ID: 915078855

View in Genome Browser
Species Human (GRCh38)
Location 1:153337477-153337499
Sequence TCAGGGGGAATGAGGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1074
Summary {0: 1, 1: 0, 2: 6, 3: 64, 4: 1003}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915078847_915078855 1 Left 915078847 1:153337453-153337475 CCAATGGAGTGCTGGTAAACTAG 0: 1
1: 0
2: 1
3: 16
4: 92
Right 915078855 1:153337477-153337499 TCAGGGGGAATGAGGGAGGCAGG 0: 1
1: 0
2: 6
3: 64
4: 1003
915078846_915078855 6 Left 915078846 1:153337448-153337470 CCTTGCCAATGGAGTGCTGGTAA 0: 1
1: 0
2: 0
3: 8
4: 101
Right 915078855 1:153337477-153337499 TCAGGGGGAATGAGGGAGGCAGG 0: 1
1: 0
2: 6
3: 64
4: 1003

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915078855 Original CRISPR TCAGGGGGAATGAGGGAGGC AGG Intronic
900164852 1:1240577-1240599 CCAGGGTGAATGGGGGGGGCTGG - Intergenic
900577413 1:3390151-3390173 TGCGGGGGGATGCGGGAGGCAGG + Intronic
900681654 1:3920082-3920104 GGAGGGGGAAGGAGGGAGGGAGG - Intergenic
900701872 1:4053583-4053605 TCAGGGGTTCAGAGGGAGGCTGG - Intergenic
900847721 1:5116978-5117000 TCAGGAATAATGTGGGAGGCCGG - Intergenic
900881685 1:5386260-5386282 TCAGGGGAAAGCAGGGAAGCAGG - Intergenic
900984849 1:6067113-6067135 ACATGGGGAGTGAGGAAGGCCGG - Intronic
901203777 1:7482488-7482510 TCAGGAGGATGGAGGGAGGTGGG - Intronic
901216915 1:7560166-7560188 GAAGGGGGAATGAGGGCAGCAGG + Intronic
901253107 1:7796671-7796693 GGAGGGGGAAGAAGGGAGGCAGG + Intronic
901632279 1:10653698-10653720 CCAGGGGGATTGAGCCAGGCAGG + Exonic
901772798 1:11539120-11539142 GCAGGGGAAATGGGGCAGGCTGG + Intergenic
901867884 1:12119267-12119289 ACAGAGGGAATCAGGGAGTCAGG - Intronic
902514539 1:16983078-16983100 TCTGCGGGGGTGAGGGAGGCAGG - Intergenic
902730670 1:18366703-18366725 TCTGTGGGTATGTGGGAGGCAGG + Intronic
902784251 1:18722723-18722745 GCAGGGAGCAGGAGGGAGGCTGG + Intronic
902918258 1:19651634-19651656 ACAGAGGGAGGGAGGGAGGCTGG - Intronic
903140223 1:21334877-21334899 GTAGGGGGCAGGAGGGAGGCAGG - Intronic
903274263 1:22210759-22210781 GCAGGGAGACTGGGGGAGGCAGG + Intergenic
903304650 1:22404233-22404255 TGAAGGGGATGGAGGGAGGCAGG + Intergenic
903350782 1:22715399-22715421 GCTGGGGGAGGGAGGGAGGCAGG - Intronic
903687408 1:25141959-25141981 TCAGGGGTAAAGAGAGAGGTTGG - Intergenic
904223170 1:28990388-28990410 AGAGGGGGAAGGAGGGAGGGAGG - Intronic
904263499 1:29304689-29304711 TCAGTGGGGATGATGTAGGCAGG - Intronic
904328982 1:29745601-29745623 TCCAGGGGAAGGAGGGTGGCCGG + Intergenic
904842092 1:33379350-33379372 ACAGGGGGGATGGGGGGGGCAGG - Intronic
904902560 1:33869016-33869038 TTAGAGGGACAGAGGGAGGCCGG + Intronic
904935693 1:34128131-34128153 CCAGAGGGAATGTGGGAGGAAGG - Intronic
904941861 1:34169335-34169357 ACAGGGAGAATGAGAGGGGCAGG - Intronic
904996246 1:34633814-34633836 TCAGGAATAATGTGGGAGGCCGG + Intergenic
905240863 1:36580681-36580703 TGAGGAGGGAGGAGGGAGGCTGG + Intergenic
905397123 1:37674018-37674040 TCTCTGGGAAGGAGGGAGGCGGG + Intergenic
905953799 1:41975229-41975251 TGTGGGGGAATGAGGGAAGCAGG - Intronic
906081159 1:43089358-43089380 TCAGGAATAATGTGGGAGGCTGG - Intergenic
906291872 1:44624666-44624688 ACAGGGAGAAGGAGGGAGGGAGG + Intronic
906646730 1:47480489-47480511 TGAGGAGGAAGGAGGGATGCAGG - Intergenic
906702352 1:47869047-47869069 TTTGGGGGAAGGAGGGAGGGAGG - Intronic
906744276 1:48210839-48210861 TCAGGAATAATGTGGGAGGCCGG + Intergenic
906795251 1:48691782-48691804 GCAGGGGAGAGGAGGGAGGCTGG - Intronic
907084871 1:51662189-51662211 TAAAAGGGAATGAGAGAGGCTGG + Intronic
907270377 1:53287732-53287754 GCAGGAGGAATGAGGCAGGAGGG + Intronic
907552085 1:55313139-55313161 TGAGGGGGTATGAGGAGGGCAGG - Intergenic
908461474 1:64351821-64351843 TCAGGAATAATGTGGGAGGCTGG + Intergenic
908495278 1:64688649-64688671 TCAGGGGGCAATGGGGAGGCTGG - Intronic
909593266 1:77376265-77376287 TCAGGGAGAATGATGGAGAGAGG - Intronic
909910202 1:81249296-81249318 TCAGGAATAATGTGGGAGGCCGG - Intergenic
909959585 1:81823402-81823424 GTAGGGGGAAGGAGGGAGACAGG - Intronic
910097362 1:83538838-83538860 CCAGGGGTAAGGAGGGAGGAAGG + Intergenic
911147732 1:94568720-94568742 TCAGGAATAATGTGGGAGGCTGG + Intergenic
911178084 1:94837176-94837198 GCAGGGGAAATGAGAGATGCTGG + Intronic
911510358 1:98802906-98802928 TCAGGAATAATGTGGGAGGCCGG + Intergenic
911570623 1:99513477-99513499 TCAGGAATAATGTGGGAGGCCGG - Intergenic
911764295 1:101655708-101655730 TAAGGGAGAATGAGGGAGTGAGG + Intergenic
912383603 1:109260569-109260591 CCAGTGGGAAGGAGGGAGGAGGG + Intronic
912432282 1:109635007-109635029 TGAGGGGGAAGGAGGGTGGGTGG + Intergenic
912466604 1:109878974-109878996 GGATGGGGAATGTGGGAGGCAGG + Intergenic
912541085 1:110416122-110416144 CCAAGGGGAATGTGGGAGTCCGG - Intergenic
912651589 1:111444199-111444221 TCAAGGGGCAGGAGGGAGGGAGG + Intronic
913245428 1:116866333-116866355 TCAGGAATAATGTGGGAGGCTGG - Intergenic
913497512 1:119441968-119441990 ACAGGGGAAATGAGAGAGCCAGG - Intergenic
914357395 1:146898715-146898737 TCACGGGGAGAGAGGGAGGAAGG - Intergenic
915078855 1:153337477-153337499 TCAGGGGGAATGAGGGAGGCAGG + Intronic
915103272 1:153515824-153515846 TCCAGAAGAATGAGGGAGGCTGG - Intergenic
915163156 1:153933577-153933599 GGTGGGGGAATGCGGGAGGCAGG + Exonic
915524250 1:156466503-156466525 CAAGGAGGAATGAGGGAGGTGGG + Exonic
915722113 1:157993298-157993320 TCAGGCGGAGGGAGGGAGGCAGG + Intronic
916100609 1:161390318-161390340 TGAGAGTGAATGAGGGAGGAGGG + Intergenic
917724610 1:177816715-177816737 TCTGTGAGGATGAGGGAGGCTGG - Intergenic
919674325 1:200366416-200366438 ACAGGGGGAATGGGGCAGGTGGG + Intergenic
919902947 1:202057330-202057352 CCTGGGGGAATGAGGTAGGTGGG + Intergenic
920748043 1:208647334-208647356 GGAGGGGGAAGGAGGGAGGGAGG - Intergenic
920908292 1:210191339-210191361 TCAGGAATAATGTGGGAGGCCGG - Intergenic
921370479 1:214418042-214418064 CCAGGAGTAATGAGGTAGGCAGG - Intronic
921459536 1:215411803-215411825 TCAGGAATAATGTGGGAGGCCGG + Intergenic
921509497 1:216011846-216011868 TCAGGAATAATGTGGGAGGCTGG - Intronic
921579052 1:216873982-216874004 GGAGGGGGAAGGAGGGAGGGAGG + Intronic
921785410 1:219223261-219223283 TGAGGAGAAATTAGGGAGGCAGG - Intergenic
922049298 1:221974961-221974983 TCAGGAATAATGTGGGAGGCTGG + Intergenic
922153824 1:223026262-223026284 TCAGGAATAATGTGGGAGGCCGG + Intergenic
922363300 1:224842322-224842344 TCAGGAATAATGTGGGAGGCCGG + Intergenic
922805454 1:228384816-228384838 TAAGGAGGAAGGAAGGAGGCTGG + Intergenic
922906632 1:229178284-229178306 TCAGGAATAATGTGGGAGGCCGG - Intergenic
923306881 1:232696714-232696736 TCAAGGGGAATGGGGCTGGCTGG - Intergenic
923854816 1:237834897-237834919 TCTGGGAGAAAGAGAGAGGCTGG + Intergenic
924180937 1:241438034-241438056 TCAGGAATAATGTGGGAGGCCGG - Intergenic
924537570 1:244950175-244950197 TCGGGGGAAAGAAGGGAGGCAGG + Intergenic
1063003617 10:1947328-1947350 GCAGGTGGAATGAAGGAAGCTGG + Intergenic
1063052598 10:2468888-2468910 CCAGGGGCAGTGAGGGAGCCAGG - Intergenic
1063117348 10:3080799-3080821 TCAGAGGGAGTCAGGGAGTCGGG + Intronic
1063509355 10:6631452-6631474 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1064886757 10:20121027-20121049 TCAGGAATAATGTGGGAGGCCGG + Intronic
1064949223 10:20828687-20828709 TGAGAGGGAGGGAGGGAGGCAGG + Intronic
1064999733 10:21327657-21327679 ACAGGAGGAAAGAGGGAGGGTGG - Intergenic
1065129874 10:22609876-22609898 GAAGTGGGAATGAGGAAGGCAGG - Intronic
1065245042 10:23748158-23748180 AGAGAGGGAGTGAGGGAGGCTGG - Intronic
1065301464 10:24325365-24325387 TTAGGGGGAATTATGGAAGCAGG + Intronic
1065442886 10:25770607-25770629 TCAGGAATAATGTGGGAGGCTGG + Intergenic
1065747522 10:28855840-28855862 TTAGAGGGAAGGCGGGAGGCAGG + Intronic
1065960766 10:30732435-30732457 CCAGTGGGAATGAGGAAGGTGGG - Intergenic
1066358517 10:34708062-34708084 TCAGTAGGAATGAAGAAGGCAGG - Intronic
1067118359 10:43453007-43453029 AAAGGGGGAATGAGGGAGTATGG + Intronic
1067696929 10:48542530-48542552 TCAGGAGGCAGGAGGGAGCCAGG - Intronic
1067833191 10:49621942-49621964 GCAGTGGGGATGAGGGAGGGAGG + Intronic
1067945519 10:50685993-50686015 TCAGGAGGAAAGAGTGGGGCCGG - Intergenic
1068179381 10:53500679-53500701 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1068231205 10:54170609-54170631 TCAGGAATAATGTGGGAGGCCGG - Intronic
1068474009 10:57502127-57502149 ACTGGGGAAAAGAGGGAGGCTGG - Intergenic
1068592099 10:58862872-58862894 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1069311544 10:67044087-67044109 TTGGGGGGAAAGAGGGAGGAGGG - Intronic
1069783032 10:70968913-70968935 TCAGTGGGGACAAGGGAGGCAGG - Intergenic
1069825863 10:71254631-71254653 CCAGGAGGAAGGTGGGAGGCGGG - Intronic
1070154354 10:73824469-73824491 TCACGGGGAATGTGTGAGGCAGG + Intronic
1070531489 10:77341462-77341484 TGAATGGGAATGAGGGAGGAGGG - Intronic
1070562639 10:77579264-77579286 GCAGGAGGGATCAGGGAGGCAGG + Intronic
1070585953 10:77766275-77766297 CCAGGTGGAAAGAGGAAGGCTGG + Intergenic
1070867032 10:79712866-79712888 TCAGGAGGAAAGAGTGGGGCCGG - Intronic
1070880822 10:79850987-79851009 TCAGGAGGAAAGAGTGGGGCCGG - Intergenic
1071633944 10:87235089-87235111 TCAGGAGGAAAGAGTGGGGCCGG - Intronic
1071647392 10:87367306-87367328 TCAGGAGGAAAGAGTGGGGCCGG - Intronic
1071897505 10:90082895-90082917 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1072051494 10:91708294-91708316 TCAGGGGGCAAGTGGGAGGTAGG + Intergenic
1072255067 10:93613308-93613330 ACCGGGGGAATGTGGGTGGCAGG + Intronic
1072789878 10:98310213-98310235 TTAGGGGGAGTGCTGGAGGCTGG - Intergenic
1072800992 10:98392352-98392374 TCGTGGGGATTGAGGGAGCCAGG - Intronic
1072981048 10:100097883-100097905 TGAGGGGGGATGAAGGAGGAGGG - Intergenic
1073006659 10:100330100-100330122 TCATGGGGAATGAGGTGGGGGGG + Exonic
1073014300 10:100385755-100385777 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1073213938 10:101826368-101826390 GGAGAGGGAAGGAGGGAGGCAGG - Intronic
1073514364 10:104063821-104063843 GCAGGGGCAAGGAGGAAGGCTGG + Intronic
1073597691 10:104817336-104817358 AGAGGGGGGAGGAGGGAGGCAGG - Intronic
1074019305 10:109566422-109566444 TCAGGAATAATGTGGGAGGCTGG - Intergenic
1074107826 10:110401744-110401766 CCATGGGGAGGGAGGGAGGCAGG - Intergenic
1074338606 10:112603942-112603964 TCAGGGGGAAACAGTGAGCCAGG - Intronic
1074421286 10:113310811-113310833 TCATGGGAAGAGAGGGAGGCAGG - Intergenic
1074740491 10:116481258-116481280 TGAGGGATAATGAGGGAGGTTGG - Intergenic
1074995444 10:118754240-118754262 TGAGGGGGAAGGAGGCAGGGAGG + Intronic
1075153512 10:119955779-119955801 TGTGGGGGAGTGAGGGAGGCAGG + Intergenic
1075403760 10:122180258-122180280 GGAGGGGGAAGGAGGGTGGCAGG - Intronic
1075449994 10:122544638-122544660 TGAGGGTGATTGAGGGGGGCTGG + Intergenic
1075482270 10:122792092-122792114 TGAGAGGGCATGAGGGAGGATGG - Intergenic
1075495432 10:122915333-122915355 GCAGGGGCCATGAGGGAGGCAGG + Intergenic
1075656242 10:124163005-124163027 GAAGGGGGAAGGAGGGAGGAAGG + Intergenic
1076252402 10:128994790-128994812 TGAGGGAGAAAGAGGGAGGGAGG + Intergenic
1076511809 10:131019612-131019634 TCAGGGCCCAGGAGGGAGGCTGG + Intergenic
1076778081 10:132709253-132709275 TGAGGGGGATGGAGGGAGGGAGG + Intronic
1076817586 10:132922450-132922472 CCCGGGGAAGTGAGGGAGGCTGG - Intronic
1077163237 11:1123060-1123082 TCAGGAGGAAGGAGGGAAGAGGG - Intergenic
1077183118 11:1225131-1225153 TCAGGGCGAGTGGGGCAGGCTGG - Intronic
1077314704 11:1913545-1913567 TCAGGGAGAGTGGGTGAGGCTGG - Intergenic
1077337225 11:2010828-2010850 ACATGGGGAGGGAGGGAGGCAGG - Intergenic
1077573021 11:3355454-3355476 ACTGGGTTAATGAGGGAGGCGGG + Intronic
1077592123 11:3500400-3500422 TCATAGGGAATGACGGACGCTGG + Intergenic
1077612433 11:3651786-3651808 TCAGGAATAATGTGGGAGGCCGG - Intronic
1077727772 11:4692790-4692812 TCAGGGTGAATGTGTGAGTCTGG - Intronic
1077766146 11:5162141-5162163 TCAGGAATAATGTGGGAGGCCGG + Intronic
1078045901 11:7914023-7914045 TCAGGAATAATGTGGGAGGCTGG + Intergenic
1078453951 11:11460664-11460686 TCAGGAAGAAACAGGGAGGCAGG - Intronic
1078488565 11:11747694-11747716 ACAGAGGGAAGGAGGGAGGGAGG + Intergenic
1078579474 11:12527291-12527313 TCAGAGGAAAGGAGGGAGGGAGG + Intronic
1079110888 11:17604520-17604542 TGACGGCGGATGAGGGAGGCAGG - Intronic
1079128748 11:17735654-17735676 TGAGGGGGAAAGAGGGAGGGGGG - Exonic
1079230793 11:18647105-18647127 TCAGGAATAATGAGAGAGGCTGG - Intergenic
1079847409 11:25488872-25488894 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1080027672 11:27630938-27630960 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1080419090 11:32094185-32094207 TGAGGAGGAATGAGTGTGGCTGG + Intronic
1080429355 11:32184379-32184401 TCAGGAGCAATGAAGAAGGCAGG + Intergenic
1080932873 11:36831102-36831124 GGAGAGGGAAGGAGGGAGGCAGG - Intergenic
1081531076 11:43959728-43959750 TCAGGGAGATTCAGGCAGGCAGG + Intergenic
1082866136 11:57901753-57901775 ACAGGGGTCAGGAGGGAGGCTGG + Intergenic
1083225741 11:61283360-61283382 TCAGGGGCAAGGAAGGAGGTGGG - Intronic
1083332461 11:61905330-61905352 ACATGCAGAATGAGGGAGGCTGG + Intronic
1083641661 11:64148975-64148997 TCCCAGGGAATGACGGAGGCAGG - Intronic
1083880086 11:65544059-65544081 GCAGGAGGAATGAGGAAGGTGGG - Intronic
1084171598 11:67403818-67403840 TCAGGGGCACTGGGGCAGGCAGG + Intronic
1084176519 11:67425110-67425132 TCAGGCCGAATGAGGCAGGTTGG - Exonic
1084232541 11:67763515-67763537 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1084244210 11:67844774-67844796 TCAGGAATAATGTGGGAGGCTGG + Intergenic
1084568459 11:69944820-69944842 CCTGGAGGAAGGAGGGAGGCGGG - Intergenic
1084824861 11:71722352-71722374 TCACAGGGAATGACGGACGCTGG - Intergenic
1084828480 11:71749789-71749811 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1084960180 11:72712407-72712429 TCAGTGGGAAGGAGGGTGGCCGG + Intronic
1085298660 11:75445556-75445578 TCGGAGGGAAGGAGGGAGGGAGG + Intronic
1085402544 11:76243403-76243425 TCAGGATGCATGAGGGAGGGAGG + Intergenic
1085490473 11:76911851-76911873 GCAAGGGGAATGAGGGAGTGGGG + Intronic
1085500520 11:77018380-77018402 TCTTAGGGAATTAGGGAGGCTGG - Intronic
1085627566 11:78084995-78085017 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1085705196 11:78780834-78780856 TCAGTGGAAATGATGGAGGCAGG + Intronic
1085934051 11:81122690-81122712 TGAGGGATAGTGAGGGAGGCTGG - Intergenic
1085969785 11:81574146-81574168 TCAGAGGGGTTGGGGGAGGCAGG - Intergenic
1085989540 11:81825271-81825293 TGAGGGGGAAGGAGGGAGGAAGG + Intergenic
1086141258 11:83503120-83503142 TCAAGGGGCATGAAGAAGGCAGG + Intronic
1086143554 11:83525638-83525660 CCAGGGGGCATCAGGAAGGCAGG - Intronic
1086550484 11:88047246-88047268 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1086807711 11:91266493-91266515 TAAGGGGGAGGGAGGGAGGGAGG + Intergenic
1086925415 11:92634934-92634956 TCAGAGGGAAAGAGGGATGGTGG - Intronic
1087099328 11:94349566-94349588 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1087128055 11:94645456-94645478 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1087274210 11:96144397-96144419 TGAGGGGAGAAGAGGGAGGCAGG + Intronic
1087314915 11:96591779-96591801 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1087581784 11:100064850-100064872 GAAGGGGGAAAGATGGAGGCAGG + Intronic
1087584929 11:100106475-100106497 TCTGAGGGAATGAGGGAGGAGGG + Intronic
1088173027 11:107018539-107018561 AAAGGGAGAAGGAGGGAGGCAGG - Intergenic
1088504400 11:110514240-110514262 GCAGTGGGACTGATGGAGGCTGG + Intergenic
1089470821 11:118718870-118718892 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1089529472 11:119116928-119116950 TCTGTGGGAAGGAGGGAGCCGGG + Exonic
1089763242 11:120744171-120744193 CCAGGGGGAATGGGGCTGGCAGG + Intronic
1089787693 11:120919959-120919981 GTAGGGGGAGTGAGGAAGGCTGG + Intronic
1090107327 11:123867230-123867252 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1090526536 11:127544386-127544408 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1090546224 11:127770729-127770751 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1202820209 11_KI270721v1_random:66010-66032 ACATGGGGAGGGAGGGAGGCAGG - Intergenic
1091743612 12:2977001-2977023 TCAGGAGGGATGATGGAGGGCGG - Intronic
1091817791 12:3453099-3453121 GCACGGGGAATCAGGTAGGCTGG + Intronic
1092042366 12:5395898-5395920 TCTGGGGGAGGGAGGGAGGGCGG - Intergenic
1092051680 12:5475275-5475297 TCAGAGAGCATGAGGGAGGAGGG + Intronic
1092350084 12:7749172-7749194 GCAGGGTGACTGTGGGAGGCAGG + Exonic
1092414768 12:8281910-8281932 TCAGGAATAATGTGGGAGGCTGG + Intergenic
1092418241 12:8308532-8308554 TCACAGGGAATGACGGACGCTGG + Intergenic
1092474724 12:8808772-8808794 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1092626514 12:10334788-10334810 TCAGGAATAATGTGGGAGGCTGG + Intergenic
1092723494 12:11464042-11464064 TCAGGAATAATGTGGGAGGCTGG + Intronic
1092924548 12:13261449-13261471 TCAGGAATAATGTGGGAGGCTGG + Intergenic
1093977440 12:25438592-25438614 TGGGTGGGAATGAGGGAGGGTGG - Intronic
1094315776 12:29136635-29136657 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1094353309 12:29550515-29550537 TCAGCGGGAATGAGAGAGTGGGG + Intronic
1094514502 12:31119278-31119300 GCAGGGGGAAGGAGAGGGGCTGG - Intergenic
1094817678 12:34203931-34203953 AAAGGGGGAAAGAGGGAGGGAGG - Intergenic
1095405431 12:41862125-41862147 CCAGGTGGAATGAGCGAAGCAGG - Intergenic
1095778467 12:46034204-46034226 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1095969990 12:47894898-47894920 ACATGGGGCATGAGGGCGGCAGG + Intronic
1096358987 12:50967253-50967275 TCTGTGGGAATGAGGCAGGCAGG - Intronic
1096792927 12:54056237-54056259 TCAGGGGGAAGGAAGGGGACTGG - Intergenic
1096976007 12:55699610-55699632 TCAGGTGGAATGAGAGGGCCAGG - Intronic
1097416817 12:59325084-59325106 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1098051970 12:66463724-66463746 TCAAGGGGAAAGATGGGGGCAGG + Intronic
1098152779 12:67565002-67565024 TGAGGGGGATTGAAGGAGGTAGG - Intergenic
1098356011 12:69613245-69613267 TCAGGGTGGGTGAGGGAGCCTGG + Intergenic
1098385063 12:69909777-69909799 TCCAGGGGAAGGAGGGTGGCTGG + Intronic
1098920193 12:76295681-76295703 TCAGGAATAATGTGGGAGGCTGG - Intergenic
1099188955 12:79543716-79543738 TCAGGAATAATGTGGGAGGCTGG - Intergenic
1099291858 12:80784942-80784964 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1099762861 12:86942866-86942888 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1099835829 12:87909052-87909074 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1100940586 12:99719352-99719374 TCAGGAATAATGTGGGAGGCTGG - Intronic
1101292983 12:103390078-103390100 TCAGCAGCAATGATGGAGGCTGG - Intronic
1101374025 12:104155253-104155275 GCAGGGGGAAAGGGGGAGGTGGG + Intergenic
1101781747 12:107844149-107844171 TCAGGGGCACCGAGGCAGGCGGG - Intergenic
1101965718 12:109280618-109280640 CCAGGGGGAAAGAGGCAGGGAGG + Intronic
1102217195 12:111169883-111169905 CCAGAGGGCATGAGGGTGGCAGG + Intronic
1102464464 12:113120381-113120403 TGAGGGAGAACCAGGGAGGCAGG - Intronic
1103035362 12:117652153-117652175 TCAGGGGCAGTGTGGGAGGGGGG + Intronic
1103207859 12:119144207-119144229 TGAGGGGGCACGAGGGAGGGAGG - Intronic
1103482190 12:121257893-121257915 TCAGGTGGCATGAGGGAGGGTGG + Intronic
1103775478 12:123364218-123364240 TCTGGGCGAGGGAGGGAGGCAGG - Intronic
1103834553 12:123808389-123808411 GCAGGGGGAAGCAGGGAGACTGG + Intronic
1103989010 12:124785959-124785981 TCAGGGGGATTGAGGGGGGCTGG - Intronic
1104020058 12:124986316-124986338 TCAGGGGGCTTGTGGGAGGCGGG - Intronic
1104098473 12:125583546-125583568 TCTGTGGGACTGAGGGCGGCGGG + Intronic
1104262171 12:127194343-127194365 ACAGGGGGAAGGAGGGAAGGAGG - Intergenic
1104273667 12:127305323-127305345 TCAGGGCTAAAGAGGGAGCCAGG + Intergenic
1104676014 12:130713044-130713066 AGAGGAGGAATGAGGGAGGGAGG + Intronic
1104734164 12:131126626-131126648 TCTGGTGGGAGGAGGGAGGCAGG - Intronic
1105276525 13:18933534-18933556 GCAGGGAGAAAGATGGAGGCTGG - Intergenic
1105325895 13:19370487-19370509 TGTGAGGGAGTGAGGGAGGCAGG + Intergenic
1105867612 13:24474607-24474629 TGTGAGGGAGTGAGGGAGGCAGG - Intronic
1106057289 13:26250440-26250462 TTAGGGGGCATGAGGGAGATGGG - Intergenic
1106308866 13:28535389-28535411 TGAGGGGGACTGAGGGCAGCTGG + Intergenic
1107220026 13:37970833-37970855 TCAGGAATAATGTGGGAGGCTGG + Intergenic
1108913182 13:55580102-55580124 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1108919313 13:55656821-55656843 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1109353188 13:61208863-61208885 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1109400424 13:61820361-61820383 GAAGGGGGAAGGAGGGAGGGAGG + Intergenic
1109420553 13:62106008-62106030 TCAGGAAGAATGAGGGATGTGGG - Intergenic
1109499011 13:63213724-63213746 TGAGGGATAGTGAGGGAGGCTGG - Intergenic
1109574865 13:64242074-64242096 TCATGGAAAATGAGGAAGGCAGG + Intergenic
1109619252 13:64880124-64880146 GCAGGGGGTTTGGGGGAGGCGGG - Intergenic
1109716501 13:66228242-66228264 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1110427230 13:75382131-75382153 CCAAGGGGAAGGAGAGAGGCTGG - Intronic
1110657348 13:78015911-78015933 TCAGGGGAAAAGTGGGAGGGAGG - Intergenic
1110765724 13:79277982-79278004 TCAGGAATAATGTGGGAGGCTGG - Intergenic
1111302283 13:86362260-86362282 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1111458601 13:88514689-88514711 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1111482062 13:88842530-88842552 TCAGGGGGAGGGAGGGAGAGAGG + Intergenic
1111630671 13:90843272-90843294 TCAGGAATAATGTGGGAGGCTGG - Intergenic
1111631465 13:90850447-90850469 TCAGGAATAATGTGGGAGGCTGG + Intergenic
1111757763 13:92420621-92420643 TAAGGGGGTGAGAGGGAGGCAGG - Intronic
1111945554 13:94661338-94661360 TCAGGGAGGATGTGAGAGGCCGG + Intergenic
1112047499 13:95613001-95613023 TTAGAGGGAAAGAGGGAGGGAGG + Intronic
1112617358 13:101019039-101019061 TCAGAGGGAATGGTGGAGGTAGG + Intergenic
1112924740 13:104660431-104660453 TCTGGGAGATGGAGGGAGGCTGG - Intergenic
1113991167 14:16029400-16029422 ACAGAGGGAAAGAGGGAGGGAGG - Intergenic
1114225299 14:20732499-20732521 TCAGTGGGAATGAGGCTGACTGG - Intronic
1114778278 14:25511457-25511479 CCTGGGAGTATGAGGGAGGCAGG - Intergenic
1115027809 14:28764498-28764520 TAAGGGAGAAGGAGGGAGGAGGG + Intergenic
1115074881 14:29376324-29376346 TCATGGGTACTGAGGGAGGAAGG - Intergenic
1115905048 14:38194646-38194668 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1116780568 14:49232981-49233003 GAAGGGGGAAAGAGGGAGGGGGG - Intergenic
1116941140 14:50792096-50792118 AGATGGGGGATGAGGGAGGCTGG + Intronic
1117227891 14:53681951-53681973 CAAGGGGAAATGGGGGAGGCAGG - Intergenic
1117453577 14:55875924-55875946 TCAGGGGAAGTGAGGGTGGCTGG - Intergenic
1117899080 14:60514933-60514955 TCAGGGCTAATGACGGCGGCCGG + Intronic
1118328474 14:64797528-64797550 ACAGGGGGATTGAAGGAGGGTGG + Intronic
1119022657 14:71128161-71128183 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1119176573 14:72572868-72572890 TAAGAGGGAAGGAGGGAGGGAGG + Intergenic
1119883694 14:78122590-78122612 TCAGAGGGGATGAGGGTGGAGGG - Intergenic
1120251119 14:82062735-82062757 TCAGGAATAATGTGGGAGGCTGG + Intergenic
1120437813 14:84502075-84502097 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1120622938 14:86788338-86788360 TGAGGGGGAAGAAAGGAGGCTGG + Intergenic
1121454396 14:94029014-94029036 GCAAGGAGATTGAGGGAGGCAGG + Intronic
1121624598 14:95374931-95374953 GAAGGGGGAAGGAGGGAGGGAGG - Intergenic
1121624629 14:95375034-95375056 GAAGGGGGAAGGAGGGAGGGAGG - Intergenic
1121641820 14:95489834-95489856 TCAGGGGAACTGAGAAAGGCAGG + Intergenic
1121703924 14:95977015-95977037 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1121956399 14:98217511-98217533 TCAGGGGGAAAGGGAGAGGATGG - Intergenic
1122128932 14:99593955-99593977 TCAGGGGAAATGGGGAAGGTGGG + Intronic
1122316470 14:100828444-100828466 TGAGGGGGGAAGAGGGAGGAGGG - Intergenic
1122405564 14:101498779-101498801 TCATAGGGAAAGAGAGAGGCGGG - Intergenic
1122755257 14:103973566-103973588 GGAGGGTGGATGAGGGAGGCTGG + Intronic
1122804479 14:104249713-104249735 ACATGGGGGATGAGGGAGACAGG - Intergenic
1122804751 14:104250651-104250673 AAAGGGGGAAGGAGGGAGGGAGG + Intergenic
1122893212 14:104742525-104742547 TGAGGGTGAAAGAGGAAGGCTGG - Intronic
1122959915 14:105089686-105089708 TCAGGGGGGATCTGGGAAGCGGG - Intergenic
1124177688 15:27441668-27441690 TCAGGGGGATTGGGGGAGGCAGG + Intronic
1124201460 15:27681924-27681946 TCAGTGGGCATGAAGGAGGGTGG - Intergenic
1124217990 15:27825447-27825469 TGAGGAGCACTGAGGGAGGCAGG + Intronic
1124348948 15:28941644-28941666 TCAGGGGCACACAGGGAGGCTGG + Intronic
1124967869 15:34450885-34450907 TCAGAGGAAATGTGGGGGGCAGG + Intergenic
1125062486 15:35440631-35440653 GAAGGGGGAATGATAGAGGCAGG + Intronic
1125213428 15:37241055-37241077 TGAGGGATAGTGAGGGAGGCTGG + Intergenic
1125747193 15:42005069-42005091 TGTGGGGGAAGGACGGAGGCAGG - Intronic
1126858572 15:52862165-52862187 TCAGAGGGAGGGAGGGAGGGAGG - Intergenic
1127453637 15:59139297-59139319 TGAGGAGGAATGAGGGGGGTGGG - Intronic
1127686482 15:61350662-61350684 TCAGGGGGAAAGGGGGAGCCAGG - Intergenic
1128101053 15:65000292-65000314 TCAGGAAGAATAAGGGATGCTGG - Intergenic
1128632545 15:69280947-69280969 GCTGGGAGAATGTGGGAGGCTGG - Intergenic
1129069143 15:72936740-72936762 TCTGGGGGTATGAGGGATGAAGG - Intergenic
1129269915 15:74414154-74414176 CCAGGCAGAATGAGGGAGTCAGG - Intronic
1129716950 15:77857741-77857763 TCGGGGGGCAGGAGGGAGGCAGG + Intergenic
1129888034 15:79052410-79052432 GCAGAGGGAAGCAGGGAGGCAGG - Intronic
1130371396 15:83287705-83287727 TCAGGGGGAAGTGGGGAGGTGGG + Intergenic
1130399598 15:83537115-83537137 CAAGGGGGACTCAGGGAGGCTGG + Intronic
1130945675 15:88549147-88549169 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1130995707 15:88902801-88902823 TCTGGGGAATTGAGGGAGGCAGG + Intronic
1131117157 15:89802635-89802657 TCAGCGGAAATGATGGGGGCAGG + Intronic
1131448012 15:92515566-92515588 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1131882275 15:96873678-96873700 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1132322776 15:100938560-100938582 TGTGGGGGAAGGAGGGAGGATGG - Intronic
1132340662 15:101076394-101076416 TCAGGAATAATGTGGGAGGCTGG - Intronic
1132578840 16:676027-676049 TCGGGGGGAGGGAGGGAGGGAGG + Intronic
1132855485 16:2042881-2042903 GCTGGGGGAATGGGGGAGGAGGG - Intronic
1132880874 16:2161196-2161218 GCAGGGGGACGGAGGGAGGGAGG - Intronic
1133026347 16:2990505-2990527 TCAGGAGGAGGGAGGCAGGCAGG - Intergenic
1133748149 16:8702901-8702923 ACAGGGGAAATGATGGAGGCAGG + Intronic
1135864391 16:26087488-26087510 GCTGAGGGAGTGAGGGAGGCAGG - Intronic
1136073223 16:27801446-27801468 GCAGGAGGAACGGGGGAGGCGGG - Intronic
1136315742 16:29453925-29453947 CCAGGGGGAGTGCGGGAGTCAGG + Intronic
1136343576 16:29661434-29661456 GCAGGGGGGATGAGGGACACAGG - Intergenic
1136382924 16:29904985-29905007 GCAGGGGGGATGAGGGACTCAGG + Intronic
1136430319 16:30193267-30193289 CCAGGGGGAGTGCGGGAGTCAGG + Intronic
1137055070 16:35741505-35741527 TCAGGAATAATGTGGGAGGCTGG + Intergenic
1137363708 16:47842624-47842646 TCAGGAATAATGTGGGAGGCTGG - Intergenic
1138167564 16:54817489-54817511 TCCCGGGGAATGCTGGAGGCTGG + Intergenic
1138494636 16:57400417-57400439 TCATGGTGAATGAGGGGGTCTGG + Intergenic
1138758856 16:59519497-59519519 TCAGGAATAATGTGGGAGGCTGG + Intergenic
1138805187 16:60082681-60082703 TCAGGAATAATGTGGGAGGCTGG - Intergenic
1139225677 16:65231686-65231708 TCAGGAATAATGTGGGAGGCTGG + Intergenic
1139495512 16:67314229-67314251 AGAGGGGGAAGGAGGGAGGGAGG - Intronic
1139594509 16:67950058-67950080 TGAGGTGGAATCAGGGAGACTGG - Intronic
1139942816 16:70618339-70618361 TCAGGAATAATGTGGGAGGCCGG + Intronic
1139976793 16:70818579-70818601 TCACGGGGAGAGAGGGAGGAAGG + Intronic
1140257228 16:73347714-73347736 TAAGGGTGAGTGATGGAGGCAGG + Intergenic
1140698186 16:77555950-77555972 TCAGGGGGAATGCGTGAGGGGGG - Intergenic
1141864962 16:86743887-86743909 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1141924078 16:87155693-87155715 TCAGGGGGCAAGAGGAAGGAGGG + Intronic
1141992450 16:87618307-87618329 GCAGGAGGAGGGAGGGAGGCCGG + Intronic
1142104912 16:88297484-88297506 TCAGCGGCAGTGAGGCAGGCCGG - Intergenic
1142121859 16:88390382-88390404 TCAGAGGGGTTGGGGGAGGCAGG + Intergenic
1142248106 16:88978968-88978990 TCAGGGGGTCTGACGGAGGTGGG + Intergenic
1143089207 17:4438891-4438913 TCTGGGTGTATGAGTGAGGCTGG + Intronic
1143278345 17:5731284-5731306 GCAGGGGGAAGGAGGGAGGAGGG - Intergenic
1143325044 17:6093146-6093168 ACCTGGGGAATGAGGGAGACTGG + Intronic
1143413104 17:6724185-6724207 TCAGGTAGAGTGAGTGAGGCAGG - Intergenic
1143414072 17:6733283-6733305 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1143510619 17:7393577-7393599 TGAGTGGGAAGGAGGGAGGGAGG - Intronic
1143826209 17:9609810-9609832 TGAAGGGAAATGAGGGAGGGAGG + Intronic
1143830881 17:9649523-9649545 GCAGAAGGAAGGAGGGAGGCAGG - Intronic
1143832879 17:9666362-9666384 CCAGGGGGAACGGGTGAGGCTGG + Intronic
1143915387 17:10288522-10288544 TCAGGGGGAAAGGCGGAGGGTGG - Intergenic
1144759839 17:17701054-17701076 TCAGGGAGGATGAGCGAGGAGGG - Intronic
1144788383 17:17844265-17844287 GCAGCGGGAAGGAGGGGGGCAGG + Intronic
1144833304 17:18143642-18143664 GCAGGGCCAAGGAGGGAGGCTGG + Intronic
1146001591 17:29133639-29133661 GCAGGGAGAATGACGGGGGCTGG - Intronic
1147134065 17:38425276-38425298 TCAGGGCGAACCAGGGAGGCAGG - Intergenic
1147140890 17:38460128-38460150 TGTGGGGGAATGAGGAAGGAGGG - Intronic
1147318471 17:39632267-39632289 CCAGGAGGCATGAGGGAGGTGGG + Intronic
1147363359 17:39944851-39944873 TTAGGGGGAATAAAGGAGGGAGG - Intergenic
1147571389 17:41573245-41573267 TCAGAGGGAATGGGAGAGGCAGG - Intergenic
1147663525 17:42130313-42130335 TGAGTGGGCATGAGGGAGTCGGG - Intronic
1147727378 17:42574704-42574726 GGAGGGGGAAGGAGGGAGGGAGG - Intronic
1148855096 17:50574645-50574667 TCAGGGGGTGTGTGGGAGGGTGG - Intronic
1150505746 17:65696923-65696945 TCAGTGGGGAGGAGGGATGCGGG + Intronic
1150655264 17:67034998-67035020 TCTAAGGGAAAGAGGGAGGCAGG + Intergenic
1151467428 17:74296358-74296380 GAAGGGGGAAGGAGGGAGGGAGG + Intronic
1151513513 17:74577490-74577512 TCAGGGAGAAAGAGGGGGGTGGG - Intergenic
1151905989 17:77049782-77049804 TCAAGAGGAATGGGGGAGCCTGG - Intergenic
1152330912 17:79672570-79672592 TCAGGTGGAGTGTGGGAGGTGGG + Intergenic
1152425664 17:80217246-80217268 GCACTGGGAGTGAGGGAGGCTGG + Intronic
1153371329 18:4319852-4319874 TATGAAGGAATGAGGGAGGCTGG - Intronic
1155110271 18:22707868-22707890 TCATGGAGGATGAGGGAGGTGGG - Intergenic
1156237638 18:35219834-35219856 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1156251658 18:35357975-35357997 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1156302527 18:35847985-35848007 TCAGGAATAATGTGGGAGGCTGG - Intergenic
1157126501 18:44961118-44961140 TCAGAGGGAATGAAGGAAGGAGG + Intronic
1157323333 18:46650697-46650719 TGAGGGAGAATGGGGGAGGAAGG + Intronic
1157424319 18:47571876-47571898 TCAGGGGGACTCAGGGACTCAGG - Intergenic
1157501816 18:48196082-48196104 TCAGGGGGAATGGAGAAAGCTGG + Intronic
1158076141 18:53531838-53531860 TCAGGGGGAAGCAGAGGGGCAGG + Exonic
1158197418 18:54904650-54904672 TGAGGGAGCATGAGGGAAGCCGG + Intronic
1158336610 18:56419447-56419469 TCAGGAATAATGTGGGAGGCTGG - Intergenic
1158521658 18:58176249-58176271 ACAGAGTGAATGAGGGAGGCAGG - Intronic
1158849686 18:61482914-61482936 TGAGGAGGGATGAGGGAGGCAGG - Intronic
1159164724 18:64685481-64685503 TCAGGAATAATGTGGGAGGCTGG - Intergenic
1159214645 18:65375130-65375152 TCAAAGGGAAGGAGGGAGGAAGG - Intergenic
1160187836 18:76689060-76689082 GGAGGGTGAATGAGAGAGGCTGG + Intergenic
1160484207 18:79273352-79273374 TCATGGGATATTAGGGAGGCAGG - Intronic
1160710558 19:549206-549228 GCTGGGGGAATGAGGCTGGCGGG + Intronic
1160872085 19:1282231-1282253 TGAAGGGGAAGGAGGGAGGAGGG + Intergenic
1160906341 19:1453357-1453379 GCAGAGGGAGTGGGGGAGGCTGG + Intronic
1160919227 19:1512082-1512104 GCAGGGGGAAAGAGGGGGGAAGG + Intronic
1161162672 19:2769717-2769739 TGAGGTGGAATGAGGTAGGTAGG - Intronic
1161169818 19:2807181-2807203 TCGGGGGGAGTGAGGGAGCCAGG - Intronic
1161458304 19:4381116-4381138 GCAGGGGGATAGAGAGAGGCAGG - Intronic
1161488302 19:4547797-4547819 CAAGGGGGAGTGAGGGAGGAGGG - Intronic
1162239236 19:9335456-9335478 TCTGGGGGTATGGGGGAGACAGG - Intronic
1162300980 19:9844821-9844843 CCATGGGGAAGGAGGGAGACAGG - Intronic
1163154630 19:15433026-15433048 TAAGGGGGTCTGAGTGAGGCCGG - Intronic
1163602144 19:18255585-18255607 GCAGGGGGAAAGAGGACGGCAGG - Intergenic
1163608994 19:18291643-18291665 GCAGGGGGGAGGCGGGAGGCGGG - Intergenic
1163741128 19:19013569-19013591 ACAAGGGGAAGGAGGGAGGTAGG - Intronic
1163762691 19:19146025-19146047 GCAGGGGGAAAGAGAGAGGGAGG + Intronic
1163831826 19:19550668-19550690 TCTGGGGCAAGGAGGGAGGCTGG - Intergenic
1164022588 19:21321635-21321657 GGAGGGGGAAGGAGGGAGGGAGG + Intronic
1164153215 19:22572092-22572114 TCAGGAGTAATGTGGGAGGCCGG - Intergenic
1164220300 19:23187319-23187341 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1164509888 19:28888610-28888632 TCAGCGGGTGTGAGGGAGACGGG - Intergenic
1164636341 19:29794181-29794203 TCAGGGGGAAAGGGTGAGGGGGG + Intergenic
1165510086 19:36261349-36261371 TCAGGAATAATGTGGGAGGCTGG + Intergenic
1165995424 19:39840396-39840418 TGAGGGTGAGTGAGGAAGGCAGG - Exonic
1166034628 19:40158800-40158822 TCAGGGGGAAGGAGGGACATGGG + Intergenic
1166130646 19:40743838-40743860 TCAGGAGGATTAATGGAGGCCGG + Intronic
1166300289 19:41908877-41908899 GGAGGGGAAATGAGGGAGACAGG - Intronic
1166679706 19:44759074-44759096 GCTGGGGGTATGAGGGAGGAGGG - Intronic
1166881111 19:45930686-45930708 GAAGGGGGAAGGAGGGAGGAAGG - Intergenic
1166905483 19:46105545-46105567 TCAGGAATAATGTGGGAGGCTGG + Intergenic
1166926855 19:46274981-46275003 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1167251746 19:48402368-48402390 TCAGGGTGAATGAGAGAGAGAGG + Intronic
1168347252 19:55656041-55656063 TTACGGGGAAGGTGGGAGGCAGG + Intronic
1168430735 19:56277747-56277769 TCAGAAGGAAGGAGGGTGGCAGG + Intronic
1168490283 19:56803237-56803259 TCAGATGGAAAGAGGGTGGCAGG - Intronic
1168695737 19:58403506-58403528 TCAGTGGGAGGGAGGGAGGGAGG + Intronic
925249852 2:2422747-2422769 TCCGGGGGAAGGAGGAAGGGTGG + Intergenic
925374891 2:3377427-3377449 TGAAGGGGAAGGAGGCAGGCCGG + Intronic
925716086 2:6785678-6785700 TGAGGAGGAAGCAGGGAGGCAGG + Intergenic
926418742 2:12676303-12676325 AAAGGGGGAATGAGGGGTGCAGG - Intergenic
927482238 2:23463441-23463463 TGAGGGCTAATGAGGGAGGAGGG + Intronic
927641862 2:24850396-24850418 CCTGGGGGAAGGAAGGAGGCTGG + Intronic
927931084 2:27044830-27044852 TCTGGGGGAAGAAGGGAGGGAGG - Intronic
928251596 2:29686001-29686023 TAAAAGGGAAGGAGGGAGGCAGG - Intronic
928602406 2:32916143-32916165 TAAGGGGGAGGGAGGGAGGGAGG - Intergenic
928771037 2:34702202-34702224 TCAGGAATAATGTGGGAGGCCGG - Intergenic
928823457 2:35391333-35391355 CCAGGGAGAATGAGGTATGCGGG + Intergenic
928928811 2:36602886-36602908 TCAGGAATAATGTGGGAGGCCGG - Intronic
929076431 2:38082625-38082647 TCAGGAATAATGTGGGAGGCCGG + Intronic
929332671 2:40702603-40702625 TCAGGGGAAAGGACGGAAGCAGG + Intergenic
929792822 2:45036295-45036317 TCAGGAATAATGTGGGAGGCTGG + Intergenic
930103922 2:47625194-47625216 TGGGAGGGGATGAGGGAGGCAGG - Intergenic
930487084 2:52023754-52023776 TCAGGAATAATGTGGGAGGCTGG + Intergenic
931126527 2:59284262-59284284 AGAGGGGGCATGAGAGAGGCAGG - Intergenic
931948527 2:67335666-67335688 TCAGGAATAATGTGGGAGGCCGG - Intergenic
932044482 2:68333911-68333933 TCACTGGGAGTGAGTGAGGCAGG + Intergenic
932305012 2:70695823-70695845 TCAGGGGCAAGGAGGGAGAAAGG + Intronic
932400617 2:71478779-71478801 TCTGAGGGAGGGAGGGAGGCAGG - Intronic
932447531 2:71790186-71790208 TCTGGGGCAAAGAGGGATGCAGG + Intergenic
932973676 2:76575497-76575519 TCAGGAATAATGTGGGAGGCCGG + Intergenic
933013327 2:77092228-77092250 TCAGGAATAATGTGGGAGGCCGG - Intronic
933079502 2:77968957-77968979 TCAGGAATAATGTGGGAGGCCGG - Intergenic
933552155 2:83790766-83790788 TCAGGAATAATGTGGGAGGCTGG + Intergenic
933770822 2:85742861-85742883 TCTGGGGGAATAAGGTGGGCTGG + Intergenic
934553967 2:95277849-95277871 TGAGGGTGGATGAGGGGGGCAGG - Intronic
934659584 2:96136125-96136147 ACAGGGGGAGTGAGGGAAGCAGG + Intronic
934921622 2:98348563-98348585 GCTGTGGGAATGAGGGAGGAAGG - Intronic
935577325 2:104724396-104724418 TCAGGTGGAATGATGGAGATAGG + Intergenic
935796044 2:106642400-106642422 CCTGGGGGAAGGAGGGAGACGGG - Intergenic
935804848 2:106735209-106735231 GCAGGGGGCAGGAGGGTGGCAGG - Intergenic
935814374 2:106832792-106832814 TCTGGGGGAGGGAGAGAGGCAGG + Intronic
936037331 2:109123383-109123405 TCAGGGGAAGGGAGGGAGGGAGG - Intergenic
936883072 2:117279379-117279401 TGAGGGATAATGAGGGAGGTTGG - Intergenic
936978217 2:118240171-118240193 TCTGGGGGAAGGAAGGAGACAGG + Intergenic
936980878 2:118264081-118264103 TCAGGAGGATGGAGAGAGGCCGG - Intergenic
937034537 2:118769840-118769862 AGAGGGGGAAAGAGGGAGGAAGG + Intergenic
937249552 2:120514983-120515005 AGAGGGGGAATGGGGGAGGAGGG - Intergenic
937249640 2:120515317-120515339 TCAGGGAGAGTCAGGGAGGAAGG - Intergenic
937249719 2:120515658-120515680 TCAGGGAGAGTCAGGGAGGAGGG - Intergenic
937261309 2:120588183-120588205 TCAGGGAGAATGAGTAAGGATGG - Intergenic
937325024 2:120985237-120985259 GCTGGGGGAGTGAGGGTGGCTGG + Intronic
938291702 2:130154178-130154200 CCAGCAGGAAGGAGGGAGGCTGG - Intronic
939082908 2:137684800-137684822 TCAGGAATAATGTGGGAGGCCGG + Intergenic
939307646 2:140429990-140430012 TCAGGAATAATGAGGGAGGCCGG - Intronic
940552796 2:155182992-155183014 TCAGAGGGAAGGAGGGAGGAGGG + Intergenic
940675575 2:156721928-156721950 TCAGGAATAATGTGGGAGGCTGG + Intergenic
941386385 2:164857785-164857807 ACAGGTGGAATCAGGGAGGCTGG + Intergenic
941901914 2:170687101-170687123 TGAGGGGGGCTGAGTGAGGCAGG + Intergenic
941923723 2:170875662-170875684 CAAGGGGGATTGAGAGAGGCTGG - Intergenic
942013893 2:171791739-171791761 GCAAGGGAAATGGGGGAGGCGGG + Intronic
942043691 2:172087001-172087023 GCAGAGGGAATGAGGGAGGAAGG - Intronic
942215193 2:173712582-173712604 TCAGGTGCAATGATGGGGGCAGG + Intergenic
942680909 2:178477795-178477817 CCAGGTGGAATGAGGGAGCAGGG + Intronic
942730020 2:179053408-179053430 TCAGGAATAATGTGGGAGGCTGG + Intergenic
943421339 2:187672348-187672370 TCAGGAATAATGTGGGAGGCCGG + Intergenic
943835638 2:192511323-192511345 TCAGGAATAATGTGGGAGGCCGG - Intergenic
943840128 2:192569922-192569944 TCAGGGGTTATGGGGGAGGGAGG - Intergenic
943865612 2:192922123-192922145 TCAGGAATAATGTGGGAGGCAGG - Intergenic
943868095 2:192955320-192955342 TGTGGGAGAATGAGGGAGGAAGG - Intergenic
944394377 2:199250783-199250805 TCAGGAATAATGTGGGAGGCCGG - Intergenic
944875877 2:203963776-203963798 TCAGGAATAATGTGGGAGGCCGG + Intergenic
945152863 2:206808717-206808739 TCAGGAATAATGTGGGAGGCCGG + Intergenic
945173750 2:207021471-207021493 TCAGGAATAATGTGGGAGGCTGG - Intergenic
945224464 2:207519397-207519419 TTATGGGGAAAGAGGGAGGAAGG - Intergenic
945283710 2:208061414-208061436 TGAGGGGGAAAGGGGGAGGCTGG - Intergenic
945301184 2:208217717-208217739 TCAGGAATAATGTGGGAGGCTGG + Intergenic
945858421 2:215093815-215093837 TCAGGAATAATGTGGGAGGCCGG - Intronic
945938561 2:215926231-215926253 TCAGGAATAATGTGGGAGGCCGG - Intergenic
946886740 2:224229141-224229163 TCAGGAATAATGTGGGAGGCCGG - Intergenic
946893515 2:224300521-224300543 TCAGGAATAATGTGGGAGGCCGG - Intergenic
946996673 2:225400351-225400373 TCAGGGGCAGGGAGGGAGGGAGG + Intergenic
947911252 2:233802398-233802420 GAAGGGGGAATGAGGGTGGGAGG - Intronic
948088215 2:235267968-235267990 TCAGGGGGCTGGAGGCAGGCTGG - Intergenic
948390931 2:237610801-237610823 TCAGGAATAATGTGGGAGGCTGG - Intergenic
948652816 2:239459148-239459170 CCAGGGTGGGTGAGGGAGGCTGG - Intergenic
948698991 2:239748931-239748953 TCAGGGTAGATCAGGGAGGCTGG - Intergenic
948718482 2:239881393-239881415 GCAGTGGGCAGGAGGGAGGCCGG - Intergenic
948720050 2:239893835-239893857 GCAGGGAGAAGGAGTGAGGCTGG - Intronic
948720130 2:239894178-239894200 GCAGGGAGAAGGAGTGAGGCTGG - Intronic
948720139 2:239894218-239894240 GCAGGGAGAAGGAGTGAGGCTGG - Intronic
948796672 2:240406483-240406505 GCAGGAGGAAGGAGAGAGGCTGG - Intergenic
948856490 2:240732707-240732729 TGAGGGGGGATGAGGGATGAGGG + Intronic
948928782 2:241117061-241117083 TGAGGAGGTGTGAGGGAGGCGGG + Intronic
1169270903 20:4198794-4198816 ACAAGGGGCATGAGGGAGGGAGG - Intergenic
1169673678 20:8132043-8132065 TCAGAGCGAATGCGGGAGGCAGG + Intergenic
1170068632 20:12342129-12342151 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1170106473 20:12757730-12757752 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1170165978 20:13360803-13360825 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1170206348 20:13802774-13802796 TGATGGGGAAAGAGGAAGGCAGG - Intronic
1170680165 20:18519247-18519269 TCAGGAATAATGTGGGAGGCCGG + Intronic
1171536714 20:25898944-25898966 TGAGGGGGTCTGAGGGTGGCTGG + Intergenic
1171880048 20:30611714-30611736 TCAGGGGGAACGAGGAGGGATGG - Intergenic
1172348142 20:34220659-34220681 ACACGGGGAATCAGGGAAGCAGG + Intronic
1172357510 20:34290509-34290531 TCCCGGGGAGTGAGGGAGGAGGG - Intronic
1172467328 20:35165949-35165971 GAAGGGGGAAAGAGGGAGGGAGG - Intergenic
1172773052 20:37392700-37392722 ACAGTGGGAATGAGAGGGGCTGG + Intronic
1172956421 20:38762735-38762757 TCACTTGGATTGAGGGAGGCTGG + Intronic
1173427489 20:42955802-42955824 TGAGGGAGAAGGAGGGAGGGAGG + Intronic
1173427498 20:42955828-42955850 TGAGGGAGAAGGAGGGAGGGAGG + Intronic
1173652344 20:44674590-44674612 TCAGGAATAATGTGGGAGGCTGG - Intergenic
1173763508 20:45585853-45585875 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1173781958 20:45763512-45763534 TCAGGAATAATGTGGGAGGCCGG - Intronic
1173850196 20:46212961-46212983 TCAGGAGGAATGGGGGAGGCAGG - Intronic
1173876773 20:46377676-46377698 TCAGGGGGAGGGAGGGATGCAGG - Intronic
1173998778 20:47359226-47359248 TCAGAGAGAGGGAGGGAGGCGGG - Intergenic
1174054596 20:47789075-47789097 TCATGGGGGATGAGGGATGTGGG - Intergenic
1174124058 20:48289672-48289694 TAAAGGTGAATGAGGGAGGCAGG + Intergenic
1174215293 20:48911799-48911821 ACAGGGGTACTTAGGGAGGCAGG - Intergenic
1174303603 20:49600013-49600035 GTAGTGGGAGTGAGGGAGGCTGG - Intergenic
1174317259 20:49713066-49713088 TCATGGGGAGTGGGGGAGGATGG + Intronic
1174432015 20:50477215-50477237 ACAGGGGCAGGGAGGGAGGCAGG + Intergenic
1174590635 20:51641938-51641960 TTAGGGGGAGTAGGGGAGGCAGG - Intronic
1174832702 20:53827735-53827757 ACAGAGGGAAGGAGGGAGGGAGG - Intergenic
1175722684 20:61296842-61296864 TCAGGTGGAAGGAGGGACGGGGG + Intronic
1175938102 20:62524457-62524479 TGAGGGGGGCTGAGGCAGGCGGG - Intergenic
1175940093 20:62533807-62533829 TCATGGGGGAAGAAGGAGGCGGG + Intergenic
1176007316 20:62873194-62873216 TGAGGAAGAAAGAGGGAGGCAGG + Intergenic
1177030898 21:15981446-15981468 TCAGGAATAATGTGGGAGGCTGG + Intergenic
1177100918 21:16896393-16896415 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1177102948 21:16918052-16918074 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1177816514 21:25983743-25983765 TCAAGTGGAAGGAAGGAGGCAGG + Intronic
1177840477 21:26229671-26229693 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1179014982 21:37588585-37588607 TCAGGAGTAATGTGGGAGGCTGG + Intergenic
1179413367 21:41179094-41179116 TCAGGGTGACTGAGGGTGCCAGG + Intronic
1179591528 21:42412355-42412377 TCAGGGGGCATCAGGGAGGCCGG + Intronic
1179630471 21:42674707-42674729 TCTGGGGGTAGGAGAGAGGCTGG - Intronic
1180118450 21:45727561-45727583 ACAGGAGGAATGGGTGAGGCAGG + Intronic
1180316101 22:11278124-11278146 ACAGAGGGAAAGAGGGAGGGAGG + Intergenic
1180848127 22:18995436-18995458 TGAGGCGGAAGGAAGGAGGCTGG + Intergenic
1180948015 22:19707533-19707555 GCAGGTGGGGTGAGGGAGGCAGG - Intergenic
1180980819 22:19877239-19877261 ACATGGGGGATGGGGGAGGCAGG + Intronic
1181033156 22:20157823-20157845 TGAGAGGGAATGATGGAGGCTGG + Intergenic
1181510153 22:23385409-23385431 TGAGAGGGAATGACGGAGGCTGG - Intergenic
1182036739 22:27204409-27204431 TCACTGGCAATGAGGGAGGCAGG + Intergenic
1182331721 22:29555717-29555739 GCAGGGGGAGGGAGGCAGGCAGG + Exonic
1182358924 22:29735335-29735357 TCAGGAGGCAGGAGGAAGGCAGG + Intronic
1182585994 22:31344734-31344756 CCAGGGGGCCTGAGGGAGGCAGG - Exonic
1182739915 22:32560281-32560303 GCAGAGGGAAAGAAGGAGGCAGG - Intronic
1183416935 22:37688020-37688042 GCAGGGGGAAGGTGGGAGGGAGG + Intronic
1183636530 22:39066760-39066782 TCAGGAATAATGTGGGAGGCCGG + Intronic
1183771808 22:39933066-39933088 CCATGGGGTATGAGGGGGGCAGG + Intronic
1184113095 22:42406601-42406623 GCACCTGGAATGAGGGAGGCAGG - Intronic
1184686703 22:46099499-46099521 CCTGGGGGAATCAGGGAGGAGGG + Intronic
949161846 3:892526-892548 TCAGGAATAATGTGGGAGGCCGG + Intergenic
949213275 3:1532579-1532601 TCCTTGGGAATGAGGCAGGCAGG + Intergenic
949401098 3:3665944-3665966 ACAGGGGGAGGGAGGGAGGGAGG + Intergenic
949799674 3:7889960-7889982 TCAGGGGGAAGGTGGGAGGGGGG + Intergenic
949827681 3:8180861-8180883 TCAGGAATAATGTGGGAGGCTGG - Intergenic
949961045 3:9312754-9312776 TTGGGGGGAATGCTGGAGGCTGG + Intronic
950493096 3:13318054-13318076 CCAGGGGGCATGAGGCAGGGAGG + Intronic
950707114 3:14789730-14789752 TCTGGGGGCAAGACGGAGGCAGG + Intergenic
950727355 3:14925205-14925227 GCAGTGGGATTGAGGGAGGCTGG - Intronic
950793158 3:15489435-15489457 TCAGGTGGAGTGGGGCAGGCAGG + Intronic
950907568 3:16553001-16553023 ACAGAAGGAATGAGGGAGGGAGG + Intergenic
950926202 3:16744855-16744877 TGAGGGATAGTGAGGGAGGCTGG - Intergenic
950926728 3:16748167-16748189 TCAGGAATAATGTGGGAGGCCGG - Intergenic
950946896 3:16958802-16958824 TCAGGAGCAATGATGAAGGCTGG + Intronic
951651901 3:24959790-24959812 ACAAGGGGAATGAGGCAGGAAGG + Intergenic
952125722 3:30298540-30298562 TCAGAGGGAATGGGGTAGGAAGG - Intergenic
952297171 3:32071805-32071827 TCAGGAACAATGTGGGAGGCTGG - Intronic
952543343 3:34391734-34391756 AAATGGGGAATGTGGGAGGCAGG + Intergenic
952760088 3:36905823-36905845 GAAAGGGGACTGAGGGAGGCAGG - Intronic
952845302 3:37683107-37683129 TCAGAGGGACTGAGGGAGTTGGG - Intronic
952926854 3:38326607-38326629 TTGTGGGGAGTGAGGGAGGCAGG - Intergenic
952995527 3:38878017-38878039 TCAGGGGAAATGAGGGTGTGAGG + Intronic
953103430 3:39852534-39852556 TCAGGGGGAAGGGGGGAGTGGGG - Intronic
953770580 3:45776158-45776180 TCAGGGGGCACGGGTGAGGCAGG + Intronic
954133812 3:48572924-48572946 TCAGGGGGAGACAGGGAAGCCGG - Exonic
954386346 3:50246080-50246102 TCGGAGGGAATGAGGGGGGCCGG + Intronic
954584260 3:51720261-51720283 GAAGGGGAAATGAGGGGGGCAGG - Intergenic
955320680 3:57972178-57972200 TCAGGGGCAGGGAGGGCGGCTGG + Intergenic
955400400 3:58587104-58587126 GCCGGGGGAAGGAGGGGGGCAGG + Intronic
956050265 3:65240504-65240526 TCTGTGGGAATGAGGGAGGTAGG - Intergenic
956205374 3:66749575-66749597 GCAGAGGGAAAGAGGGAGGGAGG + Intergenic
956538689 3:70309070-70309092 TAAGGGGGAGTGAGGGAGGTTGG + Intergenic
956709491 3:72027054-72027076 TCAGGAATAATGTGGGAGGCCGG - Intergenic
957059649 3:75471721-75471743 TCAGGAATAATGTGGGAGGCCGG + Intergenic
957294162 3:78315006-78315028 TCAGTGGGCTTTAGGGAGGCAGG - Intergenic
957295469 3:78327645-78327667 TCAGGAATAATGTGGGAGGCCGG - Intergenic
959932393 3:111998816-111998838 TCAGCGGGAGGGAGGCAGGCGGG + Exonic
960035719 3:113101344-113101366 TCAGGTGGAGGGAGGGAGGATGG - Intergenic
961140494 3:124551727-124551749 ACAGGAGAAATGAGGGATGCTGG - Intronic
961164523 3:124754418-124754440 TCAGGAATAATGTGGGAGGCCGG + Intergenic
961280495 3:125762829-125762851 TTGGGGGGAATGTGTGAGGCTGG + Intergenic
961321675 3:126081359-126081381 ACAGGGGGAAAAAGGGAGGATGG + Intronic
961620127 3:128217472-128217494 GCTGGGAGATTGAGGGAGGCAGG - Intronic
961871663 3:129992993-129993015 TCAAGGGGGCTGGGGGAGGCAGG - Intergenic
961892320 3:130140527-130140549 TCAGGAATAATGTGGGAGGCCGG + Intergenic
961895930 3:130167742-130167764 TCACAGGGAATGACGGACGCTGG + Intergenic
961983722 3:131109263-131109285 TCAGGGAGAATAAGGGAGTAGGG + Intronic
962236479 3:133711618-133711640 TCAGGGGAAATGAGGGCAGCTGG - Intergenic
962445596 3:135461219-135461241 TAAGAGGGAAAGAGGGAGTCTGG + Intergenic
962523687 3:136219592-136219614 TCAGGAATAATGTGGGAGGCTGG + Intergenic
962660908 3:137599541-137599563 TCAGGAATAATGTGGGAGGCTGG - Intergenic
962908327 3:139825315-139825337 TCAAGGGGAAAGCGGGAGACTGG + Intergenic
962934745 3:140069468-140069490 TCATGGGCAGTGATGGAGGCTGG + Intronic
963425460 3:145116832-145116854 TCAGGAATAATGCGGGAGGCCGG - Intergenic
963521893 3:146366119-146366141 TCAGGAATAATGTGGGAGGCCGG - Intergenic
963616610 3:147547145-147547167 TAAGGGGAAAGGAGGGAGGGAGG + Intergenic
963663588 3:148155501-148155523 TCAGGAATAATGTGGGAGGCCGG - Intergenic
963684564 3:148418201-148418223 TCAGGAATAATGTGGGAGGCCGG - Intergenic
963707041 3:148699801-148699823 TCAGGGGGAAAAAAGGTGGCGGG - Intronic
964983878 3:162716448-162716470 TCAGGAATAATGTGGGAGGCCGG - Intergenic
965070591 3:163911597-163911619 TCAGGAATAATGTGGGAGGCCGG - Intergenic
965661890 3:171050729-171050751 GCAGGGGACATGAGGAAGGCAGG - Intergenic
965839067 3:172882333-172882355 ACAGTGGGAATGAAGCAGGCAGG + Intergenic
965861712 3:173157607-173157629 TCAGGAATAATGTGGGAGGCCGG + Intergenic
966085700 3:176065393-176065415 TCAGGAATAATGTGGGAGGCCGG - Intergenic
966104864 3:176323495-176323517 TCAGGAATAATGTGGGAGGCCGG + Intergenic
966397892 3:179520711-179520733 TCAGGAATAATGTGGGAGGCCGG - Intergenic
966406584 3:179604782-179604804 GCAGGAGGAAGAAGGGAGGCGGG - Exonic
966480034 3:180397131-180397153 TCAGGGAGAATGATGGTAGCAGG - Intergenic
966768795 3:183485753-183485775 AAAGGGAGAATAAGGGAGGCAGG - Intergenic
966807800 3:183820020-183820042 TCAGGTGGAAGGAGCCAGGCTGG + Intronic
967152365 3:186661869-186661891 TCAGGAATAATGTGGGAGGCCGG - Intronic
967211925 3:187177386-187177408 TCAGGAATAATGTGGGAGGCCGG + Intronic
967243938 3:187468131-187468153 TCAGGAATAATGTGGGAGGCCGG + Intergenic
967496458 3:190148352-190148374 TCAGGAATAATGTGGGAGGCCGG - Intergenic
967561618 3:190923962-190923984 TCAGGAATAATGTGGGAGGCCGG - Intergenic
967740707 3:192999537-192999559 TCAGGAATAATGTGGGAGGCCGG - Intergenic
968038576 3:195569353-195569375 TCTGGGTGAGTGAGGCAGGCAGG - Intronic
968499399 4:940487-940509 TCAGGAAGAAAGAGGGAGGGTGG + Intronic
968558242 4:1261336-1261358 TCAGGGGGATTGAAGGAGCAAGG + Intergenic
968601513 4:1512099-1512121 TGAGAGGGAATGAGGGAGGAAGG + Intergenic
968993620 4:3931223-3931245 TCAGGAATAATGTGGGAGGCCGG - Intergenic
969003549 4:4001907-4001929 TCAGGAATAATGTGGGAGGCCGG + Intergenic
969293869 4:6257676-6257698 TCAGGGGACAGGAAGGAGGCCGG + Intergenic
969355227 4:6621117-6621139 GCAGGGGGTGAGAGGGAGGCTGG + Intronic
969810375 4:9642916-9642938 TCAGGAATAATGTGGGAGGCCGG - Intergenic
970042309 4:11810131-11810153 TCAGGAATAATGTGGGAGGCTGG - Intergenic
970087814 4:12367830-12367852 TCAGGAATAATGTGGGAGGCCGG - Intergenic
971200369 4:24504857-24504879 TCAGGAATAATGTGGGAGGCCGG - Intergenic
971380125 4:26088946-26088968 TCAGAGGGAATGGGGGTGGGTGG + Intergenic
971385694 4:26138955-26138977 TCAAGAGGAAAGAGGGAGGTGGG + Intergenic
971501807 4:27326298-27326320 AGAGGGGGAAGGAGGGAGGGAGG + Intergenic
972789471 4:42357259-42357281 AGAGGGGGAGGGAGGGAGGCGGG + Intergenic
973669367 4:53199912-53199934 GCAGAGAGAAGGAGGGAGGCGGG + Intronic
973704991 4:53572286-53572308 TTCTGGGGAATGAGGGAGGTAGG + Intronic
973844107 4:54893472-54893494 TAAGGTGGACTGAAGGAGGCTGG - Intergenic
975152357 4:71035222-71035244 TCAGGAATAATGTGGGAGGCTGG - Intergenic
975844313 4:78508828-78508850 TCTGGGGAAATGAGGGTCGCAGG - Intronic
975933648 4:79555835-79555857 TCAGGAATAATGTGGGAGGCCGG + Intergenic
976105328 4:81611565-81611587 TAACAGGGAAAGAGGGAGGCAGG + Intronic
976133463 4:81909425-81909447 TCATGGGGAATGGGGGTGGGAGG + Intronic
976558843 4:86478645-86478667 TCAGGAATAATGTGGGAGGCCGG - Intronic
976696776 4:87925719-87925741 TCAGGAATAATGTGGGAGGCCGG - Intergenic
976719326 4:88154685-88154707 TCAGGAATAATGTGGGAGGCCGG + Intronic
976739665 4:88345242-88345264 TCAGGAATAATGTGGGAGGCTGG + Intergenic
977012694 4:91656478-91656500 TCAGGAATAATGTGGGAGGCCGG + Intergenic
977198198 4:94086487-94086509 TCAGGAATAATGTGGGAGGCCGG + Intergenic
977216921 4:94295109-94295131 TCAGGAATAATGTGGGAGGCCGG + Intergenic
977361926 4:96016220-96016242 TAAGAGAGAAAGAGGGAGGCAGG + Intergenic
978438855 4:108713001-108713023 TCAGGAATAATGTGGGAGGCCGG - Intergenic
978815888 4:112905017-112905039 TCAAGGGGAAGGAGGGAAGAAGG + Intronic
979380174 4:119997774-119997796 TCAGGAATAATGTGGGAGGCCGG - Intergenic
979850070 4:125563491-125563513 TCAGGAATAATGTGGGAGGCCGG + Intergenic
980472164 4:133265349-133265371 TCAGGAATAATGTGGGAGGCTGG + Intergenic
980874218 4:138644771-138644793 TTGGGAGGAATGAGTGAGGCAGG + Intergenic
980904178 4:138931715-138931737 TCAGGAATAATGTGGGAGGCCGG - Intergenic
981044640 4:140253473-140253495 TAAGGAGGAAGGAGGGAGGGAGG + Intergenic
981539956 4:145836599-145836621 TCAGGAATAATGTGGGAGGCCGG - Intronic
981799876 4:148643037-148643059 TGGGGTGGAATGAGGGAGGAAGG + Intergenic
982068026 4:151671822-151671844 GCAGGGGGAGTGAGGAAGCCAGG + Intronic
982083717 4:151814308-151814330 TCAGGAATAATGTGGGAGGCCGG + Intergenic
982084224 4:151817633-151817655 TGAGGGATAATGAGGGAGGTTGG + Intergenic
982319105 4:154060502-154060524 TCAGGAATAATGTGGGAGGCTGG - Intergenic
982535678 4:156604136-156604158 TCAGGAACAATGTGGGAGGCCGG - Intergenic
983024115 4:162712949-162712971 TCAGGAATAATGTGGGAGGCTGG - Intergenic
983055719 4:163096916-163096938 TCAGGAATAATGTGGGAGGCCGG - Intergenic
983178572 4:164620892-164620914 TCAGGGTGAATGAGTGATTCAGG - Intergenic
983345831 4:166524586-166524608 TCAGGAATAATGTGGGAGGCTGG - Intergenic
983360649 4:166720157-166720179 TCAGGAATAATGTGGGAGGCCGG - Intergenic
983448294 4:167880174-167880196 TCAGGAATAATGTGGGAGGCCGG - Intergenic
983452575 4:167926743-167926765 TCAGGAATAATGTGGGAGGCTGG - Intergenic
983659810 4:170120301-170120323 TCAGGAATAATGTGGGAGGCCGG - Intergenic
983707436 4:170678220-170678242 TGAGGGATAATGAGGGAGGTTGG - Intergenic
984098772 4:175463045-175463067 TCAGGAATAATGTGGGAGGCCGG + Intergenic
984661779 4:182382461-182382483 GCAGTGTGAATGAGAGAGGCGGG - Intronic
985582582 5:706634-706656 TCAGGAATAATGTGGGAGGCTGG - Intergenic
985625129 5:981862-981884 ACAGGTGGACTGAGGCAGGCCGG - Intergenic
985625152 5:981936-981958 ACAGGTGGACTGAGGCAGGCCGG - Intergenic
985625194 5:982084-982106 ACAGGTGGACTGAGGCAGGCCGG - Intergenic
985848556 5:2371931-2371953 CCAGGGTGAAGGAGGGAGGGAGG - Intergenic
986026652 5:3857638-3857660 TAAGGGGCAATGACAGAGGCAGG + Intergenic
986193760 5:5519391-5519413 TCAGGAATAATGTGGGAGGCTGG - Intergenic
986368680 5:7059794-7059816 TCAGGAATAATGTGGGAGGCTGG + Intergenic
986420574 5:7577034-7577056 TCAGGGCAAATCAGGGAGGAAGG - Intronic
986554777 5:9000192-9000214 TCAGGAATAATGTGGGAGGCTGG + Intergenic
987281749 5:16420554-16420576 TGAGGGATAGTGAGGGAGGCTGG - Intergenic
987497893 5:18670713-18670735 TCAGGAATAATGTGGGAGGCTGG + Intergenic
987734219 5:21818519-21818541 TCTGGGGGAAGGAGGGAAGAAGG - Intronic
987756063 5:22098692-22098714 TCAGGAATAATGTGGGAGGCCGG - Intronic
988199370 5:28049706-28049728 TCAGGAATAATGTGGGAGGCTGG - Intergenic
989011737 5:36878876-36878898 TTAGTGGGAGGGAGGGAGGCCGG - Intronic
989056591 5:37371362-37371384 TGAGGAGGAAGGAGGGAGGAGGG + Intergenic
989975367 5:50579710-50579732 TCAGGGGAAATGTGGGAGGGGGG - Intergenic
990564900 5:57019008-57019030 TCCGGGATAATGTGGGAGGCCGG + Intergenic
990690247 5:58355743-58355765 TGAGGGGGAAGGAGGAAGGAAGG - Intergenic
991518464 5:67466508-67466530 TTAGGGAGACTGAGGCAGGCAGG - Intergenic
992565784 5:77994172-77994194 TCAGGGGGGCTGAGAGAGGAGGG - Intergenic
992605100 5:78447928-78447950 AGAGGGGGAAGGAGGGAGGAAGG - Intronic
992624810 5:78627349-78627371 ACAGGGAAAGTGAGGGAGGCTGG - Intronic
992961104 5:81957345-81957367 TCAGGAATAATGTGGGAGGCCGG - Intergenic
993202339 5:84831530-84831552 AGAGGGGGAAAGATGGAGGCAGG + Intergenic
994124267 5:96152045-96152067 TCAGGAGGAAGGAGGGAGGGAGG + Intergenic
994557154 5:101318757-101318779 TCAGGAATAATGTGGGAGGCCGG - Intergenic
995122745 5:108553129-108553151 TCAGGAATAATGTGGGAGGCCGG - Intergenic
995124928 5:108570337-108570359 TCAGGAATAATGTGGGAGGCCGG + Intergenic
996032456 5:118721226-118721248 TTGGGGGGAAGGAGGGAGGGGGG + Intergenic
996284614 5:121774333-121774355 TCATGGGGAATGGGGGATGTAGG + Intergenic
996528282 5:124500899-124500921 TCAGGAATAATGTGGGAGGCCGG - Intergenic
996725642 5:126671602-126671624 TCAGGAATAATGTGGGAGGCCGG + Intergenic
997194623 5:131970311-131970333 TCAGGGCGATGGAGGGAGGGAGG + Intronic
997411714 5:133695948-133695970 ACAGAAGGAATGAGGGAGGTGGG - Intergenic
997743481 5:136278379-136278401 ACAGGGGCAATGAGGAAGGAAGG - Intronic
997770393 5:136548189-136548211 TCAGGAATAATGTGGGAGGCCGG + Intergenic
997772418 5:136567206-136567228 TCAGGAATAATGTGGGAGGCCGG + Intergenic
998156857 5:139792057-139792079 TGAGGGGGAATGAGTGTGGGAGG + Intergenic
998560419 5:143166281-143166303 TCAGGGTGACTGAGGGAGTGTGG + Intronic
999147347 5:149405275-149405297 TCAGAAGGAATGAGGGAGGGTGG + Intergenic
999431863 5:151531609-151531631 TCAGCGGGAACGAGCAAGGCAGG - Exonic
999526099 5:152407524-152407546 TTAGGGGAAGAGAGGGAGGCAGG - Intronic
999974133 5:156894025-156894047 TCTGGGGAAACTAGGGAGGCTGG + Intergenic
1000439986 5:161252557-161252579 TCAGGAATAATGTGGGAGGCAGG - Intergenic
1000497165 5:161999097-161999119 CCAAGGAGAATGAGGGAGGGAGG - Intergenic
1000519165 5:162277263-162277285 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1001089416 5:168726421-168726443 GCAGGGAGGAAGAGGGAGGCAGG + Intronic
1001881255 5:175246143-175246165 TCAGGAGGAATAAGGGAGCTGGG + Intergenic
1002173500 5:177388237-177388259 GCAGGGGGAGTGAAGGAGGCTGG - Intronic
1002192886 5:177488005-177488027 TCAGTGGGAACGAGGGCTGCTGG - Intronic
1002400496 5:178989186-178989208 GGAGGGGGAAGGCGGGAGGCCGG - Intronic
1002884344 6:1280724-1280746 AAAGGGGGAATGAGGGAGGAGGG + Intergenic
1004106496 6:12671209-12671231 TCAGGGATAATGTGGGAGGCCGG - Intergenic
1004126818 6:12882121-12882143 ACAGGGGGATGGAGGGAAGCAGG + Intronic
1004360695 6:14968148-14968170 GGAGTGGGAGTGAGGGAGGCAGG + Intergenic
1004768336 6:18755930-18755952 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1004837275 6:19542967-19542989 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1005014417 6:21363366-21363388 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1005863030 6:29916028-29916050 CCAGGGGGTCTGAGGGACGCTGG - Intergenic
1006053590 6:31363398-31363420 TCAGGGAGAATGAGATGGGCTGG + Intergenic
1006325069 6:33347502-33347524 TCAGGAATAATGTGGGAGGCTGG - Intergenic
1006401610 6:33821057-33821079 GCAGGGGAACTGAGGGAGGTGGG + Intergenic
1006723221 6:36174159-36174181 TGGGGGGGAAGGAGGGAGGGAGG + Intergenic
1006810958 6:36820197-36820219 TCAGGTGGAAAGAGGAAAGCGGG - Intronic
1006916150 6:37595073-37595095 TGCAGGGGAGTGAGGGAGGCAGG + Intergenic
1007427918 6:41759257-41759279 GCAGGGGGAATGATCCAGGCAGG + Intergenic
1007834592 6:44664842-44664864 GCAGGAGGAAAGAGGGAGGGAGG + Intergenic
1007922542 6:45623870-45623892 TCAGAGGGAATGAGTGAGGATGG - Intronic
1008291986 6:49726911-49726933 ACAGAGGAAATGAGGGAGGGTGG + Intergenic
1008476866 6:51942565-51942587 TCAGGAATAATGTGGGAGGCCGG - Intronic
1008658773 6:53644143-53644165 TCAGGGGGAATGATGGAAATTGG + Intergenic
1008754073 6:54772952-54772974 TCATGGGGCATGTGGAAGGCAGG - Intergenic
1009379363 6:63009025-63009047 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1010071452 6:71750202-71750224 TCAGGAATAATGTGGGAGGCAGG + Intergenic
1010887555 6:81263181-81263203 CCAGGGAGAAAGAGGTAGGCAGG + Intergenic
1011367630 6:86600022-86600044 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1011719869 6:90144365-90144387 ACAGAGGGAAGGAGGGAGGGAGG + Intronic
1012014157 6:93831933-93831955 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1012066304 6:94555804-94555826 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1012401905 6:98848199-98848221 TCATGCGGCAAGAGGGAGGCCGG - Intergenic
1012437787 6:99233581-99233603 TAAAGGGGAATGAAGGATGCAGG + Intergenic
1012979797 6:105817501-105817523 ACAGGGGGAAGAAGAGAGGCAGG - Intergenic
1013195191 6:107838465-107838487 TCGGGGACAATGGGGGAGGCCGG - Intergenic
1013369145 6:109455178-109455200 TCAGAGGGTATGGAGGAGGCGGG + Intronic
1013424033 6:109994470-109994492 TCAGAGGGAATCAGGGAGGCAGG + Intergenic
1013843468 6:114424334-114424356 TCAGGTATAATGTGGGAGGCCGG + Intergenic
1013891943 6:115035731-115035753 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1014396306 6:120929022-120929044 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1014416401 6:121190238-121190260 GGAGGGGGAAGGAGGGAGGTTGG - Intronic
1014614432 6:123584154-123584176 TCAGGAATAATGTGGGAGGCTGG + Intronic
1014744214 6:125180944-125180966 TCTGGTGGCATGAAGGAGGCTGG + Intronic
1015190231 6:130464239-130464261 CCGGGGAGAGTGAGGGAGGCAGG - Intergenic
1015266083 6:131293626-131293648 TCATGGGGAAGAGGGGAGGCTGG + Intergenic
1015266979 6:131299303-131299325 TCAGGAATAATGTGGGAGGCTGG - Intergenic
1015271609 6:131342720-131342742 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1015324065 6:131905536-131905558 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1015426680 6:133078132-133078154 TCAGGGGGCATTTTGGAGGCTGG + Intergenic
1015801112 6:137062974-137062996 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1016114413 6:140262472-140262494 TGAGGGATAGTGAGGGAGGCTGG + Intergenic
1016204796 6:141456877-141456899 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1016249132 6:142019871-142019893 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1016317708 6:142808514-142808536 ACAGAGGGAAGGAGGGAGGGAGG + Intronic
1016380847 6:143477236-143477258 TTAAGGGGAATGTGGGAGCCAGG + Intronic
1016426399 6:143940185-143940207 GGAGGGGGCATGAGGGAGCCAGG + Intergenic
1016535523 6:145105014-145105036 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1017416751 6:154228972-154228994 TCTAGGGGAATGAGGTAGGAAGG - Intronic
1017584715 6:155908113-155908135 TAAGGGGGCATGAGGCTGGCTGG + Intergenic
1017644403 6:156526007-156526029 TCTGGGGGAAAGAGGGATTCTGG + Intergenic
1018165215 6:161087513-161087535 TCAGTGTGACTGAAGGAGGCAGG - Intronic
1018301609 6:162408982-162409004 ACAGGGGGAGTGGGAGAGGCAGG - Intronic
1018861223 6:167712256-167712278 GGAGGGGGAATGAGGGTGGCTGG + Intergenic
1018873395 6:167799850-167799872 CCACGAGGAAGGAGGGAGGCAGG + Intergenic
1018901614 6:168054491-168054513 TCAGGTGGCATGAGGCAGGCCGG - Intergenic
1018956746 6:168415506-168415528 GAAGGGGGAATGAGGGTGGAGGG + Intergenic
1019057882 6:169236106-169236128 TAAGGGGGAATGAGTGTGGATGG - Intronic
1019315076 7:380548-380570 GCAGGGGGACAGAGGGAGGCAGG + Intergenic
1019315091 7:380578-380600 GCAGGGGGACAGAGGGAGGGAGG + Intergenic
1019315106 7:380608-380630 GCAGGGGGACAGAGGGAGGGAGG + Intergenic
1019315121 7:380638-380660 GCAGGGGGACAGAGGGAGGGAGG + Intergenic
1019397535 7:830097-830119 TAAGGGGGAAGGAGGAAGGAGGG + Intronic
1019932110 7:4230468-4230490 GCAGGGGGAAGGAAGGAGGGAGG + Intronic
1019939015 7:4274527-4274549 TCAGAGTGAATGGGGAAGGCAGG - Intergenic
1020114246 7:5466757-5466779 GCAGGAGGCAGGAGGGAGGCAGG + Intronic
1020316288 7:6907630-6907652 TCAGGAATAATGTGGGAGGCTGG - Intergenic
1020322524 7:6950019-6950041 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1020326617 7:6979353-6979375 TCACAGGGAATGACGGACGCTGG + Intergenic
1020499865 7:8904040-8904062 TGAGAGGGAAGGAGGGAGGGAGG + Intergenic
1020532477 7:9355280-9355302 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1020722255 7:11761897-11761919 AAGGGGGGAAGGAGGGAGGCAGG - Intronic
1021393893 7:20124654-20124676 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1021637622 7:22707469-22707491 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1021799232 7:24287451-24287473 GCAGGGGGAATGCTGGTGGCGGG - Intronic
1021810885 7:24400123-24400145 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1021977667 7:26026059-26026081 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1022007374 7:26278247-26278269 TCGGGGGGAGGGGGGGAGGCGGG + Intergenic
1022572524 7:31468681-31468703 TCTGGGATAATGTGGGAGGCTGG + Intergenic
1022574803 7:31487302-31487324 ACAGGAGGAAGGAGGAAGGCGGG - Intergenic
1022709343 7:32836425-32836447 TCAGGAATAATGTGGGAGGCTGG - Intergenic
1023698654 7:42872472-42872494 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1023705124 7:42932889-42932911 AAAGGGAGAATGAGCGAGGCGGG + Intronic
1023761124 7:43466040-43466062 GAAGGGGGAAGGAGGGAGGGAGG + Intronic
1023831041 7:44039162-44039184 ACAGGTGGACTGAGGAAGGCAGG + Intergenic
1024331588 7:48160546-48160568 GCAGGGGGAAGGATGGAGGGTGG + Intergenic
1024466165 7:49713446-49713468 TCAGAGGTAAGGAGGGAGGGAGG + Intergenic
1024782766 7:52870924-52870946 TCAGGGGGATTTTGGGAGGGAGG + Intergenic
1024907104 7:54398098-54398120 TGAGAGTGAAAGAGGGAGGCAGG - Intergenic
1024942514 7:54777271-54777293 TCAGGGGAAGAGAGGGAGCCGGG - Intergenic
1025997889 7:66539605-66539627 TAAAGGGGAAAGAGGGGGGCTGG + Intergenic
1026102716 7:67396188-67396210 CCTGGGGGAAGGAGGGAAGCTGG - Intergenic
1026321243 7:69269209-69269231 TCAGAGGGACTGAGGTAGGGAGG + Intergenic
1026459788 7:70603824-70603846 TCAGAGGAACTGGGGGAGGCTGG - Intronic
1027852187 7:83463515-83463537 TCAGGAATAATGTGGGAGGCCGG - Intronic
1028670741 7:93397782-93397804 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1029502909 7:100944888-100944910 CCAGGAGGAGTGAGTGAGGCAGG - Intergenic
1029530473 7:101122056-101122078 TCACCAGGAATCAGGGAGGCTGG + Intergenic
1029741367 7:102493467-102493489 ACAGGTGGACTGAGGAAGGCAGG + Intronic
1029759357 7:102592636-102592658 ACAGGTGGACTGAGGAAGGCAGG + Intronic
1029776726 7:102688546-102688568 ACAGGTGGACTGAGGAAGGCAGG + Intergenic
1030159464 7:106492619-106492641 ACAGAGGGAAGGAGGGAGGGAGG + Intergenic
1031214346 7:118870952-118870974 TCAGGGGGCAACAGGAAGGCCGG + Intergenic
1031296884 7:120012938-120012960 TCAGGAATAATGTGGGAGGCTGG - Intergenic
1031365026 7:120890786-120890808 TGAGGGATAGTGAGGGAGGCTGG + Intergenic
1031422177 7:121565472-121565494 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1031525877 7:122821102-122821124 TCAGGAATAATGTGGGAGGCTGG - Intronic
1031686080 7:124732880-124732902 TCAGGAATAATGTGGGAGGCTGG - Intergenic
1031727710 7:125260765-125260787 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1032121384 7:129159715-129159737 TCACGGAGCATGGGGGAGGCAGG - Intronic
1032577265 7:133068592-133068614 ACAGGGGGAAAGAGTGAAGCAGG + Intronic
1033084940 7:138332717-138332739 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1033209667 7:139451581-139451603 TCAGGTGGAGTGAGGGAGAAAGG - Intergenic
1033211740 7:139464979-139465001 TCAGGAATAATGTGGGAGGCCGG - Intronic
1033551838 7:142454727-142454749 ACTGGGGGAATGGAGGAGGCTGG + Intergenic
1033556382 7:142491723-142491745 ACTGGGGGAATGGAGGAGGCTGG + Intergenic
1035113555 7:156504797-156504819 TCAGTGGGGACGAGGCAGGCGGG - Intergenic
1035374782 7:158400891-158400913 TCTGGGGGAATGCGGGGGGTGGG - Intronic
1035407525 7:158609387-158609409 TGAGGGGGAATGTGTGAGGAGGG + Intergenic
1035587175 8:785590-785612 TCTGAGGGGAGGAGGGAGGCCGG - Intergenic
1036370003 8:8154574-8154596 TCACAGGGAATGACGGACGCTGG - Intergenic
1036373518 8:8180951-8180973 TCAGGAATAATGGGGGAGGCCGG - Intergenic
1036639770 8:10575495-10575517 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1036830879 8:12018794-12018816 TTGGGGGGAATGTGTGAGGCTGG - Intergenic
1036877385 8:12484690-12484712 TCAGGAATAATGGGGGAGGCCGG + Intergenic
1036880889 8:12511056-12511078 TCACAGGGAATGACGGACGCTGG + Intergenic
1036963750 8:13273729-13273751 TAAGGGGGAAGGGGGGAGGGAGG + Intronic
1037128959 8:15384708-15384730 GCAAGGAGCATGAGGGAGGCAGG - Intergenic
1037564199 8:20103679-20103701 ACAGCGGGAACGAGGGAGGGTGG + Intergenic
1037930234 8:22875467-22875489 TGAGGGGGAAGGTGGGAGGAGGG - Intronic
1038786314 8:30619935-30619957 TAAAAGGGAAAGAGGGAGGCAGG + Intronic
1039190516 8:34968597-34968619 TGAGTGAGAAAGAGGGAGGCAGG + Intergenic
1039393709 8:37204524-37204546 TCTCAGGGAATGAGGGAAGCAGG - Intergenic
1039465639 8:37783400-37783422 TCTGGAGGAGTGAGGGAAGCAGG + Intergenic
1039616235 8:38956971-38956993 TTAGAGGGAAGGAGGGAGGCAGG + Intronic
1039680564 8:39730665-39730687 GGTGGGGGAAGGAGGGAGGCTGG + Intergenic
1040071568 8:43192914-43192936 TGCGGGGGAATAAAGGAGGCAGG + Intronic
1042054392 8:64748559-64748581 TAAGGGAGAGTGTGGGAGGCAGG - Intronic
1042453799 8:68977019-68977041 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1044148279 8:88744076-88744098 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1044810222 8:96053071-96053093 TTACAGGGAATGGGGGAGGCAGG + Intergenic
1045043169 8:98246811-98246833 GCAGGGGCAAGGAGGGAGGGAGG - Intronic
1045315419 8:101039699-101039721 TCAGGGGGAAAGAGCGGTGCTGG + Intergenic
1045349978 8:101329754-101329776 GGAGTGGGAAGGAGGGAGGCAGG - Intergenic
1045428932 8:102095255-102095277 GCAGATGGAGTGAGGGAGGCAGG + Intronic
1046386112 8:113511372-113511394 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1046440247 8:114245189-114245211 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1046512314 8:115216079-115216101 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1047079600 8:121444859-121444881 GGAGAGGGAATAAGGGAGGCAGG + Intergenic
1047241729 8:123096208-123096230 TCAGGGGAAATGAGGGGTGGGGG - Intronic
1047699587 8:127435571-127435593 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1047714842 8:127586101-127586123 GCAGGAGGCAAGAGGGAGGCAGG - Intergenic
1047856637 8:128918466-128918488 TCAGGAATAATGTGGGAGGCTGG - Intergenic
1048168201 8:132082091-132082113 TCAGGAATAATGTGGGAGGCCGG + Intronic
1048445125 8:134487603-134487625 TGTGGGGGAAGGAGTGAGGCAGG - Intronic
1048508521 8:135042087-135042109 TCAGGGGGAGGCAGGCAGGCGGG + Intergenic
1048585192 8:135769012-135769034 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1048592061 8:135829521-135829543 TCAGAGGGAAAAAGGGAGGGAGG + Intergenic
1048709667 8:137195215-137195237 AGAGCGGGAAGGAGGGAGGCAGG + Intergenic
1048763972 8:137826468-137826490 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1049318141 8:141980571-141980593 TCAAGGGCAATGACAGAGGCTGG + Intergenic
1049363437 8:142225143-142225165 TCTGGGGGGAGGGGGGAGGCAGG - Intronic
1049393158 8:142382382-142382404 TCCCGGGGAATGATGGAGGTTGG - Intronic
1049429521 8:142553419-142553441 TCTGGGAGAATGAGAGAGGTGGG - Intergenic
1049481005 8:142822678-142822700 TCAGGGGGAATGAAGCAGGCTGG - Intergenic
1049549820 8:143252034-143252056 GCAGTGGGCATGAGAGAGGCTGG - Intronic
1049551189 8:143260723-143260745 TCAGGGTGACTGAGCAAGGCTGG - Intronic
1049775289 8:144401153-144401175 GCAGGGGGAGGGAGGGTGGCTGG + Intronic
1049868531 8:144955746-144955768 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1050117887 9:2279623-2279645 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1050257820 9:3812815-3812837 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1051052869 9:12952196-12952218 TCAGGAATAATGTGGGAGGCTGG - Intergenic
1051602424 9:18888653-18888675 TCAGTGGGAAAGAGGGAAACTGG + Intronic
1053020591 9:34691396-34691418 GCAGGGGGAAGAAGGGGGGCAGG - Intergenic
1053058295 9:35007546-35007568 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1053312496 9:37028378-37028400 GCAGGTGGAGTGAGGGAGGAGGG - Intronic
1055233304 9:74089512-74089534 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1055375525 9:75645522-75645544 TCAGGGGACATGATGGGGGCAGG - Intergenic
1055626998 9:78184873-78184895 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1055810289 9:80141266-80141288 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1055857440 9:80707232-80707254 TCTGGTGGGAAGAGGGAGGCTGG - Intergenic
1055996785 9:82168722-82168744 TCAGGTGTCATGAGGGAAGCTGG - Intergenic
1056060882 9:82884359-82884381 TGAGGGATAGTGAGGGAGGCTGG - Intergenic
1056061391 9:82887601-82887623 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1056261687 9:84855053-84855075 TCATGGGGAATGAGGCAGGGAGG + Intronic
1056324122 9:85462498-85462520 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1056474852 9:86944056-86944078 TCAGGGGAAAAGGGGGAGGCGGG + Intergenic
1056522683 9:87414777-87414799 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1056523951 9:87425402-87425424 AAAGGGGGAAGGAGGGAGACAGG + Intergenic
1056530477 9:87482523-87482545 GAAGGGGGAAGGAGGGAGGGAGG + Intergenic
1056883209 9:90416429-90416451 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1057026509 9:91737986-91738008 CCAGGGGTTATGAGGGAGGGAGG + Intronic
1057812304 9:98267467-98267489 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1057852280 9:98574942-98574964 TCAGAGGGATGGAGGGAGGTGGG - Intronic
1058136717 9:101315890-101315912 TGAGGCGGAATGTGGGAGGAAGG + Intronic
1058612145 9:106788856-106788878 TGAGGGATAATGAGGGAGGTTGG - Intergenic
1058612663 9:106792407-106792429 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1058985248 9:110203835-110203857 TCAGTGGGGATGAAGGAAGCGGG + Intronic
1059606468 9:115841059-115841081 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1059863221 9:118487319-118487341 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1060218799 9:121753803-121753825 TCAGGTGAAAGGAGGGAAGCAGG - Intronic
1060318233 9:122532498-122532520 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1060422983 9:123482841-123482863 CCAGGGGAAATGAGAGAGGCTGG + Intronic
1060518937 9:124283004-124283026 TCTGGGGGAACAGGGGAGGCTGG - Intronic
1060737599 9:126076273-126076295 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1060918515 9:127404993-127405015 TAAGGGGGCCTGTGGGAGGCTGG + Intronic
1060944727 9:127563221-127563243 TCAGGGGGACTAGAGGAGGCTGG + Intronic
1061217594 9:129230910-129230932 GCAGGGGGATTGCTGGAGGCCGG - Intergenic
1061330977 9:129892891-129892913 TCAGGGGGAATGGGGTGGGAGGG - Intronic
1061440524 9:130600116-130600138 AGAGGGGGAAAGAGGGAGGGAGG - Intronic
1061494245 9:130962652-130962674 ACAGAGGGACTGAGGGAGGAGGG + Intergenic
1062050529 9:134444461-134444483 GAAGAGGGAAAGAGGGAGGCAGG - Intergenic
1062050657 9:134444809-134444831 CCAGAGGGAAGGAGGGAGGAAGG - Intergenic
1062332568 9:136051135-136051157 TCAGGGGGACTAGGGGACGCTGG - Intronic
1062449155 9:136608299-136608321 GAAGGGGGAAGGAGGGAGGTAGG + Intergenic
1062588704 9:137263429-137263451 TTGGGGGGAAGGAGGGAGGGAGG - Intronic
1062613689 9:137386776-137386798 GCAGGGGTGCTGAGGGAGGCAGG - Intronic
1062613707 9:137386834-137386856 GCAGGGGTGCTGAGGGAGGCAGG - Intronic
1062613738 9:137386921-137386943 GCAGGGGTGCTGAGGGAGGCAGG - Intronic
1062613747 9:137386950-137386972 GCAGGGGTGCTGAGGGAGGCAGG - Intronic
1062613777 9:137387037-137387059 GCAGGGGTGCTGAGGGAGGCAGG - Intronic
1185858188 X:3554992-3555014 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1185991298 X:4895432-4895454 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1186291869 X:8109092-8109114 AAAGGAGGAAGGAGGGAGGCAGG - Intergenic
1186784316 X:12943679-12943701 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1187103537 X:16218841-16218863 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1187672476 X:21682167-21682189 TCCAGGGTAATGAGGGAGGCTGG + Intergenic
1188431302 X:30107404-30107426 TCAGGAATAATGTGGGAGGCTGG - Intergenic
1188463119 X:30450766-30450788 TCAGGAATAATGTGGGAGGCTGG + Intergenic
1188550402 X:31358112-31358134 TGAGGGGGAATGAGGGAAGAGGG - Intronic
1188552934 X:31381563-31381585 TCAGGAATAATGTGGGAGGCCGG - Intronic
1188748378 X:33874568-33874590 TCAGGGGGACAAAGGGAGGGAGG + Intergenic
1189839555 X:45059518-45059540 TCAGGCAGAAGGAGGGTGGCTGG + Intronic
1190397372 X:49998647-49998669 TGAGAGGGAAGGAGGGAGGGAGG - Intronic
1192202572 X:69076131-69076153 TCAGTGGGAATTTGGCAGGCAGG + Intergenic
1192366299 X:70476403-70476425 TCAGAGGGAAGGAGGGAGCTTGG + Intronic
1193886160 X:86985652-86985674 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1193941731 X:87685746-87685768 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1194293873 X:92105243-92105265 TGAGGGATAATGAGGGAGGTTGG + Intronic
1194807752 X:98350619-98350641 TAAGAGGGAATGTAGGAGGCAGG + Intergenic
1194822539 X:98526124-98526146 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1194887919 X:99340876-99340898 TCAGAGGGGAAGAGGGTGGCTGG - Intergenic
1195016824 X:100789121-100789143 TCAGGAATAATGTGGGAGGCCGG + Intergenic
1195471475 X:105235095-105235117 TCAGTTTGAATGAGGGTGGCAGG - Intronic
1195841727 X:109182269-109182291 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1195923264 X:110002908-110002930 CCAGAGGGAAGGCGGGAGGCCGG - Intronic
1196073319 X:111547775-111547797 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1196165781 X:112534464-112534486 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1196331060 X:114470614-114470636 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1196341483 X:114603154-114603176 TCAGGAATAATGTGGGAGGCCGG + Intronic
1196634993 X:117992093-117992115 CCTGAGGGAATGAGGCAGGCTGG + Intronic
1196899399 X:120368144-120368166 TAAGTGGGGATGAGGGAGGAAGG + Intronic
1196928519 X:120658019-120658041 TGAGAGGGAGTGAGGGAGGGAGG + Intergenic
1196934603 X:120717005-120717027 TCAAGAGGCATGAGGGAGCCAGG + Intergenic
1197065145 X:122225888-122225910 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1197356727 X:125444871-125444893 TGAGGAGGAATGAGGCAGTCTGG - Intergenic
1197383125 X:125769886-125769908 TCATGGGGAGGGAGGGAAGCAGG - Intergenic
1197471241 X:126867137-126867159 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1197499988 X:127230653-127230675 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1197933329 X:131715919-131715941 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1198036402 X:132805428-132805450 CCAAGGGGGATGGGGGAGGCAGG - Intronic
1199070895 X:143474392-143474414 TCAGATGGAGAGAGGGAGGCAGG - Intergenic
1199475203 X:148237321-148237343 TGAAAGGTAATGAGGGAGGCTGG + Intergenic
1199555458 X:149103344-149103366 TCAGGGGGAATGATGGGGTAGGG + Intergenic
1199838344 X:151616596-151616618 TCAGGGGGAATGACAGAGTAGGG - Intronic
1200213353 X:154356655-154356677 GAAGGGGGAAGGAGGGAGACGGG + Intronic
1200675552 Y:6143037-6143059 TCAGGAATAATGTGGGAGGCCGG - Intergenic
1200803736 Y:7410987-7411009 ACAAGGGGAATGACGAAGGCAGG - Intergenic
1201146181 Y:11066744-11066766 TGAGAGGGAAGGAGGGAGGAGGG + Intergenic
1201256345 Y:12111992-12112014 GAAGGGGGAAGGAGGGAGGAAGG - Intergenic
1201512222 Y:14777626-14777648 TGAGGGGGGAAGAGGGAGGGAGG + Intronic
1201762797 Y:17557988-17558010 AAAGGGGGAAAGAGGGAGGGAGG - Intergenic
1201838755 Y:18348001-18348023 AAAGGGGGAAAGAGGGAGGGAGG + Intergenic