCAGGGGCAGGGAGGGCGG - Intronic
1156841766 18:41617440-41617462 TTGCACAGGGGGACAGAGGGAGG + Intergenic
1158847821 18:61463319-61463341 AAGCTCTGGGAGGATGAGGGAGG - Intronic
1160878397 19:1308499-1308521 CAGCCCAGGGAGAATGAGGCTGG + Intergenic
1162531259 19:11237607-11237629 GGGCTCAGGGGGAGGGAGGGAGG + Intronic
1165811391 19:38614079-38614101 TAGCTCCCTGGGAATGAGAGGGG + Exonic
1166714235 19:44956227-44956249 CAGCTCAGGGGAAAGGAGTGCGG + Intronic
1166781271 19:45344929-45344951 TAGGTTGGGGGGAATGAGGATGG - Intronic
1168265300 19:55220206-55220228 TAGCTCAGGGGAAAGGACTGTGG + Intergenic
925287774 2:2727174-2727196 AAGCTGGGGGGGAATGTGGGGGG - Intergenic
925374841 2:3376921-3376943 TGCGTCAGGGGGAATGAGGTAGG - Intronic
925459134 2:4044692-4044714 TAGCTCAGGAGGAAGGTGTGAGG - Intergenic
926325810 2:11784561-11784583 GATCGCAGGGGGACTGAGGGTGG - Intronic
926613428 2:14970838-14970860 TAGCCCAGTGGGACTGAGGCTGG - Intergenic
926678910 2:15649423-15649445 TAGCTGAGGAGAAATGAGGGCGG + Intergenic
928825543 2:35416145-35416167 TTGCTCAGTGGGAATGATGAAGG + Intergenic
929090632 2:38213893-38213915 TAGCTCTGGAGGAATGAGGATGG - Intergenic
929559324 2:42945896-42945918 TAGGTGTGGGGGCATGAGGGGGG + Intergenic
934717785 2:96553327-96553349 TGGCTCAGGAGGAGGGAGGGTGG + Intergenic
936611503 2:114006266-114006288 GAACTCAGGGGGAAAAAGGGTGG + Intergenic
939802426 2:146726630-146726652 TTAAGCAGGGGGAATGAGGGAGG + Intergenic
941586662 2:167367759-167367781 TTGCTCAGGGGAGAAGAGGGTGG - Intergenic
942043692 2:172087005-172087027 TAGGGCAGAGGGAATGAGGGAGG - Intronic
942214974 2:173709871-173709893 TAGCTAAGGTGGAATGGGGAGGG - Intergenic
942215192 2:173712578-173712600 TAGCTCAGGTGCAATGATGGGGG + Intergenic
942770445 2:179511566-179511588 TAGCACATGGGAATTGAGGGAGG + Intronic
944516818 2:200520850-200520872 TAGCTACAGGGGAATGAGGTTGG - Intronic
945774696 2:214091109-214091131 TAGCTCAGTGGGATTGAAGTAGG - Intronic
946383860 2:219369481-219369503 CTGCTCAGGGGGACTGAGGCAGG + Intergenic
948294163 2:236848298-236848320 TAGCCCAGGAGAGATGAGGGGGG - Intergenic
948856503 2:240732749-240732771 GGGATAAGGGGGAATGAGGGAGG + Intronic
948856542 2:240732878-240732900 GGGATGAGGGGGAATGAGGGAGG + Intronic
948856581 2:240733003-240733025 GGGATGAGGGGGAATGAGGGAGG + Intronic
948856591 2:240733024-240733046 GGGATGAGGGGGAATGAGGGGGG + Intronic
948993262 2:241565070-241565092 CAGCTGACGGGGAATGTGGGCGG + Intronic
1169325284 20:4670731-4670753 GAGCACAGGGAGAATGGGGGAGG + Intergenic
1169531775 20:6492661-6492683 CAGCTCAGGATGAAGGAGGGTGG + Intergenic
1169690517 20:8325766-8325788 TAGTTAAGCGGGAATGGGGGTGG + Intronic
1170289108 20:14747649-14747671 TTGCTCGGGTGGAAGGAGGGAGG + Intronic
1170570871 20:17631789-17631811 CAGCTCTGCAGGAATGAGGGCGG - Intronic
1170587489 20:17745700-17745722 GGGGGCAGGGGGAATGAGGGGGG + Intergenic
1171536713 20:25898940-25898962 AAGCTGAGGGGGTCTGAGGGTGG + Intergenic
1173312150 20:41906214-41906236 TAGCTCAGGGGTAGTGGGGCAGG - Intergenic
1173397330 20:42691629-42691651 CAGCCCTAGGGGAATGAGGGAGG - Intronic
1173850198 20:46212965-46212987 TGCCTCAGGAGGAATGGGGGAGG - Intronic
1175134627 20:56813805-56813827 TGTTGCAGGGGGAATGAGGGAGG - Intergenic
1176039413 20:63056411-63056433 TGGCTCTGGTGGAATGAGGACGG + Intergenic
1176674645 21:9767326-9767348 AAGCTCAGGGAGGGTGAGGGTGG - Intergenic
1177954663 21:27582845-27582867 TAGCTCTGAGGTAAAGAGGGTGG - Intergenic
1178043011 21:28662370-28662392 CAGCGGAGGGGGAAAGAGGGAGG - Intergenic
1178693904 21:34776310-34776332 TAGCAGAGGGGGAGTGACGGGGG - Intergenic
1179169894 21:38964609-38964631 CAGCTCAGTGAGAGTGAGGGTGG - Intergenic
1179245770 21:39632935-39632957 TAGCTCAGTGGGAAAGAAGTAGG - Intronic
1179716230 21:43290157-43290179 AAGCTCAGGCGGGTTGAGGGGGG + Intergenic
1180191712 21:46168483-46168505 TGGCTCTGGGGGACTGAGGAAGG + Exonic
1181967702 22:26668392-26668414 CAGCTCCAGGGGTATGAGGGAGG + Intergenic
1182072761 22:27475188-27475210 AAGCTCAGGGAGAAGGAGGCTGG + Intergenic
1182125248 22:27811164-27811186 TGGCTCAGGTGGAGAGAGGGAGG + Intergenic
1182270526 22:29150354-29150376 TAGCTCTGGGTGACTGAGCGGGG + Intronic
1183894876 22:40960250-40960272 GAGTTGAGGGGGAAGGAGGGAGG + Intronic
1185400135 22:50611307-50611329 GAGCTCAGGGGGAAGCAGGGAGG + Exonic
949518650 3:4829857-4829879 AGGCTCAGGGGGAGGGAGGGAGG - Intronic
950466931 3:13161278-13161300 CAGCCCAGGGGGAGTGCGGGAGG + Intergenic
950663080 3:14479011-14479033 CAGCTCAGGGGCCATGAGTGGGG - Intronic
951385170 3:22032834-22032856 TAGCTCAGGGGTAATTGTGGAGG - Intronic
951619723 3:24587954-24587976 GAGCTGAGGGGATATGAGGGGGG - Intergenic
953023485 3:39130887-39130909 CAGCTAATGGGGAATGGGGGAGG - Intronic
953172414 3:40519335-40519357 TAGGACAGGGGGACTGAGGCAGG - Intergenic
953193783 3:40713333-40713355 AACCTCAGGGGGTATGAGGGAGG - Intergenic
957067161 3:75534244-75534266 GGGCTCAGGGGGAAGGTGGGAGG - Intergenic
960965158 3:123099576-123099598 TTGCTCAGGTGGAGTGAGGCAGG + Intronic
960985955 3:123281033-123281055 TAGCTCAGTGGGGATGGGGTTGG + Intergenic
961053329 3:123766294-123766316 CAGAGAAGGGGGAATGAGGGTGG - Intronic
961285989 3:125803738-125803760 GGGCTCAGGGGGAAGGTGGGAGG + Intergenic
961900756 3:130209120-130209142 GGGCTCAGGGGGAAGGTGGGAGG - Intergenic
962823829 3:139080809-139080831 AAGCCCAGGGGGAATAATGGTGG + Intronic
962977024 3:140454964-140454986 AATCTCAGGGGAAGTGAGGGAGG - Intronic
963305973 3:143653394-143653416 TTGCCAAGGGGGAAAGAGGGAGG + Intronic
963931159 3:151005565-151005587 TATCTCAGGGAGAATGAAGGAGG - Intergenic
968077620 3:195825127-195825149 GAGTTCATGGGGAATGAGAGAGG + Intergenic
968490937 4:890204-890226 TCGCTCAGGGGTTATGTGGGAGG - Intronic
968601512 4:1512095-1512117 GAGGTGAGAGGGAATGAGGGAGG + Intergenic
968858398 4:3146996-3147018 TTCCTTAGGGGGAATGGGGGTGG + Intronic
969011754 4:4070828-4070850 GGGCTCAGGGGGAAGGTGGGAGG - Intergenic
969706565 4:8795377-8795399 AAGCTCAGGGGCAATGTGGCGGG + Intergenic
969801713 4:9571761-9571783 GGGCTCAGGGGGAAGGTGGGAGG + Intergenic
970669607 4:18380762-18380784 TACCTCAGCTGGAATGAGGGAGG - Intergenic
971243177 4:24906847-24906869 CACCTGAGGGGGGATGAGGGAGG + Intronic
971380123 4:26088942-26088964 CAGGTCAGAGGGAATGGGGGTGG + Intergenic
971895642 4:32590315-32590337 TACCTCAGGCAGGATGAGGGAGG + Intergenic
973676379 4:53268059-53268081 TAGGGCAGGAGGAATGAAGGAGG + Intronic
973849046 4:54943166-54943188 TGGCTGATGGGGAGTGAGGGTGG - Intergenic
986279900 5:6314428-6314450 GAGCTCAGGGGGAAAGCAGGGGG - Intergenic
990879223 5:60520916-60520938 TAGGACAGGGGCAGTGAGGGAGG - Intronic
992322599 5:75628710-75628732 TAGGCCAGGGGGAATTTGGGTGG + Intronic
995972942 5:117994947-117994969 CAGTTCAGGGGGATGGAGGGAGG + Intergenic
996438908 5:123467284-123467306 TGGCTCAGGTGGGATGATGGAGG - Intergenic
997631067 5:135369314-135369336 GCCCACAGGGGGAATGAGGGGGG + Intronic
997702994 5:135917897-135917919 TAGGGCAGAGGGAAGGAGGGAGG + Intergenic
998156855 5:139792053-139792075 TGGTTGAGGGGGAATGAGTGTGG + Intergenic
998588835 5:143456178-143456200 TAGCACAGGAGGGATGTGGGAGG - Intergenic
999147344 5:149405271-149405293 TTCCTCAGAAGGAATGAGGGAGG + Intergenic
999429245 5:151511935-151511957 TACTTCTGGGGGGATGAGGGAGG - Intronic
1000570856 5:162912212-162912234 TATCTGATGGGGATTGAGGGAGG - Intergenic
1001033594 5:168280732-168280754 TATTTCAGAGGGAAGGAGGGAGG - Intergenic
1001229307 5:169972000-169972022 TAGCTCAGCAGGAAAGAGTGTGG - Intronic
1002552965 5:180010730-180010752 TAGGGAAGGGGGAAGGAGGGAGG + Intronic
1002823982 6:755903-755925 TATCTCAGGGCTAATGATGGTGG - Intergenic
1003081947 6:3027978-3028000 TAGCTCACGGAGAGTGGGGGAGG - Intergenic
1003887629 6:10535513-10535535 TAACTCAGGAGGAAAGTGGGAGG - Intronic
1004117172 6:12780948-12780970 TAGCTGAAGGGGAAAGAGAGAGG - Intronic
1004168965 6:13281016-13281038 GTGCTCAGAGGGAATGAGCGAGG - Intronic
1005359046 6:25013381-25013403 TAGGGCAGGGGGAATGAATGAGG + Intronic
1006930611 6:37685851-37685873 TAGCTCAGGTGGGGTGGGGGTGG - Intronic
1007763995 6:44150429-44150451 TAGCTCAGGAGGCCTGGGGGTGG - Intronic
1007791719 6:44312960-44312982 TAGCTTTTGGGGAAAGAGGGCGG - Intronic
1007922543 6:45623874-45623896 ATGCTCAGAGGGAATGAGTGAGG - Intronic
1011443761 6:87415108-87415130 TATCACAGGAGGAATGAGGAGGG + Intronic
1012480759 6:99664403-99664425 AAGCTGAGGGGGCATGAGTGAGG + Intergenic
1012837104 6:104282718-104282740 TATCCCAGGGGAAATGAGAGGGG - Intergenic
1013352716 6:109319790-109319812 AAGGTGAGGGGGAATGAAGGAGG - Intergenic
1018861222 6:167712252-167712274 TAATGGAGGGGGAATGAGGGTGG + Intergenic
1021930987 7:25581179-25581201 TATCTCAGGGTGAAAGAGGTCGG + Intergenic
1022786871 7:33646985-33647007 TAGCTCTGAGGGAATAAAGGGGG - Intergenic
1023874311 7:44278492-44278514 TAGCTGAGGAGGAATGGGGGAGG - Intronic
1024589283 7:50867227-50867249 TCTCTCAGCGGGGATGAGGGTGG + Intergenic
1026070433 7:67114141-67114163 TAGCTCAGGAGGAAGAGGGGAGG - Intronic
1028935884 7:96463498-96463520 TGGCTCAGGGGCAGTGAGTGGGG - Intergenic
1032573140 7:133022735-133022757 TATCTCAGGTGGAATGGGGTGGG - Intronic
1034590760 7:152137099-152137121 TTGCACAGAGGAAATGAGGGAGG + Intronic
1036247536 8:7131503-7131525 GGGCTCAGGGGGAAGGTGGGAGG + Intergenic
1036886731 8:12562500-12562522 GGGCTCAGGGGGAAGGTGGGAGG - Intergenic
1037308986 8:17535300-17535322 AAGCTCAGTGAGAAGGAGGGCGG - Intronic
1037438287 8:18888056-18888078 TAGCTTAGGGGTAGGGAGGGTGG - Intronic
1037805051 8:22054383-22054405 TTTCTCAGGTGGAATGAGAGAGG + Intronic
1040639058 8:49310521-49310543 TAGCCCAGAGGGAGAGAGGGAGG + Intergenic
1042388565 8:68205446-68205468 TTGCTCAGGGTGAATAAGGTGGG + Intronic
1044744840 8:95362030-95362052 TTGCTCTGGAGGAATGAGGCAGG + Intergenic
1045414730 8:101954381-101954403 GAGGTCAGGGGAAATGAGGAGGG - Intronic
1047628904 8:126684351-126684373 TACATCATGGGGACTGAGGGAGG + Intergenic
1047879338 8:129176417-129176439 TAGCTCAGGGGAAATGGCAGGGG + Intergenic
1048578749 8:135713511-135713533 AAGCACAGAGGGAAGGAGGGAGG + Intergenic
1049010269 8:139882646-139882668 CAGCACAGGGGGTAGGAGGGTGG + Intronic
1049429523 8:142553423-142553445 GAGCTCTGGGAGAATGAGAGAGG - Intergenic
1049481006 8:142822682-142822704 TCTCTCAGGGGGAATGAAGCAGG - Intergenic
1053737909 9:41113350-41113372 TAGCTGGGGGGGAAAGGGGGTGG - Intergenic
1054690440 9:68317970-68317992 TAGCTGGGGGGGAAAGGGGGTGG + Intergenic
1057523580 9:95780202-95780224 TTACTCAGGGGGAACGAGGAGGG - Intergenic
1058054400 9:100435112-100435134 TTGCGCAGAGGGAATGAGGCAGG + Intronic
1059421503 9:114195366-114195388 TGGCTCATGGGGTATGATGGGGG - Intronic
1061092712 9:128435614-128435636 TAGCTCAGGGGGATTGAGGCGGG - Intronic
1061226542 9:129283962-129283984 CAGCTCCGGGGGAATGGGGAGGG - Intergenic
1061713029 9:132500652-132500674 TTTCTCAGGGGGAGTGTGGGAGG - Intronic
1062665677 9:137670269-137670291 GATCTAAGGGAGAATGAGGGAGG - Intronic
1203779310 EBV:92045-92067 GAGCTCATGGGGAATGATGGGGG - Intergenic
1186201406 X:7158605-7158627 CACAGCAGGGGGAATGAGGGAGG + Intergenic
1187280572 X:17855539-17855561 TAGCTCAGGTGCCATGATGGAGG - Intronic
1189420543 X:40853723-40853745 TAGCTCTGTGGGGATGTGGGTGG - Intergenic
1194263110 X:91722072-91722094 AAACTCAGGGGGAATGGGGGTGG + Intergenic
1195010631 X:100729854-100729876 CAGGGGAGGGGGAATGAGGGAGG + Intronic
1197342407 X:125288986-125289008 TAGCTCTGGGGTATTGATGGCGG - Intergenic
1199939758 X:152613511-152613533 TAGCTTAGAGGGTTTGAGGGTGG - Intergenic