ID: 915078856

View in Genome Browser
Species Human (GRCh38)
Location 1:153337478-153337500
Sequence CAGGGGGAATGAGGGAGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1648
Summary {0: 1, 1: 0, 2: 5, 3: 170, 4: 1472}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915078847_915078856 2 Left 915078847 1:153337453-153337475 CCAATGGAGTGCTGGTAAACTAG 0: 1
1: 0
2: 1
3: 16
4: 92
Right 915078856 1:153337478-153337500 CAGGGGGAATGAGGGAGGCAGGG 0: 1
1: 0
2: 5
3: 170
4: 1472
915078846_915078856 7 Left 915078846 1:153337448-153337470 CCTTGCCAATGGAGTGCTGGTAA 0: 1
1: 0
2: 0
3: 8
4: 101
Right 915078856 1:153337478-153337500 CAGGGGGAATGAGGGAGGCAGGG 0: 1
1: 0
2: 5
3: 170
4: 1472

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915078856 Original CRISPR CAGGGGGAATGAGGGAGGCA GGG Intronic
900149208 1:1170929-1170951 CAGGCAGAATGGGGGAGGCCTGG - Intergenic
900164851 1:1240576-1240598 CAGGGTGAATGGGGGGGGCTGGG - Intergenic
900414437 1:2528556-2528578 CAGGGGGAGGGAGGGATGGAGGG - Intergenic
900577414 1:3390152-3390174 GCGGGGGGATGCGGGAGGCAGGG + Intronic
900681653 1:3920081-3920103 GAGGGGGAAGGAGGGAGGGAGGG - Intergenic
900681784 1:3920478-3920500 AAGGGGGAGGGAGGGAGGGAGGG - Intergenic
900827382 1:4937664-4937686 CAGAGGGAAGGAAGGAGGGAGGG + Intergenic
900881684 1:5386259-5386281 CAGGGGAAAGCAGGGAAGCAGGG - Intergenic
900939228 1:5787046-5787068 AAGAGGGAAGGAGGGAGGGAGGG + Intergenic
901031975 1:6312421-6312443 GAGGGGGAGGGAGGGAGGGAGGG - Intronic
901064215 1:6486959-6486981 CATGGGGAAAGAGGGTGGGAAGG + Intronic
901202979 1:7477064-7477086 AAGGGGGTGTGAGGGAGGCCAGG + Intronic
901216916 1:7560167-7560189 AAGGGGGAATGAGGGCAGCAGGG + Intronic
901253108 1:7796672-7796694 GAGGGGGAAGAAGGGAGGCAGGG + Intronic
901264897 1:7902991-7903013 AAGAGGGAAGGAGGGAGGGAGGG - Intergenic
901395917 1:8981440-8981462 CAGGAGGAAGGAGGGAGGGAAGG - Intergenic
901519080 1:9768959-9768981 AAGGGGGAAGGAGGGAAGAAGGG + Intronic
901626960 1:10630048-10630070 CAGGGCCAGAGAGGGAGGCAGGG - Exonic
901748002 1:11387430-11387452 CATGGGGCCAGAGGGAGGCAGGG - Intergenic
901832918 1:11904696-11904718 CAGGGGAAATGGGCCAGGCATGG + Intergenic
902114089 1:14106932-14106954 GAAGGGGAAGGAGGGAGGGAGGG - Intergenic
902218591 1:14950310-14950332 CCTGGGGACTGAGGGAGGGATGG + Intronic
902262491 1:15237311-15237333 CCGTGGGACAGAGGGAGGCAGGG - Intergenic
902364115 1:15959605-15959627 CAGAGGGAAGGAGGGAGGAGAGG + Intronic
902562655 1:17287403-17287425 GAGGTGAAATGAGGGAGGTAGGG + Intergenic
902628313 1:17689502-17689524 GAGAGGGAGGGAGGGAGGCAGGG - Intronic
902719620 1:18295383-18295405 CAGGGGGAATGAGAAAAGCACGG + Intronic
902793944 1:18788038-18788060 AAGGGGGAGGGAGGGAGGGAGGG + Intergenic
902918257 1:19651633-19651655 CAGAGGGAGGGAGGGAGGCTGGG - Intronic
903007251 1:20306982-20307004 CAGGGGAGAAGAGGGAGGGAGGG - Intronic
903025707 1:20428681-20428703 CAGAGAGAAGGAGGGAGGAAGGG + Intergenic
903304651 1:22404234-22404256 GAAGGGGATGGAGGGAGGCAGGG + Intergenic
903341667 1:22658761-22658783 CAGAGGGATGGAGGGATGCAGGG + Intronic
903406773 1:23103901-23103923 AGGGGGGAAGGAGGGAGGGAGGG + Intronic
903479008 1:23639611-23639633 CAGGGGAGATCAGGGAGGAAGGG - Intronic
904043678 1:27598315-27598337 AAGGGGGCTGGAGGGAGGCAGGG + Intronic
904223169 1:28990387-28990409 GAGGGGGAAGGAGGGAGGGAGGG - Intronic
904282111 1:29427789-29427811 CAGAGGGAATGAGGGAGCCATGG - Intergenic
904299296 1:29543813-29543835 CAGGGGTAATGCAGGAGGGAGGG - Intergenic
904353620 1:29924597-29924619 CTGAGGGAAGGAGGGAGGGAGGG - Intergenic
904393041 1:30198247-30198269 CAGAGGGGATGAGAGAGACAGGG + Intergenic
904512113 1:31020050-31020072 GAAAGGGAAGGAGGGAGGCAAGG - Intronic
904629430 1:31829985-31830007 CTGTGGGAAGGAGGGAAGCAGGG + Intergenic
904842091 1:33379349-33379371 CAGGGGGGATGGGGGGGGCAGGG - Intronic
905128911 1:35737135-35737157 TAGGGGGAAGCAGGGAGGGAAGG - Intronic
905313561 1:37066837-37066859 AGAGGGGAATGAGGGAGGAAGGG - Intergenic
905363971 1:37438763-37438785 GAGGGAGAAGGAGGGAAGCAAGG + Intergenic
905901455 1:41584335-41584357 CGGGGGGAATGATGGAAGCGTGG + Exonic
905933738 1:41807445-41807467 CAGAGGGAGTGAGGGAAGGAGGG + Intronic
906091109 1:43180465-43180487 CAGGGAGCGTGAGTGAGGCAAGG + Intronic
906521567 1:46469829-46469851 CAAGGGGAACGGGGAAGGCAAGG - Intergenic
906558918 1:46739573-46739595 AAGGGGGAAGGAGGGAAGGAGGG - Intergenic
906640449 1:47438004-47438026 GCGGGGGACTGAGGCAGGCAGGG - Exonic
906642245 1:47448503-47448525 CAGGTGGGGTGAGGGAAGCAAGG - Intergenic
906646729 1:47480488-47480510 GAGGAGGAAGGAGGGATGCAGGG - Intergenic
906653188 1:47527996-47528018 CAAGGGGAAGGAGGGAGGGATGG + Intergenic
906795250 1:48691781-48691803 CAGGGGAGAGGAGGGAGGCTGGG - Intronic
906824963 1:48969591-48969613 GAGAGGGAATAAGGGAGGGAGGG - Intronic
907411645 1:54287569-54287591 CCTGGGGAAGGAGGGAGGGAGGG + Intronic
907437740 1:54460164-54460186 GATGGGGAAGGAGGGAGGGAGGG + Intergenic
907483073 1:54758030-54758052 TAGGGGGGATGAGGCAGGCTTGG + Exonic
907552084 1:55313138-55313160 GAGGGGGTATGAGGAGGGCAGGG - Intergenic
907765436 1:57405996-57406018 CAGGGGAAATGAGGCAGGGAAGG - Intronic
907835728 1:58106853-58106875 AAGGAGGAAGGAGGGAGGGAGGG - Intronic
907878555 1:58520100-58520122 AAGGGGGAAGGAGGGGAGCAAGG + Intronic
908744969 1:67367513-67367535 AAGGGGGAGGGAGGGAGGAAGGG + Intronic
909046832 1:70720626-70720648 GAGAGGGAAGGAGGGAGGGAGGG - Intergenic
909249606 1:73335000-73335022 GAGAGGGAAGGAGGGAGGGAGGG - Intergenic
909366894 1:74835191-74835213 CAGGGGGCAGGAGGTAGACAGGG - Intergenic
909387151 1:75070952-75070974 TAGGGGAAATGAGGTGGGCAGGG + Intergenic
909593265 1:77376264-77376286 CAGGGAGAATGATGGAGAGAGGG - Intronic
909647267 1:77931844-77931866 ACAGGGGAATGAGAGAGGCAAGG - Intronic
909897714 1:81094003-81094025 CGGAGGGAAGGAGGGAGGGAGGG + Intergenic
910422415 1:87080701-87080723 CAGGGGGAATGGAGGAGGGGTGG - Intronic
911679410 1:100697593-100697615 AAGAGGGAAGGAGGGTGGCAAGG - Intergenic
911939221 1:104020203-104020225 CAGGGGGGAAGAGGGAGGAGTGG + Intergenic
912000431 1:104827161-104827183 AGGGAGGAAGGAGGGAGGCAAGG - Intergenic
912308464 1:108595370-108595392 GAGAGGGAAGGAGGGAGGGAAGG + Intronic
912516638 1:110220469-110220491 CAGAGGGAGGGAGGGAGGGAGGG - Intronic
912536824 1:110380075-110380097 CAGCGGGAGGGAGGAAGGCATGG + Intronic
912651590 1:111444200-111444222 CAAGGGGCAGGAGGGAGGGAGGG + Intronic
912663874 1:111561506-111561528 TTGGGGGAAGGAGGGAGGAAGGG + Intronic
913089597 1:115467576-115467598 CTGGAGGAAGGAAGGAGGCAGGG + Intergenic
913515610 1:119603177-119603199 CTTGGGGAATGAGGGAGCTATGG + Intergenic
914245047 1:145879319-145879341 CAGGGGGGATGTGGGACGCGTGG - Exonic
914420722 1:147526364-147526386 CAGCGTGGAGGAGGGAGGCAAGG + Intergenic
914920956 1:151847214-151847236 CAGGAGGCAGGAGGCAGGCAGGG + Intergenic
914920965 1:151847241-151847263 CAGGAGGCAGGAGGCAGGCAGGG + Exonic
914920981 1:151847288-151847310 CAGGAGGCAGGAGGCAGGCAGGG + Exonic
914920990 1:151847315-151847337 CAGGAGGCAGGAGGCAGGCAGGG + Exonic
915078856 1:153337478-153337500 CAGGGGGAATGAGGGAGGCAGGG + Intronic
915103878 1:153520212-153520234 GAGGGGGAGGGAGGGAGGGAGGG + Intergenic
915163157 1:153933578-153933600 GTGGGGGAATGCGGGAGGCAGGG + Exonic
915271288 1:154755601-154755623 GAGGGGGAGGGAGGGAGGGAAGG + Intronic
915309753 1:155001136-155001158 GAGGGAGAAAGAGGGAGGGAGGG + Intergenic
915553275 1:156647196-156647218 CAGAGGGAGGGAGGGAGGGAGGG + Intronic
915993601 1:160542023-160542045 CAGGGAGAATGAAGGAGCCAAGG + Intronic
916046674 1:161005270-161005292 AAGGAGGAAGGAGGGAGGAAGGG - Intronic
916246589 1:162694353-162694375 CAGAGGGAATGTGGGAAACATGG - Intronic
916527006 1:165619912-165619934 AAGAGGGAAGGAGGGAGGAAGGG - Intergenic
916580857 1:166106719-166106741 GAGGGGGAGAGAGGGAGGGAAGG + Intronic
916804225 1:168243211-168243233 CAGGGAGAGGGAGGGAGGGATGG - Exonic
916804512 1:168245105-168245127 TAGGGGGAAAGAGGGAGGGAAGG + Exonic
917536920 1:175881068-175881090 TCTGGGGAGTGAGGGAGGCATGG + Intergenic
917598545 1:176553269-176553291 GAGGGGGGCTGAGGGAGGGAGGG + Intronic
918189609 1:182161514-182161536 AAGGGGGCAAGAGGCAGGCATGG - Intergenic
918273312 1:182924827-182924849 GTGGGGGAAGGAGGGAGGAAGGG + Intronic
918300497 1:183199480-183199502 GGGAGGGAATGAGGGAGGGAAGG - Intronic
918395859 1:184112411-184112433 CTGGGGGAAGGAGGGAAGGAAGG + Intergenic
919089023 1:192956089-192956111 CAGAAGGAAGGAGAGAGGCAGGG + Intergenic
919674326 1:200366417-200366439 CAGGGGGAATGGGGCAGGTGGGG + Intergenic
919879997 1:201895003-201895025 CTGGAGGAAGGAGGGAGGGAGGG + Intergenic
919902948 1:202057331-202057353 CTGGGGGAATGAGGTAGGTGGGG + Intergenic
919935133 1:202246092-202246114 CAGAGGGAGGGAGGGAGGGATGG - Intronic
920169740 1:204064377-204064399 GAGGGGGAGGGAGGGAGGGATGG - Intergenic
920365561 1:205446582-205446604 CAGGGGGCAGGAAGGTGGCATGG + Intronic
920693260 1:208163035-208163057 CAGGCAGAGAGAGGGAGGCATGG + Intronic
920748042 1:208647333-208647355 GAGGGGGAAGGAGGGAGGGAGGG - Intergenic
920860105 1:209698970-209698992 CTGGGAGAATGAAGTAGGCATGG - Intronic
921131991 1:212227834-212227856 GAGTGGGAAAGAGGCAGGCACGG + Intergenic
921579053 1:216873983-216874005 GAGGGGGAAGGAGGGAGGGAGGG + Intronic
921791198 1:219292573-219292595 CTGGGGAAATGAGGGCAGCAAGG - Intergenic
921929565 1:220744111-220744133 AAGAGAGAATGAGGCAGGCATGG - Intergenic
922175979 1:223198002-223198024 GGGAGGGAATGAGGGAGGAAAGG - Intergenic
922202433 1:223417181-223417203 GAGGGAGAAAGAGGGAGGGAGGG + Intergenic
922574336 1:226652159-226652181 CTGGGGGAAGGAGGGAAGGAGGG + Intronic
922696753 1:227734905-227734927 CAGGGAGGGTGAGGGAGGCCAGG - Intronic
922722756 1:227906902-227906924 TAGGAGGAGGGAGGGAGGCAAGG - Intergenic
922806295 1:228391666-228391688 CAGGGGGCATGTGGTGGGCAAGG + Intergenic
923125092 1:231027766-231027788 CAGTGGGGATGAGGGTGTCATGG - Intronic
923175486 1:231460215-231460237 CAGGGGGAATGAATGGGGAAAGG + Intergenic
923255390 1:232217509-232217531 GATGTGGATTGAGGGAGGCAGGG - Intergenic
923426065 1:233871140-233871162 CAGAGAGACAGAGGGAGGCAGGG + Intergenic
1063052597 10:2468887-2468909 CAGGGGCAGTGAGGGAGCCAGGG - Intergenic
1063100898 10:2949445-2949467 AAGGAGGAAGGAGGGAGGGAGGG + Intergenic
1063280516 10:4624825-4624847 CAGGGGCACAGAGGGAGGGAAGG - Intergenic
1063434264 10:6017971-6017993 GAGGGGGTAGGGGGGAGGCAGGG + Intronic
1063476235 10:6331099-6331121 GAGGGGGAGGGAGGGAGGGAGGG + Intergenic
1063570103 10:7207508-7207530 AAAGGGGAAAGAGGGAGGGAGGG + Intronic
1064149381 10:12849946-12849968 TGGGGGGAAGGAGGGAGGGAGGG - Intergenic
1064179532 10:13102174-13102196 CAGAGGGCAGAAGGGAGGCAAGG + Intronic
1064641653 10:17421213-17421235 CAGGGGGCTTGAGGCTGGCATGG - Intronic
1064926621 10:20576406-20576428 CAGGAGGAATGAGAGACACATGG + Intergenic
1064999732 10:21327656-21327678 CAGGAGGAAAGAGGGAGGGTGGG - Intergenic
1065182682 10:23142743-23142765 CAGGAGGAAGGAGAGAGGGAGGG + Intergenic
1065242274 10:23718824-23718846 GAGAGGGATTGAGGGAGGGAGGG + Intronic
1065245041 10:23748157-23748179 GAGAGGGAGTGAGGGAGGCTGGG - Intronic
1065246014 10:23758648-23758670 AAGGGGGAGGGAGGGAGGGAGGG - Intronic
1065360628 10:24885975-24885997 CAGGGGTTAGGTGGGAGGCAGGG + Intronic
1065679456 10:28213857-28213879 CAGAGGGAATGAAGGATCCAGGG + Intronic
1065747523 10:28855841-28855863 TAGAGGGAAGGCGGGAGGCAGGG + Intronic
1065819544 10:29512788-29512810 CAGGAGGCAGGAGGGCGGCAAGG - Exonic
1065856962 10:29838853-29838875 AAGGGGGAAGGGGGGAGGGAGGG + Intergenic
1066016235 10:31246667-31246689 GAGGAGGAAGGAGGGAGGCAAGG - Intergenic
1066569403 10:36754410-36754432 GAGGGGGAAGGAAGGAGGGAGGG + Intergenic
1066728913 10:38419121-38419143 CGGAGGGAAGGAGGGAGGGAGGG - Intergenic
1067102032 10:43340792-43340814 CAGTGGGAATGCAGGAAGCACGG + Intergenic
1067230195 10:44400974-44400996 AAGGGGGAGGGAAGGAGGCAGGG - Intergenic
1067803213 10:49374444-49374466 CAGGGGGAGGAAGGGAGTCATGG - Intronic
1067991286 10:51215554-51215576 CAGGGGGCATGGAGGAGGAAGGG + Intronic
1068083270 10:52346539-52346561 CACGGGGCATGGGGGATGCAGGG - Intergenic
1068650454 10:59516900-59516922 CTGGGAGAATGAAGGAGGGAAGG - Intergenic
1068830675 10:61491273-61491295 CAGGGAGGGAGAGGGAGGCAGGG + Intergenic
1068895523 10:62195597-62195619 CAGAGGGAATGAAGGAAGGAAGG + Exonic
1069354894 10:67573720-67573742 GAGAGGGAAGGAGGGAGGAAGGG - Intronic
1069388929 10:67911802-67911824 CCTGGGCAATGAGGGAGGGAGGG - Intronic
1069464034 10:68622241-68622263 GAGAGGGAAGGAGGGAGGGAGGG - Intronic
1069777185 10:70934008-70934030 CAGGAGGAAGAAGGAAGGCAGGG + Intergenic
1069973969 10:72198067-72198089 GAGGGGGAACGAGGAAGGGAAGG + Intronic
1070328179 10:75401222-75401244 CAGGGGGTCAGAGGGGGGCACGG + Exonic
1070562640 10:77579265-77579287 CAGGAGGGATCAGGGAGGCAGGG + Intronic
1070571444 10:77642124-77642146 CAGGGAGTAGGAAGGAGGCATGG + Intergenic
1070637108 10:78137834-78137856 CAGGGGGAGACAGGGAGGGAGGG - Intergenic
1070661783 10:78311748-78311770 CAGAGGGAGGGAGGGAGGAAGGG - Intergenic
1070762835 10:79035469-79035491 CATGGGGATTGGAGGAGGCAAGG - Intergenic
1070768869 10:79070840-79070862 CAGCGGGAGGGAGGGAGGGAGGG - Intronic
1071256799 10:83878629-83878651 CAAGGGAGATGAGGGAGGCCAGG - Intergenic
1071988579 10:91076905-91076927 AAGGGGGAAGGAGAGAGGGATGG - Intergenic
1072200162 10:93150860-93150882 AGTGGGGAATGAGGCAGGCAGGG + Intergenic
1072255069 10:93613309-93613331 CCGGGGGAATGTGGGTGGCAGGG + Intronic
1072286461 10:93920604-93920626 GAGGGGGAAAGAGGCAAGCAAGG + Intronic
1072288431 10:93939786-93939808 AAGAGGGAAAGAGGGAGGGAGGG - Intronic
1072531952 10:96327918-96327940 CATGGAGAAAGAGGGAGTCAAGG - Intronic
1072684876 10:97530343-97530365 CAGGGGGAATGCTGGAGCCCAGG + Intronic
1072740536 10:97906486-97906508 CAGGCGGGAGGAGAGAGGCAAGG - Intronic
1072887118 10:99287491-99287513 CAGTGGGTGTGAGGGTGGCAGGG + Intergenic
1072897173 10:99376979-99377001 AAGGGGGAGGGAGGGAGACAGGG - Intronic
1073352785 10:102831710-102831732 GAGTGGGAATGAGGGAGTAAAGG - Intronic
1073471869 10:103727524-103727546 AAGGGAGAAGGAGGGACGCAGGG + Intronic
1073597690 10:104817335-104817357 GAGGGGGGAGGAGGGAGGCAGGG - Intronic
1073649753 10:105345582-105345604 AAGGGGGCATGAGGGAGGGATGG - Intergenic
1073797717 10:107006205-107006227 CAGCAGGAGAGAGGGAGGCATGG + Intronic
1073849299 10:107595796-107595818 CAAGGGGAATGATGGAAGAAAGG + Intergenic
1073917957 10:108428017-108428039 GAGGGGGAGGGAGGGAGGGAAGG - Intergenic
1074059389 10:109950988-109951010 CAGGAGTAGTGAGGGAGACAAGG + Intronic
1074105616 10:110387832-110387854 GAAGGGGAATGGGGGAGGCAAGG + Intergenic
1074157264 10:110810029-110810051 CAGAGGGATGGAGGGAGGGAAGG - Intronic
1074190206 10:111128899-111128921 CAGGGGGCAGGGGGGAGGAAGGG - Intergenic
1074430538 10:113390565-113390587 AAGTGGGCATGAGGGAGTCAGGG - Intergenic
1074454856 10:113588113-113588135 CAGGGGGTGTCAGGGAGGGATGG - Intronic
1074465796 10:113680033-113680055 CGGCAGGAAGGAGGGAGGCAAGG - Intronic
1074689441 10:115991062-115991084 AAGGGGGATTGAGGCAGGGATGG + Intergenic
1074735387 10:116425831-116425853 CTCATGGAATGAGGGAGGCAGGG + Intergenic
1074753334 10:116607507-116607529 CAGGGAGTAGGAGGGAGGAAGGG + Intronic
1074829971 10:117241275-117241297 CCGGGGGAGGCAGGGAGGCAGGG + Intronic
1074913316 10:117932003-117932025 CAGGGGGGATGTTGGAGGCCTGG + Intergenic
1074942436 10:118248439-118248461 AAGGGGGAGGGAGGGAGGGAAGG + Intergenic
1074964081 10:118473436-118473458 CAGAGGGGAGGAGGGAGGGAGGG - Intergenic
1075008290 10:118846158-118846180 CATGGGGAAAAAGGGAGGCTAGG + Intergenic
1075084957 10:119408682-119408704 CAGGGGGCACGTGGGAGGGAGGG + Intronic
1075132036 10:119748480-119748502 CAGGAAGAATGAGGTATGCAAGG + Intronic
1075161672 10:120029660-120029682 AAGGGGGAAGGAGGGGGGGAGGG + Intergenic
1075281036 10:121138621-121138643 CGGGGAGAAAGATGGAGGCAAGG - Intergenic
1075535074 10:123264188-123264210 CAGGGAGGCTGAGGGGGGCAGGG + Intergenic
1075878899 10:125832699-125832721 CAGGGGGAATGCTTGAGGCCAGG + Intronic
1075934859 10:126331717-126331739 CATGGGGAAGGAAGGAGGGAGGG + Intronic
1076001482 10:126916636-126916658 CAGAAGGAATGAGGGAAGAAGGG - Intronic
1076465972 10:130681810-130681832 CAGGGGCAGAGAGTGAGGCATGG + Intergenic
1076496182 10:130899238-130899260 CCGGGGGAAGGAAGCAGGCATGG - Intergenic
1076523333 10:131094719-131094741 AAGGGGGAAGGAGGGAGAGAAGG - Intronic
1076564335 10:131387794-131387816 TTGGGGGAGGGAGGGAGGCATGG - Intergenic
1076597593 10:131634930-131634952 CAGAGGGAGGGAGCGAGGCATGG + Intergenic
1076602720 10:131669464-131669486 CTGTGTGCATGAGGGAGGCAAGG + Intergenic
1076778082 10:132709254-132709276 GAGGGGGATGGAGGGAGGGAGGG + Intronic
1076817189 10:132920771-132920793 CAGGGGCAGTGAGGGCGGCACGG - Intronic
1076817584 10:132922449-132922471 CCGGGGAAGTGAGGGAGGCTGGG - Intronic
1076835067 10:133016884-133016906 CAGCGGGAAGGAAGGAGGGAAGG - Intergenic
1077272219 11:1686727-1686749 AAGGAGGGAGGAGGGAGGCAGGG - Intergenic
1077272305 11:1686989-1687011 AAGGAGGGAAGAGGGAGGCAGGG - Intergenic
1077463540 11:2722785-2722807 TAGAGGGAAGGAGGGAGGAAGGG - Intronic
1077908590 11:6555182-6555204 GAGAGGGAATGAGGGAGGAGAGG - Intronic
1078488566 11:11747695-11747717 CAGAGGGAAGGAGGGAGGGAGGG + Intergenic
1078525851 11:12100720-12100742 CAGGAGGGATGGGGGAGGAACGG + Intronic
1078579475 11:12527292-12527314 CAGAGGAAAGGAGGGAGGGAGGG + Intronic
1078755403 11:14204192-14204214 CACAGGGACTGAGGGAGGAAGGG + Intronic
1078807933 11:14725457-14725479 AAGGGGGACAGAGGGAGGAAAGG - Intronic
1078901011 11:15642929-15642951 CAGAGTGCATGAGGAAGGCATGG + Intergenic
1079110887 11:17604519-17604541 GACGGCGGATGAGGGAGGCAGGG - Intronic
1079501514 11:21105911-21105933 GGGAGGGAATGAGGGAGGGAAGG - Intronic
1079601392 11:22316216-22316238 CACGGGGAGAGAGAGAGGCAGGG - Intergenic
1080170958 11:29302052-29302074 AAGGGGGAGGGAGGGAGGGAGGG + Intergenic
1080365578 11:31570358-31570380 GAGAGGGAAGGAGTGAGGCAAGG + Intronic
1080645980 11:34187847-34187869 CTGAGGGAAGGAGGGAGGGATGG + Intronic
1081125615 11:39317353-39317375 GAGAGGGAAAGAGGGAGGGAGGG + Intergenic
1081462524 11:43285013-43285035 CAGGGGGGAAGAAAGAGGCAGGG - Intergenic
1081467530 11:43336152-43336174 AAGGGTGAATGAGAGAGGAATGG - Intronic
1081531077 11:43959729-43959751 CAGGGAGATTCAGGCAGGCAGGG + Intergenic
1081701147 11:45153525-45153547 CAGTGGACATGGGGGAGGCATGG + Intronic
1081714065 11:45236109-45236131 CTGGGGAAAAGAGGGAGGAAGGG - Intergenic
1081734012 11:45391070-45391092 CAGGGAGGAAGGGGGAGGCAGGG + Intergenic
1081782429 11:45722409-45722431 CAGGGGGAATGGGGAGGGGACGG + Intergenic
1082763473 11:57148421-57148443 CTGGGGGTATGGGGAAGGCAGGG - Intergenic
1082983512 11:59145281-59145303 GAGGGGGAAGGAGAGAGGGAAGG + Exonic
1083188766 11:61034761-61034783 CAGGGGGCCTGAGAGGGGCAAGG - Intergenic
1083332462 11:61905331-61905353 CATGCAGAATGAGGGAGGCTGGG + Intronic
1083446477 11:62710965-62710987 CAGTGGGGGTGAGGGAGGCAAGG - Intronic
1083470673 11:62881768-62881790 AAGGGGGAGAGAGGGAGGCAAGG - Intronic
1083641659 11:64148974-64148996 CCCAGGGAATGACGGAGGCAGGG - Intronic
1083656200 11:64230853-64230875 CAGGGGCAGTAAGGGCGGCATGG - Exonic
1083679097 11:64343062-64343084 CAGGGTGGGGGAGGGAGGCAGGG + Intronic
1083680485 11:64349475-64349497 GGGGAAGAATGAGGGAGGCAGGG + Intronic
1083852663 11:65377143-65377165 CAAGAGGAAGGAGGCAGGCAGGG + Intronic
1084123505 11:67083377-67083399 TAGGAGGAGTGAGGGAGGGAGGG - Intergenic
1084148514 11:67277506-67277528 CAGGGGCAAGGAGGCACGCAGGG - Intronic
1084357892 11:68651730-68651752 CAGAGGGAGGGAGGGAGGGAGGG + Intergenic
1084533941 11:69745909-69745931 AATGGGGAATGAAGGAGGGAGGG + Intergenic
1084568458 11:69944819-69944841 CTGGAGGAAGGAGGGAGGCGGGG - Intergenic
1084928654 11:72535879-72535901 GAGAGGGAAGGAGGGAGGGAAGG + Intergenic
1085074455 11:73577855-73577877 CACTGGGCATGAGGGAGGGAAGG + Intronic
1085250485 11:75140497-75140519 CTGGGGGAGTGAGGGCGGTAGGG - Intronic
1085264689 11:75230379-75230401 AAGAGGGAAAGAGGGAGGGAGGG - Intergenic
1085383288 11:76140065-76140087 GAGGGGGAGGGAGGGAGGGAGGG - Intronic
1085402545 11:76243404-76243426 CAGGATGCATGAGGGAGGGAGGG + Intergenic
1085806654 11:79643033-79643055 CAGAGGGAGAGAGGGAGGGAGGG + Intergenic
1085911529 11:80832490-80832512 CGGGGGGAAACAGGGAGACACGG + Intergenic
1085984468 11:81768872-81768894 GTGTGGGAATGAGAGAGGCAGGG + Intergenic
1086343049 11:85866911-85866933 AAGGGAGGGTGAGGGAGGCAGGG + Intronic
1087093976 11:94303012-94303034 CAGGTGGAGGGAGGGAGGGAGGG - Intergenic
1087302719 11:96454843-96454865 CAAGGGGAGGCAGGGAGGCAAGG - Intronic
1088173026 11:107018538-107018560 AAGGGAGAAGGAGGGAGGCAGGG - Intergenic
1088209851 11:107442860-107442882 GAGAGGGAAGGAGGGAGGGAGGG + Intronic
1088480368 11:110291329-110291351 CAGAGAGAAGGAGGGAGACAGGG + Intronic
1088911426 11:114195401-114195423 CAGAGAGACTGAGGGAGTCAGGG + Intronic
1088935466 11:114395414-114395436 CTGGGGGAATTAAGGAGGAAAGG + Intronic
1088989049 11:114935579-114935601 GAGGGGGAAAGAAGGAAGCAGGG + Intergenic
1089610382 11:119665353-119665375 GAGGGGGTGGGAGGGAGGCAGGG + Intronic
1089633489 11:119797628-119797650 CAGGAGTGATGAGGAAGGCAGGG - Intergenic
1090026048 11:123168491-123168513 CACGGGGAATGAGGAAGCCTTGG + Intronic
1090077424 11:123588038-123588060 AAGGGAGACTGAGGCAGGCATGG - Intronic
1090093482 11:123721483-123721505 TAGGGGCACTGAAGGAGGCAAGG + Intergenic
1090238241 11:125164973-125164995 CAGCAGGGAGGAGGGAGGCAGGG + Intronic
1090386368 11:126359747-126359769 CACGGGGAAGGAGGGAAGGAGGG - Intronic
1090488005 11:127132167-127132189 GGGGGGGAGTGAGGGAGGGAGGG - Intergenic
1091113805 11:132995453-132995475 CAGAGGGAAGAAGGGAGGGAGGG - Intronic
1091239727 11:134044320-134044342 CAGGGGGAATTGGGGTGGCATGG - Intergenic
1091860506 12:3777236-3777258 CAGAGGGAAGGAAGGAGGGAAGG + Intergenic
1092004629 12:5058888-5058910 CAGGGTGAATGAGCCAGGCAAGG - Intergenic
1092047454 12:5442157-5442179 CAGGGAGAACAAGGGAAGCAAGG + Intronic
1092588594 12:9926578-9926600 TTGGGGGAATGAGGAAGGAAAGG + Intronic
1092608565 12:10147709-10147731 AAGGGGGAGGGAGGGAGGAAGGG - Intergenic
1092799075 12:12145518-12145540 AAGGGGGAGGGAGGGAGGGAGGG - Intronic
1092867362 12:12775281-12775303 CAGGGGTTAGGAGGGAGGGAGGG + Intronic
1093141309 12:15513258-15513280 GAGGGGGAAGGAAGGAGGGAGGG + Intronic
1093141636 12:15516572-15516594 CAGGGGGAGGGAGGAAGGAAGGG + Intronic
1094012208 12:25821226-25821248 CAGGAGGACTGAATGAGGCAAGG - Intergenic
1094165560 12:27439137-27439159 CAGAGACAATTAGGGAGGCAGGG + Intergenic
1094201073 12:27794998-27795020 CAGGGGGACTGAGGGGCCCATGG - Intronic
1094222516 12:28009488-28009510 CAGGGAGAGGGAGGGTGGCAGGG + Intergenic
1094476290 12:30843245-30843267 CAGGAGGGGTGAGGGAGGCAAGG + Intergenic
1094524597 12:31223181-31223203 CTGAGTGAATGAGGGAGGGAGGG + Intergenic
1094817677 12:34203930-34203952 AAGGGGGAAAGAGGGAGGGAGGG - Intergenic
1095405430 12:41862124-41862146 CAGGTGGAATGAGCGAAGCAGGG - Intergenic
1095560347 12:43557349-43557371 CAGGGGGAAAGAGGGGGAAATGG - Intergenic
1095638108 12:44455514-44455536 CAGGGGGATTAGGGGCGGCACGG - Intergenic
1095700902 12:45190026-45190048 AAGAGGGAAGGAGGGAGGGAGGG - Intergenic
1095700915 12:45190062-45190084 AAGAGGGAAGGAGGGAGGGAGGG - Intergenic
1095897507 12:47294719-47294741 CAGGGGAAAGGAGGGAGGAATGG - Intergenic
1095946427 12:47756354-47756376 AAGAGGGAAGGAGGGAGGGAGGG + Intronic
1096241643 12:49962968-49962990 CAGGAGGTGGGAGGGAGGCAGGG - Intronic
1096294595 12:50372946-50372968 AAGGAGGAAGGAGGGAGGGAGGG + Intronic
1096311410 12:50524546-50524568 CGGGAGGATGGAGGGAGGCAGGG - Intronic
1096386810 12:51199692-51199714 CCGGGGGCAGGAGCGAGGCATGG - Intronic
1096628071 12:52907327-52907349 AAGGCGGAAGGAGGGAGGGAGGG + Intronic
1096782544 12:53999527-53999549 CAGGGGCGGTGAGGGAGGGAGGG - Intronic
1096873840 12:54611958-54611980 GAGGGGGAGTCAGGGAGGAAGGG - Intergenic
1096973376 12:55684754-55684776 CAGGGTGAATGGGAGAGGAAGGG + Exonic
1096976006 12:55699609-55699631 CAGGTGGAATGAGAGGGCCAGGG - Intronic
1097055683 12:56247808-56247830 CAGGAGGAAGAAGGGAGGCAAGG + Intronic
1097721043 12:63021754-63021776 CAGGAGGAGGGAGGGAGGGAAGG + Intergenic
1097728870 12:63105180-63105202 CAGGTGCAAGGAGGCAGGCATGG - Intergenic
1098051971 12:66463725-66463747 CAAGGGGAAAGATGGGGGCAGGG + Intronic
1098289477 12:68943950-68943972 CAGGGGGAGTGTGGGAAGAAGGG + Intronic
1100209221 12:92383982-92384004 CAAGGGTAATGAAGGAGGCATGG + Intergenic
1100233864 12:92637623-92637645 CAGGGGCTAGGAGAGAGGCATGG + Intergenic
1100449929 12:94696075-94696097 CAGGGGGAAGGAGGGAGAAGAGG + Intergenic
1100798743 12:98209671-98209693 GAGAGGGAAAGAGGGAGGGAGGG + Intergenic
1100821822 12:98438938-98438960 CAGGGGGATTAAGGGAAGAAGGG + Intergenic
1101209737 12:102523889-102523911 GAGAGGGAAGGAGGGAGGGAGGG + Intergenic
1101220777 12:102637572-102637594 AGGGAGGAAGGAGGGAGGCAAGG - Intergenic
1101374026 12:104155254-104155276 CAGGGGGAAAGGGGGAGGTGGGG + Intergenic
1101525312 12:105523220-105523242 CAGAGGGAGGGAGGGAGGGAGGG + Intergenic
1101659592 12:106753927-106753949 AAGGGGGACTGGTGGAGGCAGGG + Intronic
1101724614 12:107378628-107378650 CAAGGGGAATGAGGGCCGTAAGG - Intronic
1101861888 12:108489158-108489180 AAGAGGGAAGGAGGGAGGGAGGG + Intergenic
1101861894 12:108489174-108489196 GGGAGGGAATGAGGGAGGGAGGG + Intergenic
1101952414 12:109187059-109187081 AAGGGGGATGGAGGGAGGGAGGG + Intronic
1101952438 12:109187136-109187158 GAGAGGGAAGGAGGGAGGGAAGG + Intronic
1102190047 12:110980902-110980924 CATGAGGAAGGAGTGAGGCAGGG + Intergenic
1102217196 12:111169884-111169906 CAGAGGGCATGAGGGTGGCAGGG + Intronic
1102425081 12:112837862-112837884 AGGGGGGAAGGAGGGAGGGAAGG - Intronic
1102520869 12:113476898-113476920 AAGGGGGAGGGAGGGAGGGAAGG - Intergenic
1102825388 12:115944116-115944138 GAGAGGGAAGGAGGGAGCCAAGG - Intergenic
1102907374 12:116687279-116687301 CAGACGGAGGGAGGGAGGCATGG + Intergenic
1103034648 12:117646818-117646840 CTGGGGGACTGCGGGAGGGAGGG - Intronic
1103251847 12:119506638-119506660 AAGGGGGAATGGGGAAGGGAAGG + Intronic
1103269098 12:119657391-119657413 CAGGAGGAATGGGCGAGGCAAGG - Intergenic
1103501564 12:121407061-121407083 GAGGGGGAAGGAGGGAGGAAAGG - Intronic
1103521871 12:121541425-121541447 CGGAGGGAAGGAGGGAGGGAGGG + Intronic
1103792165 12:123479458-123479480 CAGGAGGAATGAAGGATGGAAGG + Intronic
1103834554 12:123808390-123808412 CAGGGGGAAGCAGGGAGACTGGG + Intronic
1103874641 12:124117319-124117341 CAGGGAGCATGAGGGGAGCACGG + Intronic
1103946959 12:124532207-124532229 AAGGGGGCATGGGGGAGACAAGG - Intronic
1104172509 12:126295854-126295876 AAGGGGGAAGGAGGGAGGGAAGG + Intergenic
1104191104 12:126482509-126482531 AGGGGGGAAGGAGGGAGGGAGGG - Intergenic
1104262170 12:127194342-127194364 CAGGGGGAAGGAGGGAAGGAGGG - Intergenic
1104610156 12:130221066-130221088 GAGGGGGAGGGAGGGAGGGATGG - Intergenic
1104675574 12:130709897-130709919 CACTGGGCAGGAGGGAGGCAGGG + Intronic
1104676015 12:130713045-130713067 GAGGAGGAATGAGGGAGGGAGGG + Intronic
1105018724 12:132802375-132802397 CAGGGGGCATGGGGGGTGCAGGG + Intronic
1105238278 13:18582833-18582855 AAGGGGGAGGGAGGGAGGGAAGG - Intergenic
1105276524 13:18933533-18933555 CAGGGAGAAAGATGGAGGCTGGG - Intergenic
1105437513 13:20391076-20391098 TTGGGGGAAGAAGGGAGGCAGGG + Intergenic
1105683271 13:22751927-22751949 AGGGGGGAATGAGGGTGGCCAGG - Intergenic
1105882949 13:24619671-24619693 CAGGGGGATTGCTGGAGGCCAGG - Intergenic
1105977034 13:25481409-25481431 GAGGAGGAATGAAGGATGCATGG - Intronic
1107044733 13:35982430-35982452 GAGGGGGAGGGAGGGAGGGAGGG + Intronic
1107400730 13:40066475-40066497 CAGAGGGAGGGAGGGAGGGAAGG + Intergenic
1107527290 13:41245879-41245901 CAGGGATAAAGAGGGAGGAAGGG - Intronic
1107993341 13:45837603-45837625 CAGAGGGAGGGAGGGAGGAAGGG + Intronic
1108242111 13:48475531-48475553 CAGGGACTCTGAGGGAGGCAGGG + Intronic
1108392105 13:49956587-49956609 GAGAGGGAAGGAGGGAGGGAAGG - Intergenic
1108430193 13:50345837-50345859 AGGGGGGAGTGAGGGAGGGAGGG - Intronic
1108463639 13:50693088-50693110 CAGGAGATAAGAGGGAGGCAAGG + Intronic
1108487364 13:50940555-50940577 GAGATGGAATGTGGGAGGCAAGG + Intronic
1109147707 13:58801853-58801875 AAAGGGGAACGAGGGAGGTAGGG + Intergenic
1109400425 13:61820362-61820384 AAGGGGGAAGGAGGGAGGGAGGG + Intergenic
1109619251 13:64880123-64880145 CAGGGGGTTTGGGGGAGGCGGGG - Intergenic
1110034776 13:70669342-70669364 CAAGGGGAAGGAGGAAGGAAGGG - Intergenic
1110161809 13:72387605-72387627 CAGGAGGAAGGATGGTGGCAAGG + Intergenic
1110622974 13:77619876-77619898 CAGAGGGACTGAGGGAGGAAAGG - Intronic
1110843220 13:80166301-80166323 CAGTGGGAAGGTGGGAAGCATGG - Intergenic
1111255145 13:85657963-85657985 AGGGGGGAAGGAGGGAGGGAAGG + Intergenic
1111446173 13:88348039-88348061 AAAAGGGAAGGAGGGAGGCAGGG + Intergenic
1111482063 13:88842531-88842553 CAGGGGGAGGGAGGGAGAGAGGG + Intergenic
1111542552 13:89688516-89688538 AAAGGGAAATGAGGGAAGCAGGG + Intergenic
1111662317 13:91226438-91226460 CTAGGGGAAGGAGGGAGGGAAGG + Intergenic
1111757762 13:92420620-92420642 AAGGGGGTGAGAGGGAGGCAGGG - Intronic
1111942853 13:94631284-94631306 CATGGGAAATGGGGGAAGCAAGG - Exonic
1112047500 13:95613002-95613024 TAGAGGGAAAGAGGGAGGGAGGG + Intronic
1112047965 13:95616673-95616695 CAGAGGCAATGGGGTAGGCAGGG + Intronic
1112138136 13:96606593-96606615 CAGAGGGAGGGAGGGAGGGAGGG + Intronic
1113024180 13:105922170-105922192 AAGAGGGAAAGAGGGAGGGAGGG - Intergenic
1113618503 13:111697402-111697424 CAGGGAGAGGAAGGGAGGCAGGG - Intergenic
1113624032 13:111782663-111782685 CAGGGAGAGGAAGGGAGGCAGGG - Intergenic
1113990423 14:16023887-16023909 CAGAGGGAGGGAGGGAGACAGGG - Intergenic
1113991166 14:16029399-16029421 CAGAGGGAAAGAGGGAGGGAGGG - Intergenic
1113991186 14:16029455-16029477 GAGAGGGAAGGAGGGAGGGAGGG - Intergenic
1114183229 14:20382315-20382337 CAGGGGGACAGTGGCAGGCAGGG + Exonic
1114266540 14:21075560-21075582 CTTGGGGACTGGGGGAGGCAGGG + Intronic
1114464364 14:22910509-22910531 AAGGGAGAAGGAGGGAGGGATGG + Intronic
1114483006 14:23047118-23047140 GAAGGGGAAAGAGGGAGGAAGGG - Exonic
1114523383 14:23352512-23352534 CAGGGGGCAGGTGGGAGGGAGGG + Intronic
1114602564 14:23968735-23968757 CCTGGGGAATAAGGGAAGCAAGG - Exonic
1114606933 14:24005864-24005886 CCTGGGGAATAAGGGAAGCAAGG - Exonic
1114634212 14:24178244-24178266 CCGGGGAAGGGAGGGAGGCAGGG + Intronic
1114778277 14:25511456-25511478 CTGGGAGTATGAGGGAGGCAGGG - Intergenic
1115074880 14:29376323-29376345 CATGGGTACTGAGGGAGGAAGGG - Intergenic
1115356555 14:32454635-32454657 GAGAGGGAAGGAGGGAGGGAGGG - Intronic
1115642112 14:35341568-35341590 CAAGGGGAATGAGGGGCCCAAGG - Intergenic
1116267885 14:42719468-42719490 CAGGGGGAATGAAGCAGGTGAGG + Intergenic
1117054081 14:51892703-51892725 CATGGGGGAGGAGGGAGGCAAGG - Intronic
1117062824 14:51980599-51980621 CAGGGAGAAAGAGGAAGGCATGG + Intergenic
1117403401 14:55378617-55378639 TAGGGGAACTGAGGGAGGGAGGG - Intronic
1117440451 14:55754324-55754346 CAGGTTGAATGATGGAGGTAAGG - Intergenic
1117450043 14:55841191-55841213 GTGAGGGAATGAGGAAGGCAGGG - Intergenic
1117453576 14:55875923-55875945 CAGGGGAAGTGAGGGTGGCTGGG - Intergenic
1117679607 14:58190068-58190090 GAGGGGGAGGGAGGGAGGGAAGG + Intronic
1117707457 14:58486090-58486112 CAGGGGGCAGGAGGGAAGAAAGG - Intronic
1117764354 14:59064860-59064882 GAGGGGGAGGGAGGGAGGGAAGG + Intergenic
1118169412 14:63372105-63372127 GTGGGGGAAGGAGGGAGGGAAGG + Exonic
1118328475 14:64797529-64797551 CAGGGGGATTGAAGGAGGGTGGG + Intronic
1118607656 14:67515280-67515302 CAGGCGGCGTGGGGGAGGCACGG - Exonic
1118992344 14:70808717-70808739 GAGGGGGAATGACGGAGGCCTGG - Intronic
1119172899 14:72547988-72548010 CAGGGGGAGGGAGGCAGGAATGG - Intronic
1119176574 14:72572869-72572891 AAGAGGGAAGGAGGGAGGGAGGG + Intergenic
1120745967 14:88152176-88152198 CAGCAGGAATGGAGGAGGCAGGG + Intergenic
1121047108 14:90796224-90796246 CAGGGGTAAAGAGGGACTCAAGG + Intronic
1121048657 14:90805596-90805618 CAGGGGTAAGGAGGGATTCAAGG + Intronic
1121092375 14:91191559-91191581 CAGGGAGAATGAGGCTGGGAAGG - Intronic
1121430931 14:93888037-93888059 CAGAGGGAGGGAGGGAAGCAGGG - Intergenic
1121454397 14:94029015-94029037 CAAGGAGATTGAGGGAGGCAGGG + Intronic
1121566841 14:94916267-94916289 GAGAGGGAAGGAGGGAGGGAAGG + Intergenic
1121576106 14:94989524-94989546 CAGAGGGAATAAGGGCTGCAAGG + Intergenic
1121578727 14:95010405-95010427 CAGAGGGAAGGAGGGAAGGAGGG + Intergenic
1121652078 14:95566122-95566144 AAAGGGGAAGGAGGAAGGCAGGG + Intergenic
1121973907 14:98385253-98385275 CAGGCTGCATCAGGGAGGCAGGG + Intergenic
1122002058 14:98666943-98666965 AAGGGGGAGAGAGGGAGGGAGGG - Intergenic
1122070477 14:99202607-99202629 GAGGGAGAGAGAGGGAGGCAGGG + Intronic
1122320415 14:100852067-100852089 CAGGGAGCACGTGGGAGGCAGGG + Intergenic
1122447829 14:101782031-101782053 AAGGGGGAGAGAGGGAGGGAGGG - Intronic
1122997130 14:105271394-105271416 CAGTGAGAATGCTGGAGGCAAGG + Intronic
1123436546 15:20258697-20258719 TAGGGGGAGGGAGGGAGGAACGG + Intergenic
1123988861 15:25668478-25668500 AAGGAGGGATGAGGGAGGGAGGG - Intergenic
1124050205 15:26190075-26190097 CAGAGTGAATGAGGGAGTCATGG - Intergenic
1124217991 15:27825448-27825470 GAGGAGCACTGAGGGAGGCAGGG + Intronic
1124233673 15:27968340-27968362 CATGGGGAATGACAGGGGCAGGG + Intronic
1124366160 15:29072810-29072832 CAGCAGGACTGGGGGAGGCAGGG + Intronic
1124622024 15:31279243-31279265 CAGGGGGTGTGAAGGAAGCAGGG - Intergenic
1125207537 15:37171374-37171396 CAGGGGTAAAGCGGGAGACAAGG + Intergenic
1125233213 15:37482048-37482070 GAGAGGGAAGGAGGGAGGGAGGG + Intergenic
1125327375 15:38549645-38549667 CAGAGGGGAAGAGGGAAGCAGGG - Intronic
1125670059 15:41465136-41465158 AAGGGGGAAGGAGGAAGGGAGGG - Intronic
1126841651 15:52723133-52723155 GAGGGGGCATGAGGTAGACAGGG + Intergenic
1126858571 15:52862164-52862186 CAGAGGGAGGGAGGGAGGGAGGG - Intergenic
1127149355 15:56057597-56057619 CATGGGGAAGGATGGAAGCATGG - Intergenic
1127507472 15:59610617-59610639 GAGAGGGAAGGAGGGAGGGATGG - Intronic
1127582363 15:60349903-60349925 CAGGGGAAGGCAGGGAGGCAGGG + Intronic
1127582370 15:60349921-60349943 CAGGGGAAGGCAGGGAGGCAGGG + Intronic
1127582377 15:60349939-60349961 CAGGGGAAGGCAGGGAGGCAGGG + Intronic
1127686481 15:61350661-61350683 CAGGGGGAAAGGGGGAGCCAGGG - Intergenic
1127776223 15:62266135-62266157 TAAGGGGAGTGGGGGAGGCAGGG - Intergenic
1127827279 15:62715843-62715865 GAGGGGGAAGGATGGAGGGAGGG - Intronic
1127827670 15:62719213-62719235 CAGGGGAAAGGAGAGAGGCACGG - Intronic
1128211977 15:65909344-65909366 CAGAGGGAGGGAGGGAGGGAAGG - Intronic
1128251198 15:66165524-66165546 CAGAGGTAATGAGAGAGGAAGGG - Intronic
1128441027 15:67708670-67708692 CAGGAGGAAGAAGGCAGGCAAGG - Intronic
1128446021 15:67761253-67761275 CAAAGGGAAAGAGGGAGGGAGGG - Intronic
1128498076 15:68209585-68209607 CAGGGGCACTGAGAGAGCCACGG - Intronic
1128512237 15:68320422-68320444 CAGATGGAATGAGGAAAGCAGGG + Intronic
1128581203 15:68811370-68811392 CAAGGGAACTGAGGGAGGGATGG + Intronic
1128698196 15:69784654-69784676 AAGGAGGAATGAGAGAGGGAAGG - Intergenic
1128733593 15:70036945-70036967 CAGGTGGAGGGAGGGAGGAAGGG - Intergenic
1128740975 15:70083520-70083542 GAGGGGGAAGGAGAGAGGGAAGG - Intronic
1129069142 15:72936739-72936761 CTGGGGGTATGAGGGATGAAGGG - Intergenic
1129182605 15:73886682-73886704 CAGGAAGAAAGGGGGAGGCAAGG - Intronic
1129379654 15:75157015-75157037 CAGGGGAGATGTGGGAGGCAAGG - Intergenic
1129426457 15:75467039-75467061 TGGGAGGGATGAGGGAGGCAGGG - Exonic
1129453239 15:75662474-75662496 CAGGGGAAAGGCAGGAGGCAGGG - Intergenic
1129716951 15:77857742-77857764 CGGGGGGCAGGAGGGAGGCAGGG + Intergenic
1129933120 15:79428488-79428510 AAGGAGGAAGGAGGGAGGGAGGG - Intergenic
1130024877 15:80262268-80262290 CAGTGGGGGAGAGGGAGGCAGGG + Intergenic
1130090346 15:80815599-80815621 GAGAAGGAATGAGGGAGGGAAGG - Intronic
1130398244 15:83523735-83523757 GAGAGAGAAGGAGGGAGGCAGGG - Intronic
1130683574 15:86017691-86017713 ATGGGGGAGGGAGGGAGGCATGG - Intergenic
1131112561 15:89774720-89774742 CAGGGTGAATGAGCTAGTCATGG - Intronic
1131253134 15:90844064-90844086 AAGGAGGGAGGAGGGAGGCATGG - Intergenic
1131311383 15:91293638-91293660 CATGGGGACTGAGGGAAGGATGG + Exonic
1131366519 15:91846361-91846383 GAGAGGGAAGGAGGGAGGGAGGG - Intergenic
1131476879 15:92747322-92747344 CAGAGAGAAGGATGGAGGCAGGG - Intronic
1131671267 15:94621941-94621963 CAGGGAGAATATGAGAGGCAAGG + Intergenic
1131938999 15:97539847-97539869 GAGAGGGAAGGAGGGAGGGAGGG + Intergenic
1132209246 15:100008085-100008107 CAGGGGGAAGCAGGGATGGATGG + Intronic
1132234252 15:100207201-100207223 GAGAGGGAAAGAGGGAGGGAGGG - Intronic
1132291367 15:100705994-100706016 CAGGGTGAATGAGGAAGGGGAGG + Intergenic
1132364732 15:101249192-101249214 CAGGGGGCATGGGGGAGATAAGG + Intronic
1132475990 16:138390-138412 CAGGGGGCCTGAGGAGGGCAGGG + Exonic
1132578841 16:676028-676050 CGGGGGGAGGGAGGGAGGGAGGG + Intronic
1132664593 16:1075858-1075880 TAGGGGGAGAGAGGGAGGGAGGG - Intergenic
1132689090 16:1174510-1174532 CATGGGGAGGGAGGGAGGGAAGG + Intronic
1132719161 16:1307470-1307492 GTGGGGGAATGAGTGAGGGAGGG + Intergenic
1132719277 16:1307982-1308004 GGGAGGGAATGAGGGAGGGAGGG + Intergenic
1132719298 16:1308093-1308115 GAGTGGGAATGAGTGAGGGAGGG + Intergenic
1132719331 16:1308265-1308287 GAGAGGGAATGAGTGAGGGAGGG + Intergenic
1132732062 16:1367496-1367518 GAGGGGGAGGGAGGGAGGGAGGG - Intronic
1132880873 16:2161195-2161217 CAGGGGGACGGAGGGAGGGAGGG - Intronic
1132995007 16:2818264-2818286 GAGGGGGGATGAGGGTGGGATGG - Intronic
1133026159 16:2989796-2989818 GAGAGGGAAGGAGGGAGGGAAGG + Intergenic
1133026346 16:2990504-2990526 CAGGAGGAGGGAGGCAGGCAGGG - Intergenic
1133039415 16:3052469-3052491 CAGGGGGTAGGATAGAGGCAGGG + Intronic
1133043258 16:3072102-3072124 CAGGGGGTAGGATAGAGGCAGGG + Intronic
1133366723 16:5216147-5216169 CAGGAGGAATGTGGGAGGGTTGG + Intergenic
1133384299 16:5356216-5356238 CAGGAGCCAGGAGGGAGGCATGG + Intergenic
1133392679 16:5422527-5422549 AAGGGCGCATGAGGGGGGCAGGG + Intergenic
1133518277 16:6531152-6531174 GAGTGGGAATAAGGGAAGCAGGG - Intronic
1133647147 16:7775125-7775147 AAGGAGGAAGGAGGGAGGGAAGG + Intergenic
1133927326 16:10203821-10203843 GAGAGGGAAGGAGGGAGGGAGGG + Intergenic
1134019452 16:10911322-10911344 AAGGGGGAAGAAGGGAGGGAGGG - Intronic
1134202528 16:12210727-12210749 GGGAGGGAATGAGGGAGGGAGGG - Intronic
1134451772 16:14368197-14368219 CAGGGGGACGTAGGCAGGCAGGG + Intergenic
1134754800 16:16657467-16657489 AAGTGGGAAGGAGGGAGGGAGGG - Intergenic
1134820280 16:17241262-17241284 CAAGGGGAGAGAGGGAGGCCTGG + Intronic
1134991254 16:18701559-18701581 AAGTGGGAAGGAGGGAGGGAGGG + Intergenic
1135030605 16:19035279-19035301 GAGAGGGAGAGAGGGAGGCAAGG + Intronic
1135271573 16:21074231-21074253 CCTGGGGAAGGAGGGAGGCTTGG + Intronic
1135326734 16:21530895-21530917 CAGGGGTGAGGAGAGAGGCATGG - Intergenic
1135348275 16:21707751-21707773 GAGGGGGAGGGAGGGAGGGAAGG - Intronic
1135529054 16:23237031-23237053 AAGAGGGAAGGAGGGAGGGAGGG - Intergenic
1135864390 16:26087487-26087509 CTGAGGGAGTGAGGGAGGCAGGG - Intronic
1135872977 16:26169275-26169297 AAGGGGGACTAAGGGTGGCATGG + Intergenic
1135920389 16:26644086-26644108 AAGGGAGAAGGAGGGAGGAAGGG - Intergenic
1136114135 16:28083963-28083985 GCAGGGGAATGAGGGAGCCATGG + Intergenic
1136253874 16:29025263-29025285 CAGGGGGCCTGAGGAAGACAGGG + Intergenic
1136336990 16:29616310-29616332 CAGGGGTGAGGAGAGAGGCATGG - Intergenic
1136410811 16:30076039-30076061 CGGAGTGAAAGAGGGAGGCAGGG + Exonic
1136910368 16:34140579-34140601 GAGAGGGAAGGAGGGAGGGAGGG - Intergenic
1137254813 16:46765970-46765992 GAGAGGGAGTGAGGGAGGGAGGG + Intronic
1137332620 16:47514215-47514237 CAGAGGGAGGGAGGGAGGGAAGG + Intronic
1137340118 16:47593219-47593241 AAGAGGGAAGGAGGGAGGGAGGG + Intronic
1137351729 16:47719211-47719233 CATGTGGAGTGAGGGAGGAAGGG - Intergenic
1137465256 16:48702691-48702713 AAGGGGGAGGGAGGGAGGAAGGG - Intergenic
1137466422 16:48713962-48713984 AAGGGGGAGGGAGGGAGGAAGGG - Intergenic
1137619961 16:49869677-49869699 AAGGGGGAAACAGGGAAGCAGGG - Intergenic
1137776678 16:51060747-51060769 AAGGGAGAAGGAGGGAGGGAGGG + Intergenic
1137784299 16:51125195-51125217 CAGAGGGAAGGTGGGAGGGAGGG + Intergenic
1138038015 16:53627552-53627574 ATGGGGGAATGAGGAAGGGAGGG - Intronic
1138288900 16:55830848-55830870 AAGTGGGAGTGAGGGAGGGAGGG + Intronic
1138458809 16:57135966-57135988 AAGGGAGAAGGAGGGAGGGAAGG + Intronic
1138536730 16:57664164-57664186 CTGGGGGGCTGAGGGAGGGAGGG - Exonic
1139210083 16:65068220-65068242 AAGAGGGAAGGAGGGAGGAAGGG + Intronic
1139303091 16:65961919-65961941 GAGAGGGAGGGAGGGAGGCAGGG + Intergenic
1139303134 16:65962053-65962075 GAGAGGGAGGGAGGGAGGCAGGG + Intergenic
1139375768 16:66495445-66495467 CAGGAGGGAGGTGGGAGGCAGGG - Intronic
1139375793 16:66495532-66495554 CAGGAGGGAGGTGGGAGGCAGGG - Intronic
1139495511 16:67314228-67314250 GAGGGGGAAGGAGGGAGGGAGGG - Intronic
1139965066 16:70740782-70740804 GGTGAGGAATGAGGGAGGCAGGG + Intronic
1140018688 16:71215269-71215291 GAGGGGGAAGGAAGGAGGGAGGG + Intronic
1140257494 16:73349703-73349725 GAGAGGGAAGGAGGGAGGGAGGG - Intergenic
1140686478 16:77438315-77438337 CAGAGGGAGGGAGGGAGGGAGGG + Intergenic
1140695985 16:77534555-77534577 GTGAGGGAATGAGGAAGGCAGGG + Intergenic
1140781432 16:78300487-78300509 GAGAGGGAAGGAGGGAGGGAGGG - Intronic
1140857486 16:78990710-78990732 AAGGAGGAAGGAGGGAGGGAGGG + Intronic
1141434215 16:83990009-83990031 CAGGAGGAAGGAGGGAGGGAAGG + Intronic
1141547995 16:84785229-84785251 CAGGAGGAATGAGGCAGAGACGG - Intergenic
1141732887 16:85834261-85834283 GAGAGGGAAGGAGGGAGGGAAGG + Intergenic
1141992451 16:87618308-87618330 CAGGAGGAGGGAGGGAGGCCGGG + Intronic
1142039785 16:87885645-87885667 CAGGGGTGAGGAGAGAGGCATGG - Exonic
1142411456 16:89919123-89919145 CAGATGGAAGGAGGCAGGCATGG + Exonic
1142469487 17:155442-155464 GAGGGGGAATGACAGAGGGATGG - Intronic
1142582052 17:949031-949053 CAGGGGGAGAGGAGGAGGCAGGG - Intronic
1142613838 17:1123965-1123987 CGGGGGGCAGGTGGGAGGCAAGG - Intronic
1143014441 17:3884142-3884164 AGGAGGGACTGAGGGAGGCATGG - Intronic
1143278344 17:5731283-5731305 CAGGGGGAAGGAGGGAGGAGGGG - Intergenic
1143373781 17:6455692-6455714 CAGGGGGAAGAAGGGAGGGGAGG + Intronic
1143375260 17:6463429-6463451 GGGAGGGAAGGAGGGAGGCAGGG + Intronic
1143413103 17:6724184-6724206 CAGGTAGAGTGAGTGAGGCAGGG - Intergenic
1143594983 17:7908828-7908850 AGGTGGGAATGAGGGAGGAAAGG + Exonic
1143598801 17:7930942-7930964 CAGGGGAGATGAGGGAGTCTTGG + Intronic
1143628148 17:8122491-8122513 CAGGGGGAAGAAGGGAGGGACGG + Intronic
1143830880 17:9649522-9649544 CAGAAGGAAGGAGGGAGGCAGGG - Intronic
1143869768 17:9949809-9949831 AAGAGGGAAAGAGGGAGGGAAGG - Intronic
1144185200 17:12789986-12790008 CAGGGGAAAGGACTGAGGCAAGG - Intronic
1144247762 17:13384365-13384387 GAGAGGGAAGGAGGGAGGGAGGG + Intergenic
1144563821 17:16343758-16343780 CAGGGGAGGTGGGGGAGGCAGGG - Intronic
1144786532 17:17835408-17835430 CAGGGGGAAGGAGGGAGGGCTGG + Intronic
1145007385 17:19345227-19345249 CAGAGGCCATGAGGTAGGCAGGG + Intronic
1145057126 17:19710092-19710114 CAGGGGGAATGTTTGGGGCAAGG - Intronic
1145097377 17:20042352-20042374 CATGGGGGAAGAGGGAGGAAAGG + Intronic
1145242812 17:21249548-21249570 CAGGGGTGCTGAGGGAGGCCAGG + Intronic
1145783719 17:27580700-27580722 CGGGAGGGAGGAGGGAGGCAGGG + Intronic
1145786240 17:27595683-27595705 AAGGGAGAATGTGGGGGGCAGGG - Intronic
1145827863 17:27890921-27890943 GAGAGGGACTGGGGGAGGCAGGG - Intronic
1145982904 17:29024664-29024686 CTGGGGGAGGGAAGGAGGCAAGG + Intronic
1146026670 17:29327480-29327502 GAGAGGGAGGGAGGGAGGCAAGG + Intergenic
1147182172 17:38693324-38693346 CAGGGCCAAGGATGGAGGCAGGG + Intergenic
1147190464 17:38735348-38735370 AAGGGGGAGTGGGGGAGGTAGGG + Exonic
1147318472 17:39632268-39632290 CAGGAGGCATGAGGGAGGTGGGG + Intronic
1147363358 17:39944850-39944872 TAGGGGGAATAAAGGAGGGAGGG - Intergenic
1147562517 17:41517853-41517875 CAGGGTGCATGAGGTAGGGAGGG + Intronic
1147571388 17:41573244-41573266 CAGAGGGAATGGGAGAGGCAGGG - Intergenic
1147727377 17:42574703-42574725 GAGGGGGAAGGAGGGAGGGAGGG - Intronic
1148177500 17:45580013-45580035 CAGGCAGATTGAGGGAGGGAGGG - Intergenic
1148432191 17:47650721-47650743 GAGGGAGAAAGAGGGAGGGAAGG + Intronic
1148478331 17:47943684-47943706 ATGGGGAGATGAGGGAGGCAAGG - Intronic
1148488567 17:48007776-48007798 CAGTAGGAATGAGGAAGACATGG - Intergenic
1148860332 17:50601224-50601246 CAGGACCAGTGAGGGAGGCAAGG + Intronic
1149079248 17:52633600-52633622 AAAGGGGAAAGAAGGAGGCATGG - Intergenic
1149148545 17:53530650-53530672 AAGGGGGAAGGAGGGAGAGAGGG + Intergenic
1149283713 17:55137279-55137301 CAGAGGGAGGGAGGGAGGGAGGG - Intronic
1149592237 17:57838957-57838979 CTGGGGAAACGAGGAAGGCAGGG + Exonic
1149913244 17:60585338-60585360 CAGGGGGCGGGAGGGTGGCAGGG + Intronic
1149921181 17:60660825-60660847 AAAGGGAAATAAGGGAGGCAGGG - Intronic
1149928982 17:60731015-60731037 AAAGGAGAATGTGGGAGGCATGG - Intronic
1150129869 17:62663202-62663224 AGGAGGGAATGAGGGAGGGAGGG - Intronic
1150223003 17:63507796-63507818 CCTGGGGCAGGAGGGAGGCAGGG + Intronic
1150227900 17:63533742-63533764 CAGAGGGGATGAGGGAGAGATGG - Intronic
1150519180 17:65848551-65848573 AAGGGGGAAAGAGGCAGGGAGGG - Intronic
1150519538 17:65852179-65852201 GAGAGGGAAAGAGGGAGGGAAGG - Intronic
1150519548 17:65852210-65852232 GAGAGGGAAAGAGGGAGGGAAGG - Intronic
1150519648 17:65852477-65852499 GGGAGGGAATGAGGGAGGGAAGG - Intronic
1150689587 17:67353293-67353315 CGGGGGGAAGGAGGAAGGGAAGG - Intronic
1150820997 17:68434284-68434306 CAGGAGAAATGAGAGAGCCAGGG - Intronic
1151050940 17:70978330-70978352 AAGGAGGAAGGAGGGAGGGAGGG + Intergenic
1151163921 17:72188161-72188183 GAGAGGGAAGGAGGGAGGGAGGG + Intergenic
1151242697 17:72770519-72770541 GAGGGGGAAGGAAGGAGGCCTGG - Intronic
1151443133 17:74146558-74146580 CAGGGGAAATGGTGGGGGCAGGG - Intergenic
1151467429 17:74296359-74296381 AAGGGGGAAGGAGGGAGGGAGGG + Intronic
1151961479 17:77408098-77408120 CTGGGGGCAAGAGGGAGGCCAGG + Intronic
1152068536 17:78124277-78124299 CAGGGGCAGTGAGGGAAACAGGG + Intronic
1152224713 17:79087370-79087392 GTGGGGGCGTGAGGGAGGCAGGG + Intronic
1152284211 17:79403106-79403128 CAGGGGGAAGGAGGAAGACTTGG + Intronic
1152425665 17:80217247-80217269 CACTGGGAGTGAGGGAGGCTGGG + Intronic
1152650777 17:81491678-81491700 GAGGGGGAAAGAGGGAGAGAGGG - Intergenic
1153060050 18:985835-985857 TAGGGGGAGGGAGGGAGGGAGGG - Intergenic
1153459494 18:5318073-5318095 ATGGGGGAAAAAGGGAGGCAAGG - Intergenic
1154470835 18:14699397-14699419 CAGGAGGAGGGAGGCAGGCATGG - Intergenic
1155250234 18:23947200-23947222 CAGGGGGTAGGAGAGAGGAAGGG - Intronic
1156289090 18:35729743-35729765 GAGAGGGAGGGAGGGAGGCAAGG + Intergenic
1156462262 18:37327655-37327677 CAGGGGGGAGCGGGGAGGCAAGG + Intronic
1156463571 18:37334996-37335018 CAGAGGGAGGGAGGGAGGGAGGG - Intronic
1156584575 18:38417604-38417626 CATGGGGAGTGAAGGACGCATGG - Intergenic
1157075926 18:44467461-44467483 CAGCAGCAATGAGAGAGGCAGGG - Intergenic
1157098837 18:44711479-44711501 GAGAGGGAAGGAGGGAGGGAGGG - Intronic
1157126502 18:44961119-44961141 CAGAGGGAATGAAGGAAGGAGGG + Intronic
1157424318 18:47571875-47571897 CAGGGGGACTCAGGGACTCAGGG - Intergenic
1157630581 18:49091473-49091495 CAGGGAGAGTGAGCCAGGCAAGG + Intronic
1157923458 18:51737747-51737769 CAGGGGGAAGAAGTGAGACAGGG + Intergenic
1158103830 18:53861504-53861526 CAGAAGGAAGGAGGGAGGAAAGG + Intergenic
1158346183 18:56519237-56519259 CAGAGGGAGGGAGGGAGGGAGGG + Intergenic
1158423093 18:57313403-57313425 CATGGGGAAGGAAGGAGGAAAGG + Intergenic
1158672870 18:59492522-59492544 GAAGGGGAAGGAGGGAGGGAGGG - Intronic
1159527922 18:69617728-69617750 AAGGGGGAAGGAGGGAAGGAAGG + Intronic
1160232163 18:77056718-77056740 CAGGGAGAGTGAGACAGGCAGGG - Intronic
1160381142 18:78457118-78457140 CAGGGGGGATGCGGCTGGCAGGG - Intergenic
1160436929 18:78858943-78858965 CAGTGGGAGGGAGGGAGGGAGGG + Intergenic
1160484206 18:79273351-79273373 CATGGGATATTAGGGAGGCAGGG - Intronic
1160709536 19:544724-544746 AAGGGGAGATGAGGGAGGGAGGG - Intronic
1160714570 19:570540-570562 CAGCGGGGATGTGGGTGGCAAGG + Intergenic
1160721812 19:600886-600908 CCGGGGGAATGAGAAAGGTATGG - Intronic
1160847635 19:1173513-1173535 CAAGGGGAGGGAGGGAGACAGGG + Intronic
1160872131 19:1282370-1282392 AAGGGGGAAGGAAGGAGGGAGGG + Intergenic
1160875222 19:1293667-1293689 CAGGGGTGATGAAGGAGGCCTGG + Intronic
1160906342 19:1453358-1453380 CAGAGGGAGTGGGGGAGGCTGGG + Intronic
1160919228 19:1512083-1512105 CAGGGGGAAAGAGGGGGGAAGGG + Intronic
1160952479 19:1674368-1674390 CAGAGGGACAGAGGGAGGGAGGG - Intergenic
1160965667 19:1746015-1746037 GAGGGGGAAGGAGGGGGGAAGGG + Intergenic
1161022290 19:2015901-2015923 GAGGGGGAAGGAGGGAGGGGAGG + Intronic
1161022307 19:2015939-2015961 GAGGGGGAAGGAGGGAGGGGAGG + Intronic
1161022324 19:2015977-2015999 GAGGGGGAAGGAGGGAGGGGAGG + Intronic
1161022341 19:2016015-2016037 GAGGGGGAAGGAGGGAGGGGAGG + Intronic
1161058278 19:2201297-2201319 CAGGGAGAATGAGGAATACAGGG - Intronic
1161088512 19:2345835-2345857 CAGGGAGAATGAGAAAGACAGGG - Intronic
1161139620 19:2639768-2639790 AAGGGGGAAGAAGGGAGGGAAGG + Intronic
1161169817 19:2807180-2807202 CGGGGGGAGTGAGGGAGCCAGGG - Intronic
1161241523 19:3225904-3225926 CAGGGAGGAGGAGGGAGGCGTGG + Intronic
1161256164 19:3310995-3311017 GAGGGGGAGAGAGGGAGGGAGGG - Intergenic
1161404007 19:4081817-4081839 CAGGGGGGAGGAGGGAGGAGAGG - Intergenic
1161458303 19:4381115-4381137 CAGGGGGATAGAGAGAGGCAGGG - Intronic
1161458316 19:4381164-4381186 CAGGGGGACAGAGAGAGTCAGGG - Intronic
1161488301 19:4547796-4547818 AAGGGGGAGTGAGGGAGGAGGGG - Intronic
1161568306 19:5015832-5015854 CACGGGGAGAGAGGGGGGCAGGG - Intronic
1161621423 19:5299268-5299290 GAGGGGGAGAGAGGGAGGAATGG - Intronic
1161656953 19:5522251-5522273 CAGGGGGAAGGAGAAAGGCAAGG + Intergenic
1161664213 19:5565142-5565164 AAGGGGGAGAGAGGGAGGAAGGG - Intergenic
1161708613 19:5834429-5834451 CAGGGGGCTGGAGGGAGACAGGG + Intronic
1161834455 19:6636376-6636398 GAGAGGGAAGGAGGGAGGAAGGG - Intergenic
1161853519 19:6751148-6751170 CAGGCGGAAAGAGGGAGGCGAGG + Exonic
1161978665 19:7619562-7619584 GAGGGGGGATGGGGGAGGGACGG + Exonic
1162072947 19:8165863-8165885 GAGAGGGAAGGAGGGAGGGAGGG + Intronic
1162204682 19:9046933-9046955 AAGAGGGAGGGAGGGAGGCAGGG - Intergenic
1162239235 19:9335455-9335477 CTGGGGGTATGGGGGAGACAGGG - Intronic
1162300979 19:9844820-9844842 CATGGGGAAGGAGGGAGACAGGG - Intronic
1162312780 19:9917026-9917048 CAGGCAGAATGAGAGCGGCAGGG - Intronic
1162414162 19:10524385-10524407 CAGGTGGCAGGAGAGAGGCATGG + Intergenic
1162433391 19:10642826-10642848 GGGAGGGAAAGAGGGAGGCAGGG - Intronic
1162555810 19:11384756-11384778 GAGGGGGAAGGAGGGAAGGAGGG - Intronic
1162923971 19:13920411-13920433 CAGGGGCTTTGAGTGAGGCAGGG + Intronic
1163207208 19:15812480-15812502 CAGGAGGAAGGAAGGAGGGAGGG + Intergenic
1163318131 19:16555445-16555467 CAGGTGGATACAGGGAGGCAGGG - Intronic
1163602143 19:18255584-18255606 CAGGGGGAAAGAGGACGGCAGGG - Intergenic
1163776966 19:19224591-19224613 GAGGGGGACTCAGGGAGGCATGG - Intronic
1163831825 19:19550667-19550689 CTGGGGCAAGGAGGGAGGCTGGG - Intergenic
1164581608 19:29438646-29438668 GAGGGAGAATGAGAGAGGGAGGG + Intergenic
1164581771 19:29439194-29439216 AGGGGGGAGAGAGGGAGGCAGGG + Intergenic
1164775923 19:30853515-30853537 CAGGAATAAAGAGGGAGGCAAGG - Intergenic
1164975625 19:32570944-32570966 GGGAGGGAAGGAGGGAGGCAGGG - Intergenic
1164996174 19:32721078-32721100 CTGGGGGCATGAGGGAAGCCCGG - Intronic
1165393574 19:35551718-35551740 TGGGGGGAAGGAGAGAGGCAGGG + Intronic
1165564099 19:36708630-36708652 CAGGGGGTAGCAGGGAGGGAGGG - Intronic
1165698332 19:37918189-37918211 CAGGGGGACTAAGGAAGGCAAGG + Intronic
1165931033 19:39358865-39358887 CTGGGGAGATGAGGGAGGCCAGG - Intronic
1165995423 19:39840395-39840417 GAGGGTGAGTGAGGAAGGCAGGG - Exonic
1166137656 19:40786987-40787009 CTGGGGGCTTTAGGGAGGCAGGG + Intronic
1166300288 19:41908876-41908898 GAGGGGAAATGAGGGAGACAGGG - Intronic
1166304986 19:41932466-41932488 GAGAGGGGAGGAGGGAGGCAGGG + Intergenic
1166316151 19:41991355-41991377 CAGGGGGTGGGAGGGAGGCTTGG + Intronic
1166327749 19:42061708-42061730 CAGTTGGAATGAGGGGGCCAGGG - Intronic
1166329586 19:42070228-42070250 AAGAGGGAGGGAGGGAGGCAGGG + Intronic
1166332713 19:42088166-42088188 AAGGGGGTAGGAGGGAGGGAGGG - Intronic
1166679705 19:44759073-44759095 CTGGGGGTATGAGGGAGGAGGGG - Intronic
1166816088 19:45547070-45547092 TATGGGGAAGGAGGGAGGGAGGG + Intronic
1166881110 19:45930685-45930707 AAGGGGGAAGGAGGGAGGAAGGG - Intergenic
1166881893 19:45934930-45934952 CAGGGGGGAGGGGGGAGGCTAGG - Exonic
1166908482 19:46133031-46133053 CAGGAGGGATGGGGGAGGCAAGG + Intergenic
1167107184 19:47437151-47437173 CAGGGAGAATCAGAGAGACATGG - Intronic
1167254407 19:48418656-48418678 GAGGGAGAAGGAGGGAGGAAGGG + Intronic
1167260871 19:48456915-48456937 CAGGAGGAATGCGTGAGGCCAGG - Exonic
1167418615 19:49390066-49390088 CCGGGGGCATTAGGGAGCCATGG + Intronic
1167454574 19:49591606-49591628 GAGGGGGAGGGAGGGAGGGAGGG - Intergenic
1167576387 19:50319987-50320009 CAGGTGCAGTGTGGGAGGCAGGG + Intronic
1167579376 19:50332848-50332870 CTGGGGTAATGGGGGAGGGAGGG - Intronic
1167599801 19:50448008-50448030 GAGGAGGCCTGAGGGAGGCAGGG - Intronic
1167698777 19:51030220-51030242 CAGGGAGAGAGAGGGAGGAAGGG - Intronic
1168128399 19:54300046-54300068 GGGGGGGAGTGAGGGAGGGAGGG - Intergenic
1168226121 19:54996657-54996679 CAGCGGGCATGAGTGAGACAGGG - Intronic
1168296340 19:55378880-55378902 CAGGGAGAGGGAGGGAGGGATGG - Intergenic
1168296677 19:55380360-55380382 GAGGGGGAAGCAGGGAGGGAAGG - Intronic
1168430736 19:56277748-56277770 CAGAAGGAAGGAGGGTGGCAGGG + Intronic
1168490282 19:56803236-56803258 CAGATGGAAAGAGGGTGGCAGGG - Intronic
1168669488 19:58229812-58229834 CAGTGCTAATGAGGAAGGCATGG + Intronic
1168695738 19:58403507-58403529 CAGTGGGAGGGAGGGAGGGAGGG + Intronic
925299432 2:2800138-2800160 AAGGGGGAAGGAAGGAGGAAGGG + Intergenic
925356674 2:3246787-3246809 CGGAGGGAGGGAGGGAGGCAGGG + Intronic
925744617 2:7033512-7033534 CAGGGCAAAGGAGAGAGGCAGGG - Intronic
926024518 2:9529565-9529587 CTGGGGGAGTTAGGGAGGAAGGG + Intronic
926142941 2:10379251-10379273 CAAGCAGAAAGAGGGAGGCACGG - Intronic
926240452 2:11081106-11081128 CAGAGGGAGGGAGGGAGGGAGGG - Intergenic
926418741 2:12676302-12676324 AAGGGGGAATGAGGGGTGCAGGG - Intergenic
926552166 2:14313997-14314019 CAGGGAGAATGTGGAAGGGAAGG - Intergenic
926751045 2:16198799-16198821 CTGGGGTAATGGGGGAGGCATGG + Intergenic
926767183 2:16331849-16331871 CAGGTGGAAGCAGGCAGGCATGG - Intergenic
927138371 2:20113604-20113626 CAGGGGAAGGGAGGGAGGTAGGG + Intergenic
927641863 2:24850397-24850419 CTGGGGGAAGGAAGGAGGCTGGG + Intronic
928020789 2:27703256-27703278 CTGGGGGAGGGAGGGAGGAATGG - Intergenic
928921876 2:36535103-36535125 GAGAGGGAAGGAGGGAGGGAGGG + Intronic
929281855 2:40088269-40088291 CTGGGGGGATGAGGGAGGAGTGG + Intergenic
929332672 2:40702604-40702626 CAGGGGAAAGGACGGAAGCAGGG + Intergenic
929406626 2:41649925-41649947 GAGAGGGAGTGAGGGAGGAAAGG + Intergenic
929659762 2:43772243-43772265 CAAGAGGAATGAGGGAAGAAAGG + Intergenic
929685152 2:44027009-44027031 CAGAGGGAGGGAGGGAGGGAGGG + Intergenic
929793864 2:45043511-45043533 CAGAGGGAGGGAGGGAGGGAGGG - Intergenic
929839309 2:45440818-45440840 TAGAGGGAAGGAGGGAGGGAAGG + Intronic
929983028 2:46699020-46699042 AAGGCCGAAGGAGGGAGGCAGGG - Exonic
930048133 2:47191996-47192018 TTGGGGGAATGTGGGAGGAAAGG + Intergenic
930103921 2:47625193-47625215 GGGAGGGGATGAGGGAGGCAGGG - Intergenic
930288096 2:49459396-49459418 GGGAGGGAAGGAGGGAGGCAGGG + Intergenic
930366540 2:50446488-50446510 GACGGGGAAGGAGGGAGGGAAGG - Intronic
930622534 2:53658908-53658930 AGGGGGGAGTGAGGGAGGGAGGG + Intronic
930785832 2:55270572-55270594 CATGGTGAATTAGTGAGGCATGG - Intergenic
931052213 2:58428044-58428066 GAGGGGGAAAGAGGGAGGGAAGG + Intergenic
931419883 2:62117082-62117104 TGGGGGCAAAGAGGGAGGCAGGG - Intronic
931919427 2:66997005-66997027 GGGAGGGAGTGAGGGAGGCAAGG - Intergenic
931926050 2:67073729-67073751 CAGGTGGAAGGAGGAAGGGATGG - Intergenic
931940456 2:67246292-67246314 TAGGGAGAAAGAAGGAGGCAAGG + Intergenic
931997477 2:67853025-67853047 CAGGGTGAATGAGGAGGGGATGG + Intergenic
932044483 2:68333912-68333934 CACTGGGAGTGAGTGAGGCAGGG + Intergenic
932119319 2:69083536-69083558 CAGGAGGAATGGCAGAGGCATGG - Intronic
932121997 2:69110377-69110399 CAAAGGGAATGAGGGAGAGAGGG + Intronic
932137513 2:69243935-69243957 CATGGGAAGTGAGGGAGGCCAGG + Intronic
932400616 2:71478778-71478800 CTGAGGGAGGGAGGGAGGCAGGG - Intronic
932843398 2:75107519-75107541 AAGGGGGAATGGAGGAAGCAAGG + Intronic
933109508 2:78379248-78379270 CGGGGGGAGAGAGGGAGGGAGGG + Intergenic
933345992 2:81086276-81086298 CAAGGGGAATGAAGGAAGGAAGG - Intergenic
933498784 2:83086146-83086168 CAGAGGGAGGGAGGGAGGGAGGG - Intergenic
933610887 2:84434004-84434026 GAGAGGGAATGAGAGAGGCCAGG - Intronic
933634986 2:84699032-84699054 CAGAGGGAAGGAGGGATGAAAGG + Intronic
933855633 2:86411572-86411594 CAGGGAGAAGGAGCTAGGCAAGG - Intergenic
933860419 2:86461279-86461301 CAGAGGGAAGGAGGGAAGAAAGG - Intronic
933877232 2:86631561-86631583 CAGGGGGACTGTAGGTGGCAGGG - Intronic
933940660 2:87242121-87242143 AAGAGAGAATGAGGGAGGGAGGG - Intergenic
933971315 2:87472135-87472157 CAGAGGGAATAAAGGAGGGAGGG - Intergenic
933982661 2:87565785-87565807 CAGAGGAAAAGAGGGAGGAAGGG + Intergenic
934514470 2:94977568-94977590 CAGGGGGACAGAGGAAAGCAAGG - Intergenic
934553966 2:95277848-95277870 GAGGGTGGATGAGGGGGGCAGGG - Intronic
934559164 2:95303440-95303462 CTGCGGGAATGTAGGAGGCAGGG - Intronic
934921621 2:98348562-98348584 CTGTGGGAATGAGGGAGGAAGGG - Intronic
935124039 2:100207371-100207393 CTGGGGGAAAGAGGGGGCCATGG + Intergenic
935367189 2:102307269-102307291 GAGGGGGAGGGAGGGAGGGAGGG - Intergenic
935556845 2:104519365-104519387 CAGAGGGAGGGAGGGAGGGAAGG + Intergenic
935804847 2:106735208-106735230 CAGGGGGCAGGAGGGTGGCAGGG - Intergenic
935881376 2:107569294-107569316 CTGTGGGAAGGAGAGAGGCAAGG - Intergenic
936037330 2:109123382-109123404 CAGGGGAAGGGAGGGAGGGAGGG - Intergenic
936250871 2:110867170-110867192 TCCGGGGGATGAGGGAGGCAAGG + Intronic
936311179 2:111385008-111385030 CAGAGGAAAAGAGGGAGGAAGGG - Intergenic
936322415 2:111478064-111478086 CAGAGGGAATAAAGGAGGGAGGG + Intergenic
936611505 2:114006271-114006293 CAGGGGGAAAAAGGGTGGGAAGG + Intergenic
936846375 2:116839974-116839996 AGGAGGGAATGAGGGATGCAGGG + Intergenic
936922777 2:117706474-117706496 AAGGGGAAAGGAGGGTGGCAAGG - Intergenic
937034538 2:118769841-118769863 GAGGGGGAAAGAGGGAGGAAGGG + Intergenic
937061474 2:118983173-118983195 GAGGGGCAATGGGGAAGGCAGGG + Intronic
937084412 2:119161213-119161235 CTTGGGGAATGTGGGAGGCATGG - Intergenic
937270861 2:120651407-120651429 GAGAGGGAAAGAGGGAGGGAGGG + Intergenic
937289565 2:120773953-120773975 GAGAGGGAAGGAGGGAGGGAAGG - Intronic
937325025 2:120985238-120985260 CTGGGGGAGTGAGGGTGGCTGGG + Intronic
937463882 2:122112330-122112352 CGGCAGGAAGGAGGGAGGCAGGG - Intergenic
937559677 2:123206284-123206306 CAGGGGGTATGGAGGAGGAATGG + Intergenic
937739163 2:125329096-125329118 CACAGGGAATGAGGGAAGAAAGG + Intergenic
937818174 2:126276306-126276328 CAGAGGGAAGGAGGGAGGGAAGG + Intergenic
937818185 2:126276338-126276360 CAGAGGGAAGGAGGGAGGGAAGG + Intergenic
937818196 2:126276370-126276392 CAGAGGGAAGGAGGGAGGGAAGG + Intergenic
937818207 2:126276402-126276424 CAGAGGGAAGGAGGGAGGGAAGG + Intergenic
937904609 2:127046797-127046819 CAGGGGAAATGAGGCTGTCAAGG + Intergenic
938291701 2:130154177-130154199 CAGCAGGAAGGAGGGAGGCTGGG - Intronic
938759076 2:134407383-134407405 AAGGGGGAGGGAAGGAGGCATGG - Intronic
939175139 2:138739568-138739590 CAGGGGGATCACGGGAGGCAAGG + Intronic
939679570 2:145113829-145113851 AAAGGGGAATGGGGGAGGGAGGG + Intergenic
940016708 2:149114016-149114038 CAGAGGGAAAGAGGAAGGAATGG - Intronic
940607600 2:155946935-155946957 CAGGACTAATGAGGGAGGAATGG + Intergenic
940696381 2:156984678-156984700 GAGGAGGAAGGAGGGAGGGAGGG + Intergenic
941378126 2:164756065-164756087 GAGAGAGAATGAGGGAGGGAGGG + Intronic
941923722 2:170875661-170875683 AAGGGGGATTGAGAGAGGCTGGG - Intergenic
941930923 2:170937651-170937673 GAGAGGGAAGGAGGGAGGGAAGG + Intronic
941957645 2:171220790-171220812 GAGGGGCAATGAAGGAGGCTTGG - Intronic
942198920 2:173551495-173551517 TGGGGGGAATGAAGGAGGGATGG + Intergenic
942215194 2:173712583-173712605 CAGGTGCAATGATGGGGGCAGGG + Intergenic
942278926 2:174342179-174342201 CGTGGGCAATCAGGGAGGCAAGG + Intergenic
943499200 2:188666040-188666062 AAGGGGGAATGAGGGAAGGGAGG - Intergenic
943646083 2:190408697-190408719 CCGGGGGAGGGAGGGAGGGAGGG - Intronic
943840127 2:192569921-192569943 CAGGGGTTATGGGGGAGGGAGGG - Intergenic
945118291 2:206431591-206431613 CCTTGGGAAGGAGGGAGGCAGGG + Intergenic
945186349 2:207143890-207143912 CAGGGGGAATGTGTGGGGGATGG - Intronic
945275303 2:207982219-207982241 GGGGGGGAGTGAGGGAGGGAGGG - Intronic
945493098 2:210478899-210478921 GAGGGGGGAGGAGGGAGGGAGGG - Intronic
945876090 2:215279782-215279804 CGGAGGGAAGGAGGGAGGGAGGG + Intergenic
946097237 2:217285786-217285808 CATGGGGAATGGGGAAGCCATGG - Intronic
946156180 2:217808217-217808239 ATGGGGGAATGAGGGGGGAATGG - Intronic
946200470 2:218068236-218068258 CAGGGGACTGGAGGGAGGCAGGG + Intronic
946417750 2:219549071-219549093 CAGGTGGGATGAGAGAGGGAGGG + Intronic
946519060 2:220446571-220446593 AAGGGGGAAGGGGGGAGGAAGGG - Intergenic
946723296 2:222634559-222634581 GAGGGAGAAGGAGGGAGGAAAGG + Intronic
946853196 2:223927926-223927948 AGGGGGAAAGGAGGGAGGCAGGG + Intronic
946978643 2:225181658-225181680 CAGGGGGATTGATTGAGGCTAGG + Intergenic
946996674 2:225400352-225400374 CAGGGGCAGGGAGGGAGGGAGGG + Intergenic
947273908 2:228370165-228370187 CAGGTAGACTGAGGCAGGCAAGG - Intergenic
947360398 2:229340236-229340258 CATGGAGAATGGGGGTGGCAAGG - Intergenic
947374361 2:229480984-229481006 TAGGAGGAAGCAGGGAGGCAGGG + Intronic
947620602 2:231588196-231588218 GTGGGGGAAGGAGGGAGGGAGGG + Intergenic
947820599 2:233066502-233066524 CAGGTGGAATGAGGATGACAAGG + Intronic
947833389 2:233158034-233158056 AGAGGGGAAGGAGGGAGGCAGGG + Intronic
948058338 2:235026097-235026119 CAGAGGGGATGGGGGAGGGATGG + Intronic
948311892 2:236993532-236993554 TAGGGGGAAGGAAGGAGGGAGGG + Intergenic
948444624 2:238022783-238022805 GAGGGGGAATGTGGGAGGGCTGG + Intronic
948465964 2:238151743-238151765 CACCAGGAAGGAGGGAGGCAGGG + Exonic
948613180 2:239182301-239182323 CAGCGGGAGGGAGGGAGCCAAGG - Intronic
948718187 2:239879782-239879804 CAGGGGAAAGGAGGGACTCAGGG - Intergenic
948718481 2:239881392-239881414 CAGTGGGCAGGAGGGAGGCCGGG - Intergenic
948720049 2:239893834-239893856 CAGGGAGAAGGAGTGAGGCTGGG - Intronic
948720129 2:239894177-239894199 CAGGGAGAAGGAGTGAGGCTGGG - Intronic
948720138 2:239894217-239894239 CAGGGAGAAGGAGTGAGGCTGGG - Intronic
948753986 2:240148732-240148754 CAGGAGGACTGAGGGATGCACGG - Intergenic
948856435 2:240732537-240732559 ATGAGGGAATGAGGGAGGGATGG + Intronic
948856544 2:240732883-240732905 GAGGGGGAATGAGGGAGGGATGG + Intronic
1168850063 20:970258-970280 CAGAGGGACTGAGGGATGGAAGG - Intronic
1168953547 20:1818720-1818742 CAGAGGGATGGAGAGAGGCAGGG - Intergenic
1168969744 20:1922875-1922897 CAGGAGGAAAGAGGGAGAGAGGG + Intronic
1168974363 20:1953089-1953111 GAGGGGGATGGAGGGAGGGAGGG + Intergenic
1169246375 20:4028336-4028358 GAGGAGGAAGGAGGGAGGGAGGG - Intergenic
1169270902 20:4198793-4198815 CAAGGGGCATGAGGGAGGGAGGG - Intergenic
1169664357 20:8018446-8018468 GAGGGGGAGGGAGGGAGGGAGGG + Intronic
1169922778 20:10753182-10753204 GAGGGGGATAGAGGGAGGGAGGG + Intergenic
1170585435 20:17730702-17730724 CTGGGGACATGATGGAGGCAGGG - Intronic
1170813909 20:19696929-19696951 AATGGGGAAGGAGGGAGGGAGGG + Intronic
1170886002 20:20340343-20340365 CAGGGGTTCAGAGGGAGGCAAGG + Intronic
1170941393 20:20851124-20851146 CAGGGAGAAAGAGAGAGACAAGG + Intergenic
1171771460 20:29325787-29325809 CAGAGGGAGGGAGGGAGACAGGG + Intergenic
1171785841 20:29464051-29464073 GAGAGGGAAGGAGGGAGGGAGGG - Intergenic
1171813401 20:29763030-29763052 GAGAGGGAAGGAGGGAGGGAGGG + Intergenic
1171813417 20:29763074-29763096 CGGAGGGAAAGAGGGAGGGAGGG + Intergenic
1171862440 20:30413071-30413093 GAGAGGGAAGGAGGGAGGGAGGG + Intergenic
1171905050 20:30893695-30893717 CAGAGGGAAGGAGGGAGAGAGGG - Intergenic
1171905832 20:30899302-30899324 GAGAGGGAAGGAGGGAGGGAGGG - Intergenic
1172078248 20:32316339-32316361 CAGGGAGAATGGGTGAGGTAAGG + Intronic
1172185700 20:33029801-33029823 CAGGCAGAAAGAGGGAGGAAGGG + Intergenic
1172222936 20:33286130-33286152 CAGTGGGACTGAGGGTGGCTTGG - Exonic
1172390431 20:34561574-34561596 CAGGGAGAATGGGGTGGGCACGG - Intronic
1172701539 20:36856348-36856370 GCTGGGGAATGATGGAGGCAAGG - Intronic
1172783426 20:37450695-37450717 CAGGTGGTAGGAGGGAGGGATGG - Intergenic
1172830389 20:37829114-37829136 CAGGGGGCAGGTGGGTGGCAAGG + Intronic
1172858743 20:38030241-38030263 AAGGAGGAAGGAGGGAGGGAGGG + Intronic
1173001745 20:39110154-39110176 AAGAGGGAAAGAGGGAGGGAGGG - Intergenic
1173114075 20:40223537-40223559 CAGGGGAACAGAGGGAGTCAGGG + Intergenic
1173256221 20:41395832-41395854 GAGAGGGAAGGAGGGAGGGAGGG - Intergenic
1173427490 20:42955803-42955825 GAGGGAGAAGGAGGGAGGGAGGG + Intronic
1173427499 20:42955829-42955851 GAGGGAGAAGGAGGGAGGGAGGG + Intronic
1173427506 20:42955847-42955869 GAGGGAGAAGGAGGGAGGGAGGG + Intronic
1173450338 20:43158085-43158107 CAGGGGAAAAGAGGGTGGCTTGG + Intronic
1173541663 20:43857269-43857291 AAGGGGGAAAAAGGGAGGAAGGG + Intergenic
1173822858 20:46030166-46030188 GAGGGGGAAAGAGGGAAGAAAGG - Intronic
1173908612 20:46647337-46647359 CAGGGGGCATAAGGCAGGAAAGG + Intronic
1174036612 20:47672453-47672475 CAGGGTGGATGGGGGTGGCAGGG - Intronic
1174079863 20:47963012-47963034 CAGGGAGTAGGAGGGGGGCAAGG - Intergenic
1174124059 20:48289673-48289695 AAAGGTGAATGAGGGAGGCAGGG + Intergenic
1174137537 20:48390985-48391007 GAAGGGGAAGGAGGGAGGGAAGG + Intergenic
1174215292 20:48911798-48911820 CAGGGGTACTTAGGGAGGCAGGG - Intergenic
1174265586 20:49329387-49329409 CAGAGGGAATCAGGGAGCCTAGG + Intergenic
1174303602 20:49600012-49600034 TAGTGGGAGTGAGGGAGGCTGGG - Intergenic
1174338593 20:49882341-49882363 CAGTGGGAAGGAGGTAGGCTAGG - Intronic
1174432016 20:50477216-50477238 CAGGGGCAGGGAGGGAGGCAGGG + Intergenic
1174592310 20:51656120-51656142 CTGGAGGAATGAGGAAGACAAGG + Intronic
1174723295 20:52836254-52836276 GAGGGGGAGGGAGGGAGGCAAGG + Intergenic
1174726289 20:52865731-52865753 GAGGGAGAAAAAGGGAGGCAGGG + Intergenic
1174832701 20:53827734-53827756 CAGAGGGAAGGAGGGAGGGAGGG - Intergenic
1175041641 20:56057699-56057721 GGGAGGGAATGAGGGAGGTAAGG + Intergenic
1175186438 20:57182220-57182242 CAGGGGGCATGAGCCAGGCAAGG + Intronic
1175388508 20:58612145-58612167 AGGGGGGAAGGAGGGAGGGAGGG - Intergenic
1175524252 20:59622690-59622712 CACTGGGAATGAGGGAGACCAGG + Intronic
1175601985 20:60281687-60281709 CAGAGGAAATGAGGGAGGTCTGG + Intergenic
1175898124 20:62348909-62348931 CAGGGGAAAAGAGGTAGGAAAGG + Intronic
1176007317 20:62873195-62873217 GAGGAAGAAAGAGGGAGGCAGGG + Intergenic
1176080004 20:63267728-63267750 CGGGGGGAAGAAGTGAGGCAGGG - Intronic
1176409616 21:6441393-6441415 CAGGAGGATTGATGGAGCCAGGG - Intergenic
1176782265 21:13211110-13211132 AAGGGGGAGGGAGGGAGGGAAGG - Intergenic
1176876479 21:14135229-14135251 CAGTGGGATTTTGGGAGGCAGGG + Intronic
1177430666 21:20988567-20988589 GAGAGGGAAGGAGGGAGGGAGGG + Intergenic
1177562160 21:22770279-22770301 CAGGAGAAATCCGGGAGGCAGGG - Intergenic
1177816515 21:25983744-25983766 CAAGTGGAAGGAAGGAGGCAGGG + Intronic
1178038746 21:28615311-28615333 AAAGGGGAAGGAGGGAGGAAAGG - Intergenic
1178066350 21:28908520-28908542 CAGGGTGACTGCGGGAGGCCAGG - Intergenic
1178163917 21:29950204-29950226 AGGAGGGAAAGAGGGAGGCAGGG - Intergenic
1178357852 21:31923509-31923531 GAGAGGGAAGGAGGGAGGAAGGG + Intronic
1179246819 21:39640390-39640412 CAGGGAGCATGAGGGAGAAAGGG - Intronic
1179388971 21:40970036-40970058 AAGGAGGAAAGAGGGAGGGAGGG + Intergenic
1179413368 21:41179095-41179117 CAGGGTGACTGAGGGTGCCAGGG + Intronic
1179413446 21:41179406-41179428 CAGGGTGAGTGAGGGTGTCAGGG + Intronic
1179421238 21:41238396-41238418 CAGGAGGAGGGAGGCAGGCAGGG + Intronic
1179565546 21:42245610-42245632 CATGTGGTGTGAGGGAGGCAGGG + Intronic
1179591529 21:42412356-42412378 CAGGGGGCATCAGGGAGGCCGGG + Intronic
1179685109 21:43049715-43049737 CAGGAGGATTGATGGAGCCAGGG - Intergenic
1179956401 21:44741668-44741690 AAGGGGGAGGGAGGGAGGGAAGG + Intergenic
1180118451 21:45727562-45727584 CAGGAGGAATGGGTGAGGCAGGG + Intronic
1180133691 21:45845947-45845969 CAGAGGAGATGAAGGAGGCATGG - Intronic
1180316082 22:11278069-11278091 GAGAGGGAAGGAGGGAGGGAGGG + Intergenic
1180316102 22:11278125-11278147 CAGAGGGAAAGAGGGAGGGAGGG + Intergenic
1180316848 22:11283639-11283661 CAGAGGGAGGGAGGGAGACAGGG + Intergenic
1180320004 22:11311156-11311178 AAGGGAGAGAGAGGGAGGCAGGG - Intergenic
1180597835 22:16990550-16990572 CTGGGGGCATGAAGGATGCATGG - Intronic
1180641873 22:17305352-17305374 TAGGGAGAATGAGGCAGCCAGGG + Intergenic
1180657550 22:17435959-17435981 CAGAGGGAGGGAGGGAGGAAGGG - Intronic
1180839449 22:18952319-18952341 CAGGAGCAAGGAGGGAGGCCAGG + Intergenic
1180945993 22:19693819-19693841 CAGCAGGGATGAGGGTGGCATGG + Intergenic
1180948014 22:19707532-19707554 CAGGTGGGGTGAGGGAGGCAGGG - Intergenic
1181033157 22:20157824-20157846 GAGAGGGAATGATGGAGGCTGGG + Intergenic
1181510152 22:23385408-23385430 GAGAGGGAATGACGGAGGCTGGG - Intergenic
1181821845 22:25482458-25482480 TCTGGGGAGTGAGGGAGGCATGG - Intergenic
1181967704 22:26668397-26668419 CCAGGGGTATGAGGGAGGCCTGG + Intergenic
1182125249 22:27811169-27811191 CAGGTGGAGAGAGGGAGGCCTGG + Intergenic
1182331722 22:29555718-29555740 CAGGGGGAGGGAGGCAGGCAGGG + Exonic
1182680726 22:32077411-32077433 TAGGGGGAAGGATGGAGGGAGGG - Intronic
1182804388 22:33058123-33058145 GAGGGGCAGGGAGGGAGGCAAGG - Intronic
1182864564 22:33592103-33592125 AAGGGGGACAGAGGGAGGGAGGG + Intronic
1183212215 22:36458097-36458119 CTGGGAGGATGAGGCAGGCAGGG - Intergenic
1183318541 22:37149793-37149815 CAGGGGCCGGGAGGGAGGCAGGG + Intronic
1183501130 22:38180092-38180114 CTGGGGGAAGTAGGTAGGCAAGG - Intronic
1183543666 22:38444195-38444217 CGGGGTGAAGTAGGGAGGCAAGG - Intronic
1183836041 22:40454141-40454163 GTGGGGGTGTGAGGGAGGCAGGG + Intronic
1183894877 22:40960255-40960277 GAGGGGGAAGGAGGGAGGTCAGG + Intronic
1184016727 22:41791518-41791540 CAGTGGGAAAGATGGGGGCAAGG + Intronic
1184116435 22:42425485-42425507 CAGAGGGAAGGATGGAGGCCTGG - Intronic
1184486474 22:44783059-44783081 CAGAGGGAGGGAGGGAGGGAGGG - Intronic
1184497686 22:44851844-44851866 CAGAAGGAATGATGGAGGGAGGG + Intronic
1184686704 22:46099500-46099522 CTGGGGGAATCAGGGAGGAGGGG + Intronic
1184869066 22:47222097-47222119 CAGGAGGAGTGAAGGATGCAGGG - Intergenic
1184912701 22:47547076-47547098 CCGGGTGAAGGAGGGAGGTAGGG - Intergenic
1185069497 22:48648302-48648324 CAGGGGGAGTGGGGGAGGAAAGG - Intronic
1185129200 22:49028101-49028123 CAGAAGGAAGGAGGGAGGAAGGG + Intergenic
949465264 3:4337249-4337271 GAGGGGGAGTGAGGGAGAGAGGG - Intronic
949551520 3:5116051-5116073 GAGAGGGAAGGAGGGAGGGAGGG - Intergenic
949634462 3:5967625-5967647 AGGAGGGAATGAGGGAGGGAAGG - Intergenic
949894819 3:8761254-8761276 CAGGGAGGATGAGAGGGGCATGG + Intronic
950528726 3:13540127-13540149 CTGGGGGAAAGCGGGAGGGATGG + Intergenic
950579714 3:13854168-13854190 CGGAGGGAAGGAGGGAGGGAGGG + Intronic
950582107 3:13869303-13869325 AAGAGGGAAAGAGGGAGGGAGGG + Intronic
950582154 3:13869657-13869679 AAGAGGGAAGGAGGGAGGGAGGG + Intronic
950644653 3:14369808-14369830 CAGGTGGCAGGAGGGAGGCTCGG - Intergenic
950655661 3:14434782-14434804 CAGGGGGAGGGGTGGAGGCACGG - Intronic
950670181 3:14521257-14521279 GTGAGGGAATGAGCGAGGCATGG - Intronic
950707115 3:14789731-14789753 CTGGGGGCAAGACGGAGGCAGGG + Intergenic
950727354 3:14925204-14925226 CAGTGGGATTGAGGGAGGCTGGG - Intronic
950812325 3:15660775-15660797 CAGGGGATATGAGGGAGGAAAGG - Intergenic
950908826 3:16566353-16566375 CAGTGGGAAGAAGGCAGGCAGGG - Intergenic
951474947 3:23094912-23094934 CATGGAGAAGGAAGGAGGCAAGG + Intergenic
951703879 3:25524624-25524646 AGGGAGGAAGGAGGGAGGCAGGG - Intronic
952164622 3:30733643-30733665 GAGAGGGAAGGAGGGAGGGAGGG - Intronic
952217760 3:31294845-31294867 CAGGTGGAGTGAGGTTGGCAGGG - Intergenic
952496143 3:33917385-33917407 GAGAGGGAAGGAGGGAGGGAGGG - Intergenic
952716427 3:36484951-36484973 GAGAGAGAATGAGGAAGGCAAGG - Intronic
952780461 3:37092375-37092397 GAGAGGCAATGAAGGAGGCAGGG - Intronic
952881008 3:37986420-37986442 CAGGGGTGAGGAGGGAGGCCTGG + Intergenic
952926853 3:38326606-38326628 TGTGGGGAGTGAGGGAGGCAGGG - Intergenic
952995528 3:38878018-38878040 CAGGGGAAATGAGGGTGTGAGGG + Intronic
953534171 3:43764846-43764868 CAGGGGGAATGAGGGCTACTTGG + Intergenic
953574362 3:44101202-44101224 CTGGGAGAATGGTGGAGGCAGGG + Intergenic
954034826 3:47845861-47845883 CAGGGGTGGTGAGGGATGCAGGG - Intronic
954104977 3:48405098-48405120 CACGGGGCTTGGGGGAGGCAGGG - Intronic
954167832 3:48774823-48774845 GAGAGGGAGGGAGGGAGGCAAGG - Intronic
954386347 3:50246081-50246103 CGGAGGGAATGAGGGGGGCCGGG + Intronic
954452211 3:50577794-50577816 CAGGGAGAAAGGGGTAGGCACGG - Intronic
954659683 3:52220389-52220411 GAGAGGGAAGGAGGGAGGGAGGG + Intergenic
954699932 3:52445801-52445823 CTGGAGGCCTGAGGGAGGCAGGG - Intergenic
955015672 3:55066520-55066542 GAGGGAGTATGAGGGAGGCATGG + Intronic
955400402 3:58587105-58587127 CCGGGGGAAGGAGGGGGGCAGGG + Intronic
955496448 3:59538290-59538312 CAGAGGGAGGGAGGGAGGGAGGG - Intergenic
956050264 3:65240503-65240525 CTGTGGGAATGAGGGAGGTAGGG - Intergenic
956205375 3:66749576-66749598 CAGAGGGAAAGAGGGAGGGAGGG + Intergenic
956322068 3:68008081-68008103 CTGGGGGAAACAGGGTGGCAGGG - Intronic
956715967 3:72080384-72080406 CAGTGGAAAAGAGGAAGGCAAGG - Intergenic
957466687 3:80602528-80602550 GAGGGAGAAGGAGGAAGGCAGGG + Intergenic
957470974 3:80656814-80656836 AAGCTGGAATGAGGGAGACAAGG + Intergenic
959136956 3:102435138-102435160 CAGGGGAAATGATGAAGGTAAGG + Exonic
959380025 3:105630587-105630609 GAGGGGGAATGAAGAAGGGAGGG - Intergenic
959566409 3:107836949-107836971 CCGGGGGAATGAGGCAGGGGTGG - Intergenic
959796275 3:110432405-110432427 GAGAGGGAAGGAGGGGGGCATGG - Intergenic
960506552 3:118501320-118501342 AGGAGGGAGTGAGGGAGGCAGGG - Intergenic
960883228 3:122367111-122367133 CAGGGAGAGGGAGGAAGGCAGGG + Intronic
961387558 3:126530928-126530950 GAGGGGGCCTGAGGCAGGCAGGG + Intronic
961435304 3:126912650-126912672 CCGGGGGAGTCAGGGAGGCCTGG - Intronic
961496357 3:127294844-127294866 CAGGGATAATGAGAGAAGCAGGG + Intergenic
961503526 3:127355005-127355027 TAGGGGGAGAGAGGGAGGGATGG - Intergenic
961621318 3:128227132-128227154 CAGAGGGACTGAAGAAGGCATGG - Intronic
962006384 3:131353968-131353990 CTGGGGGAAGGAGAGAGGCACGG + Intergenic
962013986 3:131421843-131421865 GATGGGGAATGCTGGAGGCAGGG + Intergenic
962236478 3:133711617-133711639 CAGGGGAAATGAGGGCAGCTGGG - Intergenic
962340047 3:134575142-134575164 AAGGGGGACGGAGGGAGGGACGG - Intergenic
962340089 3:134575258-134575280 GAGGGGGAAAGAGGGAAGCAAGG - Intergenic
962421231 3:135230705-135230727 GAGAGGGAGGGAGGGAGGCATGG - Intronic
963145558 3:141990236-141990258 CAGTGAGCATGAGGGAGGTAGGG + Intronic
963550247 3:146711760-146711782 GAAGGGGAATGAGAGAGGAAAGG - Intergenic
963931157 3:151005560-151005582 CAGGGAGAATGAAGGAGGGTTGG - Intergenic
964139559 3:153381375-153381397 CAGGTGGGATGAGGGTGGGATGG + Intergenic
964661748 3:159127273-159127295 CAGAGGGAGTTGGGGAGGCAGGG + Intronic
964934296 3:162062147-162062169 CAGAGGGAGGGAGGGAGGGAAGG - Intergenic
965028094 3:163328463-163328485 CAGGGAGCATGAGGGAGAGAAGG - Intergenic
965045888 3:163576535-163576557 GAGGGGGGAGGGGGGAGGCAGGG - Intergenic
965839068 3:172882334-172882356 CAGTGGGAATGAAGCAGGCAGGG + Intergenic
965942452 3:174201292-174201314 AAGGGGGAGGGAGGGAGGAAGGG + Intronic
965942895 3:174206949-174206971 CAGGGGGAATAAGGCAAGTATGG - Intronic
966164848 3:177006122-177006144 CAGCAGGAGTGAGGGAGGCTTGG + Intergenic
966480033 3:180397130-180397152 CAGGGAGAATGATGGTAGCAGGG - Intergenic
966901161 3:184487004-184487026 CAGGGGAAGGGAGGGAGGGAGGG - Intronic
966916148 3:184585030-184585052 CAAGTGGAATGAGGGAATCAAGG - Intronic
967000353 3:185327984-185328006 AAGGGGGAAGGAGGGAGGGAAGG + Intronic
967019963 3:185514134-185514156 GAGAGGGAAAGAGGGAGGAAAGG + Intronic
967033702 3:185631582-185631604 GAGGGGGAAGGGGGGAGGGAGGG - Exonic
967185400 3:186940341-186940363 GAAGTGGAATGAGGGAGGAATGG - Intronic
967350693 3:188511094-188511116 AAGGAGGAAGGAGGGAGGGAGGG - Intronic
967648602 3:191957454-191957476 CTGAGGGAAGGAGGGAGGGATGG + Intergenic
968355863 3:198106214-198106236 GAGGGAGAAAGATGGAGGCAGGG - Intergenic
968581517 4:1397428-1397450 CAGGGGGGATGTTGGATGCAGGG + Intergenic
968601514 4:1512100-1512122 GAGAGGGAATGAGGGAGGAAGGG + Intergenic
968621399 4:1604924-1604946 GAGGGGGCAGGAGGGGGGCAGGG - Intergenic
968701890 4:2061324-2061346 CAGCGGGGCTGGGGGAGGCACGG + Intronic
968706376 4:2080299-2080321 CTGGGGGAATAACTGAGGCAGGG + Intronic
968786687 4:2627243-2627265 CAGCTTGAATGCGGGAGGCAGGG - Intronic
968808522 4:2789806-2789828 GAGGGAGGATGAGGCAGGCAGGG + Intergenic
969170569 4:5359399-5359421 CAGGTGGATGGAGGGAGGGAGGG - Intronic
969289444 4:6229331-6229353 CAGGGGCAAAGAGAGAGGGAGGG + Intergenic
969355228 4:6621118-6621140 CAGGGGGTGAGAGGGAGGCTGGG + Intronic
969504276 4:7574554-7574576 CAGGGGGAAGGAGGAAGAGAGGG + Intronic
969527038 4:7709076-7709098 GATGGGGAGTGAGGGAGGAAGGG + Intronic
969601336 4:8178175-8178197 CAGGGCGAGTGAGGGAGTGAAGG - Intergenic
969607746 4:8211055-8211077 CAGAGGGAGAGAGGGAGGGAGGG - Intronic
969661843 4:8534766-8534788 AAGGGGGAATGTGGAAGCCAAGG - Intergenic
969668496 4:8575948-8575970 GAGGGGGAGGGAGGGAGGGAGGG - Intronic
970025765 4:11622491-11622513 CTGGAGGAATGAGGAAGGCCAGG - Intergenic
970137871 4:12945815-12945837 CGGAGGGAAGGAGGGAGGGATGG + Intergenic
970221706 4:13818580-13818602 CAGGGGTGAAGAGGAAGGCATGG - Intergenic
970269932 4:14335168-14335190 AAGAGGGAAGGAGGGAGACAAGG + Intergenic
970444217 4:16110314-16110336 AAGGAGGAAGGAGGGAGGGAGGG + Intergenic
970536880 4:17038969-17038991 GAAGGGGAAGGAGGGAGCCAAGG - Intergenic
970640695 4:18062406-18062428 CAGGAGGATTGCTGGAGGCAAGG - Intergenic
970868390 4:20784591-20784613 TAGGAAAAATGAGGGAGGCAAGG - Intronic
971379238 4:26081576-26081598 CTGGGGGACTGAGAGAGGGATGG - Intergenic
972103141 4:35447473-35447495 GAGGAGGAAGGAGGGAGGAAGGG + Intergenic
972103217 4:35447776-35447798 GAGGAGGAAGGAGGGAGGAAGGG + Intergenic
972103230 4:35447823-35447845 GAGGAGGAAGGAGGGAGGAAGGG + Intergenic
972698612 4:41472336-41472358 GAGGGGCAGGGAGGGAGGCAGGG - Intronic
972913989 4:43853270-43853292 CAGGGGAAATGTTGGATGCAGGG + Intergenic
972924173 4:43983642-43983664 CAGAGGGAGAGAGGGAGGGAGGG + Intergenic
973531291 4:51839125-51839147 AGGAGGGAATGAGGGAGGGAAGG + Intergenic
973704992 4:53572287-53572309 TCTGGGGAATGAGGGAGGTAGGG + Intronic
973885602 4:55317985-55318007 CAGGGGGAAAGAGGAAGAGAGGG + Intergenic
973968916 4:56191387-56191409 CAGAGGGAGGGAGGGAGGAAGGG - Intronic
973977877 4:56281149-56281171 CAGGGGGTAAGTGGCAGGCAAGG + Intronic
974385536 4:61199993-61200015 GAGGGGGAGAGAGGGAGGGAGGG + Intergenic
974413753 4:61577222-61577244 GGGGGGGGATGAGGGAGGGAAGG + Intronic
975411492 4:74056649-74056671 CAGTAGGAAAGAGGTAGGCATGG + Intergenic
975844312 4:78508827-78508849 CTGGGGAAATGAGGGTCGCAGGG - Intronic
975960398 4:79897136-79897158 AAGGGGGAGGGAGGGAGGGAGGG + Intergenic
976069415 4:81224205-81224227 AAGGGGAAATGAGGGAGAAAAGG - Intergenic
976105329 4:81611566-81611588 AACAGGGAAAGAGGGAGGCAGGG + Intronic
976419790 4:84828073-84828095 CAGAGGGAGGGAGGGAGGGAGGG + Intronic
976697033 4:87927735-87927757 CAGAGGGAGGGAGGGAGGAATGG - Intergenic
977088630 4:92639639-92639661 ATGGGGGAATGAGGGGGGCCTGG + Intronic
977713842 4:100158630-100158652 CAGGAGGAATGACTGAGGCCAGG + Intergenic
978071624 4:104479769-104479791 CAGAGGGAGGGAGGGAGGGAAGG - Intronic
978639347 4:110851183-110851205 GAGGGGGAATGAGGGAGAGGTGG + Intergenic
978733812 4:112062527-112062549 CAGAGGGAGGGAGGGAGGGAGGG + Intergenic
978754052 4:112284609-112284631 CAGGGGGAACTGGGGAGGCGAGG - Intronic
979128575 4:117009409-117009431 AAAAGGGAAGGAGGGAGGCATGG + Intergenic
979506398 4:121502605-121502627 GAGGGGGAGGGAGGGAGGGAGGG - Intergenic
979612349 4:122702775-122702797 AAGTGGGGATGAGGGAGGAAGGG - Intergenic
979827331 4:125255798-125255820 GTGGGGGAATGGGGGAGGGATGG - Intergenic
980092301 4:128455482-128455504 CAGAGGGTATGAGGGTGTCAAGG - Intergenic
980874219 4:138644772-138644794 TGGGAGGAATGAGTGAGGCAGGG + Intergenic
981044641 4:140253474-140253496 AAGGAGGAAGGAGGGAGGGAGGG + Intergenic
981799877 4:148643038-148643060 GGGGTGGAATGAGGGAGGAAGGG + Intergenic
981803504 4:148685245-148685267 CATAGGAAATGTGGGAGGCAGGG + Intergenic
981841411 4:149116922-149116944 CAGGGGAAATTATAGAGGCAAGG + Intergenic
982294131 4:153808938-153808960 CAGAGGGAAGGAGGGAAGGAGGG - Intergenic
982612112 4:157588439-157588461 CAGGGAGCAAGAGAGAGGCAGGG + Intergenic
982816488 4:159891936-159891958 AGGGGGGAAGGAGGGAGGGAGGG - Intergenic
983254223 4:165379600-165379622 GTGGGGGAAGGAGGGAGGGATGG + Intronic
983375966 4:166928518-166928540 CAGGGGTTATTAGGGAGGAAAGG + Intronic
983591164 4:169412918-169412940 GAGAGGGAAAGAGGGAGGCAAGG + Intronic
983989605 4:174101586-174101608 GAGAGGGAGTAAGGGAGGCAAGG + Intergenic
984181167 4:176484258-176484280 AAAGGGGAATGAGGCAGGAAAGG + Intergenic
984661778 4:182382460-182382482 CAGTGTGAATGAGAGAGGCGGGG - Intronic
984911454 4:184676963-184676985 AAGGGGGAAAGAGGAAGGGAAGG - Intronic
985113229 4:186567327-186567349 CGGGAGGGATGAGGGTGGCAAGG - Intergenic
985273453 4:188216320-188216342 GAGAGGGAAGGAGGGAGGGAAGG - Intergenic
985273487 4:188216419-188216441 GAGAGGGAAGGAGGGAGGGAAGG - Intergenic
985273498 4:188216451-188216473 GAGAGGGAAGGAGGGAGGGAAGG - Intergenic
985273565 4:188216675-188216697 GAGAGGGAAGGAGGGAGGGAAGG - Intergenic
985625128 5:981861-981883 CAGGTGGACTGAGGCAGGCCGGG - Intergenic
985625151 5:981935-981957 CAGGTGGACTGAGGCAGGCCGGG - Intergenic
985625193 5:982083-982105 CAGGTGGACTGAGGCAGGCCGGG - Intergenic
985752342 5:1687760-1687782 CATGGGGCATGAGTGAGGCGTGG - Intergenic
985797398 5:1973148-1973170 AAGGAGGAAGGAGGGAGGGAGGG - Intergenic
985962636 5:3314350-3314372 CAAGGAGGATGAGGGAGGCAAGG - Intergenic
986026653 5:3857639-3857661 AAGGGGCAATGACAGAGGCAGGG + Intergenic
986441887 5:7790206-7790228 CAGGGGGCGTGTGGGAGGCATGG - Intronic
986517678 5:8581054-8581076 CAGGTGGGAGGAGGGGGGCAAGG - Intergenic
986557265 5:9024467-9024489 GTGGGGGAGTGAGGGAGGGAGGG - Intergenic
986620122 5:9664129-9664151 CTGGGGCGATGAGGGAGGCATGG - Intronic
987052255 5:14157433-14157455 CAGGGAGAGAGAGGGAGACAGGG - Intronic
987052259 5:14157451-14157473 CAGGGAGAGAGAGGGAGACAGGG - Intronic
987052263 5:14157469-14157491 CAGGGAGAGAGAGGGAGACAGGG - Intronic
987052267 5:14157487-14157509 CAGGGAGAGAGAGGGAGACAGGG - Intronic
987052271 5:14157505-14157527 CAGGGAGAGAGAGGGAGACAGGG - Intronic
987052275 5:14157523-14157545 CAGGGAGAGAGAGGGAGACAGGG - Intronic
987078387 5:14404660-14404682 GAGGGGGCAGGAAGGAGGCAGGG - Intronic
987092921 5:14523429-14523451 CAGGAGGAAGGAGGGAGGGACGG - Intronic
987570480 5:19651638-19651660 CATGGTGAATTAGGGAAGCAAGG - Intronic
987734218 5:21818518-21818540 CTGGGGGAAGGAGGGAAGAAGGG - Intronic
987752031 5:22052426-22052448 CAGGGGATTAGAGGGAGGCAGGG - Intronic
987883261 5:23777145-23777167 CAGGGGGAAACAGGCAGGGAAGG + Intergenic
987950060 5:24663157-24663179 CAGAGGGAAGGAGGAAGGAAAGG - Intergenic
988477279 5:31597888-31597910 AAGAGGGAAGGAGGGAGGGAGGG + Intergenic
988623635 5:32848436-32848458 AGGGGGGAAGGAGGGAGGGAGGG - Intergenic
988901180 5:35734138-35734160 CATAGGGAAAGAGGGAGGAAGGG + Intronic
990057698 5:51604671-51604693 CAGGAGGTAGGAGGGAGGAATGG + Intergenic
990326273 5:54678664-54678686 CAGTGGGAATGAGGATGGGAGGG + Intergenic
990370736 5:55115584-55115606 CTAGGAGAATGAGGGAGGAAAGG + Intronic
990528615 5:56652478-56652500 CAGTGGGAAGGAGTGAGGGAGGG + Intergenic
990852936 5:60227589-60227611 AAGGGGGAGAGAGGGAGGGAGGG + Intronic
991247430 5:64522962-64522984 GAGGGGGAAAGAGGCAGGGAAGG + Intronic
991417597 5:66408161-66408183 CTGGATGCATGAGGGAGGCAGGG - Intergenic
991471407 5:66972831-66972853 TAGAGGGAATGAGTGAGACACGG - Intronic
991501516 5:67281987-67282009 AAGGGGGAAGGAGGAAGGGAAGG - Intergenic
991536577 5:67675359-67675381 CAGGAGAAATGAGTGAAGCAAGG + Intergenic
991646694 5:68808030-68808052 AAGTGGGAAGGAGGGAGGGAGGG + Intergenic
991648324 5:68824092-68824114 CAGAGGGAATATGGGAGGGAAGG - Intergenic
991942117 5:71863182-71863204 AGGGGGGAAAGAGGGAGGGAAGG - Intergenic
991974724 5:72174907-72174929 AAGGGGGAAGGAGGGAAGGAAGG - Intronic
992395546 5:76366284-76366306 AAGGGGGAGGGAGGGAGGGAGGG - Intergenic
992504045 5:77367979-77368001 CAGGGCCAATGAGGCTGGCATGG + Intronic
992558575 5:77927890-77927912 CGGGGGGAGGGAGGGAGGAAAGG + Intergenic
992605099 5:78447927-78447949 GAGGGGGAAGGAGGGAGGAAGGG - Intronic
992792759 5:80228216-80228238 CAGAGTGAGTGAGGGAGGGAGGG + Intronic
993202340 5:84831531-84831553 GAGGGGGAAAGATGGAGGCAGGG + Intergenic
993378568 5:87179341-87179363 CAGTGAGACTGAGGGAGGGAGGG + Intergenic
993779095 5:92043199-92043221 CAAGTGGAATGAAGGAGGAAAGG - Intergenic
993823065 5:92644789-92644811 CTGGGAGAAAGGGGGAGGCAAGG - Intergenic
994124268 5:96152046-96152068 CAGGAGGAAGGAGGGAGGGAGGG + Intergenic
994197529 5:96936289-96936311 CACGAGGGCTGAGGGAGGCAGGG + Intronic
994737743 5:103576406-103576428 GAGAGGGAAGGAGGGAGGGAGGG + Intergenic
994864884 5:105255070-105255092 GAGGGGAAAGGAGGGAGGGAGGG + Intergenic
995306034 5:110651466-110651488 AAGAGGGAAGGAGGGAGGGAGGG + Intronic
997238271 5:132288123-132288145 CAGGGAGGATGGGGAAGGCAGGG + Intronic
997353837 5:133249580-133249602 CAGAGGGAAAGGAGGAGGCACGG + Intronic
997357364 5:133271890-133271912 CAGAGGGAGGGAGGGATGCAGGG + Intronic
997605486 5:135172995-135173017 AGGGGGAAAAGAGGGAGGCAGGG + Intronic
997628934 5:135351788-135351810 CAGGAGGATTGAGTGAGGCCAGG - Intronic
997739895 5:136244151-136244173 GAGAGGGAAGGAGGGAGGGAAGG - Intronic
997963259 5:138338358-138338380 AAGAGGGAAGGAGGGAGGGACGG - Intronic
998042713 5:138962966-138962988 CAGGCAGTCTGAGGGAGGCAAGG + Intronic
998105900 5:139469100-139469122 CAGGATTAATGAGGGAGGAAAGG + Intergenic
998156858 5:139792058-139792080 GAGGGGGAATGAGTGTGGGAGGG + Intergenic
998197040 5:140082939-140082961 CAGTGAGAAAGAGGGAGGAAAGG - Intergenic
998258158 5:140606067-140606089 AAGGGGGAGGGAGGGAGGGAAGG - Intergenic
998490127 5:142539502-142539524 AAGGGGGAAGCAGGGAGGGAAGG - Intergenic
998884242 5:146677531-146677553 CAGAGGGAGGGAGGGAGGGAGGG - Intronic
998984742 5:147743955-147743977 GAGGGAGAAGGAGGGAGGGAGGG - Intronic
999247177 5:150161349-150161371 AAGGGGGCAGGAGGGAGGCATGG + Intergenic
999393070 5:151208466-151208488 CTGGAGGACTGAGGGAGTCATGG + Intronic
999564520 5:152842633-152842655 GAGGAGGAATTTGGGAGGCAGGG + Intergenic
1000497164 5:161999096-161999118 CAAGGAGAATGAGGGAGGGAGGG - Intergenic
1000676683 5:164130348-164130370 AAGGGGGGATGAAGGAGGGAGGG - Intergenic
1001003764 5:168031666-168031688 AAGAGGGAAAGAGGGAGGAAGGG + Intronic
1001089392 5:168726350-168726372 CAGGGAGGGAGAGGGAGGCAGGG + Intronic
1001089399 5:168726368-168726390 CAGGGAGGGAGAGGGAGGCAGGG + Intronic
1001089405 5:168726386-168726408 CAGGGAGGCAGAGGGAGGCAGGG + Intronic
1001089411 5:168726404-168726426 CAGGGAGGCAGAGGGAGGCAGGG + Intronic
1001089417 5:168726422-168726444 CAGGGAGGAAGAGGGAGGCAGGG + Intronic
1001089450 5:168726502-168726524 CAGGGAGGGAGAGGGAGGCAGGG + Intronic
1001285274 5:170418503-170418525 GAGGGGGAAGCAGGGAGCCAAGG - Intronic
1001398979 5:171435622-171435644 CATGGGGAAAGAAGGAGGCCTGG - Intronic
1001408713 5:171495304-171495326 CAGAGGGAGGGAGGGAGGGAGGG + Intergenic
1001456191 5:171862121-171862143 CAGGGGGAAGGGAGGGGGCAGGG - Exonic
1001828265 5:174764241-174764263 AAGGGGGAGGAAGGGAGGCAAGG + Intergenic
1001946899 5:175786745-175786767 CAGAGGGAAGGAGGGAGGCAAGG - Intergenic
1001955997 5:175848501-175848523 GAGAGGGCACGAGGGAGGCATGG + Intronic
1002017437 5:176336068-176336090 AAGGGAGAGGGAGGGAGGCAGGG + Intronic
1002030754 5:176428224-176428246 GAGGGGGAGGGAGGGAGGGAGGG - Intergenic
1002173499 5:177388236-177388258 CAGGGGGAGTGAAGGAGGCTGGG - Intronic
1002199179 5:177517444-177517466 CAGGCGCAGTCAGGGAGGCAGGG - Exonic
1002400495 5:178989185-178989207 GAGGGGGAAGGCGGGAGGCCGGG - Intronic
1002575667 5:180172426-180172448 CAGGGGTCATGAGGCAGCCAAGG + Intronic
1002789685 6:427971-427993 GAGGGGGAAGCAGGGAGGCTCGG - Intergenic
1002825373 6:768098-768120 GAGAGGGAAGGAGGGAGGGAAGG - Intergenic
1002852678 6:1010528-1010550 GAGGGGAAATGAGGGAAGAAGGG - Intergenic
1002917718 6:1542191-1542213 GGGAGGGAAGGAGGGAGGCAGGG + Intergenic
1002930553 6:1631646-1631668 GAAGGGGAGTGAGGGAGGGAGGG - Intronic
1003160561 6:3630544-3630566 CAGGGAGGAACAGGGAGGCAGGG - Intergenic
1003163358 6:3654992-3655014 CAGTTGGAAGGAGGGAGTCAGGG + Intergenic
1003315858 6:5011362-5011384 CAGGAGGAAGGAGGAAGGGAGGG + Intergenic
1003540002 6:7010225-7010247 GAGAGGGAGGGAGGGAGGCAGGG + Intergenic
1003725036 6:8751866-8751888 GAGAGGGAAGGAGGGAGGGAGGG - Intergenic
1003856843 6:10285009-10285031 CAGGGTGAATGAAGGAGACCAGG + Intergenic
1003860812 6:10320084-10320106 CAGAGGGAGGGAGGGAGGGAGGG - Intergenic
1003961161 6:11210741-11210763 GAGAGGGAAGGAGGGAGGGATGG + Intronic
1003983072 6:11407862-11407884 CAGGGTAAATGAGGAATGCAGGG + Intergenic
1004017233 6:11743466-11743488 CAAGGGGGCTGAGGGAGGGAGGG - Intronic
1004360696 6:14968149-14968171 GAGTGGGAGTGAGGGAGGCAGGG + Intergenic
1004463546 6:15862035-15862057 CAGGGGCACAGAGGGAGTCAGGG + Intergenic
1005379356 6:25217792-25217814 CAGAGGGAGAGAGGGAGACAGGG + Intergenic
1005441444 6:25873516-25873538 CAGTGGGAAGGAGGGAATCAGGG - Intronic
1005966859 6:30732737-30732759 CCGGGGGAAGGTAGGAGGCAGGG - Intronic
1006098492 6:31671021-31671043 CAGGGGCAGGGAGGGAGGAAGGG + Intronic
1006166633 6:32069194-32069216 CAGGAGGAGTGAGGGAGGAGAGG + Intronic
1006449683 6:34098926-34098948 CAGAGGGAGGGAGGGAGGGAAGG - Intronic
1006453737 6:34120357-34120379 CTGTGGGGGTGAGGGAGGCAAGG + Intronic
1006611419 6:35296582-35296604 CAGGGGGAAGAAGGGATACAGGG + Intergenic
1006723222 6:36174160-36174182 GGGGGGGAAGGAGGGAGGGAGGG + Intergenic
1006812335 6:36827982-36828004 CAAGGGGAAGCAGGGAGGAAAGG - Intronic
1006817711 6:36864151-36864173 GGTGGGGAAAGAGGGAGGCAAGG - Intronic
1007082326 6:39116486-39116508 GAGGGGGAGAGAGGGAGGGAGGG + Intergenic
1007127109 6:39434685-39434707 GAGAGGGAGGGAGGGAGGCAGGG + Intronic
1007231634 6:40352185-40352207 CAGGGAGAGGGAGGGAGGCATGG - Intergenic
1007414648 6:41684468-41684490 CAACGGGGAGGAGGGAGGCAGGG + Exonic
1007427919 6:41759258-41759280 CAGGGGGAATGATCCAGGCAGGG + Intergenic
1007472341 6:42099079-42099101 CAAGGGGAAGGAGGGAGGAGTGG + Intergenic
1007700045 6:43761146-43761168 AAGGAGGACAGAGGGAGGCACGG - Intergenic
1007716730 6:43860463-43860485 CAGGGGGTGGGAGTGAGGCAAGG + Intergenic
1007834593 6:44664843-44664865 CAGGAGGAAAGAGGGAGGGAGGG + Intergenic
1007941381 6:45784851-45784873 CAGAGGGAAGGAGGGAGGATAGG - Intergenic
1008147336 6:47907728-47907750 CAGGGGAACAGAGGTAGGCATGG - Intronic
1008386906 6:50902352-50902374 AAGGGGGAGGGAGGGAGGAAAGG + Intergenic
1008612826 6:53200019-53200041 AAGGGGGAGGGAGGGGGGCATGG - Intergenic
1008837984 6:55860962-55860984 CAGGGGCAATGAGTGAGCTATGG + Intronic
1009430272 6:63558272-63558294 AAGGGGGAAGGAGGGAGGGATGG + Intronic
1009445626 6:63739058-63739080 GGGGAGGAAGGAGGGAGGCAGGG - Intronic
1010073702 6:71774513-71774535 CAGGGAGAAAGAGGCAAGCAAGG - Intergenic
1011169257 6:84487773-84487795 CAGGGATAAAGAGGGAGGAATGG + Intergenic
1011175895 6:84559873-84559895 GAGAGGGAAGGAGGGAGGGAGGG - Intergenic
1011719870 6:90144366-90144388 CAGAGGGAAGGAGGGAGGGAGGG + Intronic
1011822790 6:91272638-91272660 AAGAGGGAAGGAGGGAGGGAGGG - Intergenic
1012806398 6:103898850-103898872 GAGAGGGAAGGAGGGAGGGAAGG + Intergenic
1013424034 6:109994471-109994493 CAGAGGGAATCAGGGAGGCAGGG + Intergenic
1013424440 6:109998251-109998273 GAGAGGGAAGGAGGGAGGGAGGG + Intergenic
1013608542 6:111773386-111773408 GAGGGGGAGGGAGGGAGGGAGGG + Intronic
1013766282 6:113577990-113578012 GTGAGGGAAGGAGGGAGGCAGGG - Intergenic
1014575016 6:123059043-123059065 CTGGAGGAGAGAGGGAGGCAGGG - Intronic
1014999190 6:128192928-128192950 GAGGGGGAAGGAGGGAAGGAGGG + Intronic
1015190230 6:130464238-130464260 CGGGGAGAGTGAGGGAGGCAGGG - Intergenic
1015373512 6:132483149-132483171 GAGGTGGATGGAGGGAGGCATGG - Intronic
1015944930 6:138489932-138489954 CAGGGGGAGAGAGGGAGAGAAGG + Intronic
1016013621 6:139163026-139163048 CAGCGGGAATGATGGAGGGCAGG - Intronic
1016096541 6:140044705-140044727 AAGGGGGAGGGAGGGAGGGAAGG + Intergenic
1016317709 6:142808515-142808537 CAGAGGGAAGGAGGGAGGGAGGG + Intronic
1016471332 6:144377556-144377578 CAGGTGGCAAGAGTGAGGCATGG + Intronic
1017138871 6:151172273-151172295 GAGGGGGAGGGAGGGAGGGAGGG - Intergenic
1017258901 6:152364628-152364650 CAGGGGGAAGGAAGGAAGAAAGG + Intronic
1017416750 6:154228971-154228993 CTAGGGGAATGAGGTAGGAAGGG - Intronic
1017625307 6:156341669-156341691 CGGGGAGAAAGAGGGAGGGACGG - Intergenic
1018223045 6:161600783-161600805 AAAGGGGAATCAGGGAGGAAGGG - Intronic
1018301608 6:162408981-162409003 CAGGGGGAGTGGGAGAGGCAGGG - Intronic
1018322909 6:162632498-162632520 AAGGAGGAGGGAGGGAGGCATGG + Intronic
1018341044 6:162851258-162851280 CAGGGTGCAGAAGGGAGGCAAGG - Intronic
1018461683 6:164004722-164004744 GAGGGGGGATGGGGGAGGGAAGG + Intergenic
1018533430 6:164793294-164793316 CATGGAGAAAGAGGGAGGCATGG + Intergenic
1018861224 6:167712257-167712279 GAGGGGGAATGAGGGTGGCTGGG + Intergenic
1019196236 6:170284736-170284758 CCTGGGGAATGAGAGAGGCCAGG - Intronic
1019209987 6:170397301-170397323 CAGAGAGAGTGAGGGAGGGATGG - Intronic
1019315077 7:380549-380571 CAGGGGGACAGAGGGAGGCAGGG + Intergenic
1019315092 7:380579-380601 CAGGGGGACAGAGGGAGGGAGGG + Intergenic
1019315107 7:380609-380631 CAGGGGGACAGAGGGAGGGAGGG + Intergenic
1019315122 7:380639-380661 CAGGGGGACAGAGGGAGGGAGGG + Intergenic
1019315135 7:380669-380691 CAGGAGGACAGAGGGAGGGAGGG + Intergenic
1019333764 7:473099-473121 CAGGGGGATTGCTGGAGGCCAGG - Intergenic
1019416714 7:931029-931051 CGGAGGGACTGAGGGAGGGAGGG + Intronic
1019497664 7:1347955-1347977 CAGGGGTAGAGAAGGAGGCAGGG + Intergenic
1019513924 7:1431526-1431548 GAGGGACAAGGAGGGAGGCAAGG - Intronic
1019550077 7:1597772-1597794 CAGGGGGTCTGTGGGGGGCAGGG + Intergenic
1019730576 7:2627382-2627404 AAGAGGGAAGGAGGGAGGGAAGG + Intergenic
1019825290 7:3279458-3279480 CAGAGGGAAAGAGAGAGGGAGGG + Intergenic
1019932111 7:4230469-4230491 CAGGGGGAAGGAAGGAGGGAGGG + Intronic
1019939014 7:4274526-4274548 CAGAGTGAATGGGGAAGGCAGGG - Intergenic
1020114055 7:5465671-5465693 AAGGGGGAGAGAGGGAGGGAGGG + Intronic
1020202821 7:6093603-6093625 GTGGGGGAAGGAGGGAAGCAAGG - Intergenic
1020499866 7:8904041-8904063 GAGAGGGAAGGAGGGAGGGAGGG + Intergenic
1020817214 7:12920502-12920524 CGGGGGGAGGGAGAGAGGCAGGG - Intergenic
1020877241 7:13713465-13713487 CAGAGGGAGGGAGGGAGGGAAGG + Intergenic
1021134134 7:16944977-16944999 CAGGGGGAAAGAGGGAGTAGAGG + Intergenic
1021179092 7:17485170-17485192 GAGAGGGAATGAGGGAGAGAAGG - Intergenic
1021447505 7:20749200-20749222 GAGGGGGAGGGAGGGAGGGAGGG - Intronic
1021697120 7:23286330-23286352 GAGGGGGAAGGAGGGAGGAGAGG - Intergenic
1021799231 7:24287450-24287472 CAGGGGGAATGCTGGTGGCGGGG - Intronic
1021819271 7:24480174-24480196 CAGGGGGAAATAGGCAGGCCTGG - Intergenic
1021971076 7:25966656-25966678 AAGGGGGAGTGAGGGAGAGAGGG + Intergenic
1022096163 7:27142883-27142905 GAGGAGGAAGGAGGAAGGCAGGG + Intronic
1022420889 7:30222614-30222636 GGGTGGGAATGAGGTAGGCAAGG - Intergenic
1022703757 7:32784557-32784579 AATGGTGAATGAGGGAGGAAGGG + Intergenic
1022907998 7:34874683-34874705 AATGGTGAATGAGGGAGGAAGGG + Intronic
1022961908 7:35435230-35435252 AAGGGGGAGGGAGGGAGGAAAGG + Intergenic
1023025128 7:36042947-36042969 CAGAGATTATGAGGGAGGCAGGG - Intergenic
1023053981 7:36277179-36277201 CAGGTGGAACAGGGGAGGCAGGG - Intronic
1023183489 7:37510219-37510241 CAGAGGGCAGGAGGGAGTCAAGG - Intergenic
1023424283 7:40018756-40018778 AAGGGGGAGAGTGGGAGGCAGGG + Intronic
1023728456 7:43167623-43167645 CAGGAGGAATAAGGGAGGAAAGG + Intronic
1023761125 7:43466041-43466063 AAGGGGGAAGGAGGGAGGGAGGG + Intronic
1023831042 7:44039163-44039185 CAGGTGGACTGAGGAAGGCAGGG + Intergenic
1023862188 7:44223468-44223490 CAGGTGGAATGGGGCAGGAATGG - Intronic
1023903691 7:44505585-44505607 GAGGGGGAGGGAGGGAGGGAGGG + Intergenic
1024228940 7:47349498-47349520 CAGGAAGAATGGGGGAGTCAAGG + Intronic
1024531123 7:50393434-50393456 AAGGGGGAAGGACAGAGGCAAGG + Intronic
1025117152 7:56268249-56268271 CAGAGGGAGGGAGGGAGGAAAGG - Intergenic
1025146984 7:56513895-56513917 AAGGGGGAGGGAGGGAGGGAAGG - Intergenic
1025626905 7:63230830-63230852 CAGAGGGAGGGAGGGAGGGAGGG + Intergenic
1025913410 7:65846408-65846430 TGGGGGGAGTGAGGGAGGAAAGG - Intergenic
1026034217 7:66819479-66819501 CGGGGTGAATGAGGGAAGGATGG - Intergenic
1026149199 7:67773728-67773750 AAGGGAGAAAGAGGGAGGGAGGG - Intergenic
1026261389 7:68758797-68758819 GAGAGAGAGTGAGGGAGGCAGGG + Intergenic
1026304136 7:69125229-69125251 CAGGGGGAAGGGGGGCGGCTAGG + Intergenic
1026475968 7:70735572-70735594 CACAGGGAATGAGGAAGACAGGG - Intronic
1026478000 7:70753414-70753436 CAGGGGGAATGATGGGTGCTTGG - Intronic
1026833039 7:73621845-73621867 GAGGGAGAAGGAGGGAGGGAGGG - Intronic
1026833542 7:73623953-73623975 AAGAGGGAATGGGGGAGGAATGG + Intronic
1026901077 7:74037854-74037876 CAGGAGGAAGGAGGGAGGTGTGG + Intronic
1026985387 7:74552053-74552075 CAGGGTGAGTGAGGGAAGGATGG + Intronic
1027035588 7:74922809-74922831 AGGAGGGGATGAGGGAGGCAGGG + Intergenic
1027416864 7:77983332-77983354 CAGAGGGAGGGAGGGAGGGAAGG - Intergenic
1027485558 7:78757281-78757303 GAGGGAGAAGGAGGGAGGGAGGG - Intronic
1027849129 7:83426527-83426549 TAGAGGGAGTGAGGGAGGCAAGG + Intronic
1027886595 7:83915007-83915029 CAGGTGGAGGGAGGGATGCATGG - Intergenic
1028424701 7:90673413-90673435 CAGAGGGAGGGAGGGAGGGAGGG - Intronic
1028741690 7:94282575-94282597 AAGGGGGAATGAGAGAGAAAAGG - Intergenic
1029216446 7:98953886-98953908 GAGTGGGAATGGGGGAGGAAGGG - Intronic
1029300796 7:99580922-99580944 GAGAGGGAAGGAGGGAGGGAGGG - Intronic
1029371204 7:100151929-100151951 CAGGAGGAATGCTGGAGGCCAGG - Intronic
1029394470 7:100298328-100298350 AGGAGGGGATGAGGGAGGCAGGG - Intergenic
1029531371 7:101127461-101127483 CAGAGGGACTGAGAGAGTCAAGG - Intronic
1029741368 7:102493468-102493490 CAGGTGGACTGAGGAAGGCAGGG + Intronic
1029759358 7:102592637-102592659 CAGGTGGACTGAGGAAGGCAGGG + Intronic
1029776727 7:102688547-102688569 CAGGTGGACTGAGGAAGGCAGGG + Intergenic
1030093300 7:105876590-105876612 AAGGGGGAGGGAGGGAGGAAGGG + Exonic
1030153390 7:106427766-106427788 CAAGGGGAGTGAAGGGGGCAGGG - Intergenic
1030159465 7:106492620-106492642 CAGAGGGAAGGAGGGAGGGAGGG + Intergenic
1030638278 7:111974653-111974675 CAGGGGGAAGTAGGCAGGCATGG + Intronic
1031957571 7:127957927-127957949 CAGGTGGAATGCTTGAGGCAAGG - Intronic
1031982843 7:128139941-128139963 AAGAGGGAGGGAGGGAGGCAGGG - Intergenic
1032061326 7:128727722-128727744 GATGGGGGATGAAGGAGGCATGG - Intronic
1032121383 7:129159714-129159736 CACGGAGCATGGGGGAGGCAGGG - Intronic
1032350614 7:131159570-131159592 AAGGGGGAGTGGGGGAGGAAGGG + Intronic
1032527358 7:132588876-132588898 AAGGGGGAAAGAGGTAGGGAAGG + Intronic
1032577266 7:133068593-133068615 CAGGGGGAAAGAGTGAAGCAGGG + Intronic
1032969317 7:137140508-137140530 GAGGGGGTATGAGAGGGGCATGG + Intergenic
1033362374 7:140646847-140646869 GAGATGGAATGAGAGAGGCAGGG - Intronic
1033551839 7:142454728-142454750 CTGGGGGAATGGAGGAGGCTGGG + Intergenic
1033577582 7:142701112-142701134 CTGAACGAATGAGGGAGGCAGGG - Intergenic
1033651399 7:143346365-143346387 CTGGGGGATTGAGGGAGGACAGG + Intronic
1033685473 7:143636539-143636561 GAGGGGGAAGCAGGGAGGGAGGG - Intronic
1033688643 7:143715757-143715779 GAGGGGGAAGCAGGGAGGGAGGG - Intronic
1033699141 7:143821081-143821103 GAGGGGGAAGCAGGGAGGGAGGG + Intergenic
1034352459 7:150426043-150426065 GAGGGGGAGGGAGGGAGGGAGGG - Intergenic
1034394777 7:150813852-150813874 CAGGGGGAATAAAGCTGGCATGG + Intergenic
1034431236 7:151042184-151042206 CAGTGGGACTGAGGGCAGCAGGG + Intronic
1034789245 7:153953019-153953041 CAGAGGGAAGGTGGGAGGAAGGG + Intronic
1034911552 7:155002641-155002663 CCGGGGGAGTGCGGGAGGGAAGG - Intronic
1034975486 7:155446873-155446895 AAAGGGGAAGGAGGGAGGGAGGG + Intergenic
1035024922 7:155818988-155819010 CAGGGAGAATGTGTGGGGCAGGG + Intergenic
1035534046 8:377733-377755 CAGTGGGGATGATGGAGGGAAGG - Intergenic
1036126570 8:6068489-6068511 CAGAGGGAATGAAGGAGGGAAGG - Intergenic
1036338720 8:7895801-7895823 GAGGGGGAGGGAGGGAGGGAGGG + Intronic
1036612982 8:10365995-10366017 GCAGGGGAATGAGGCAGGCAAGG - Intronic
1036914301 8:12790123-12790145 CAGGGAGAATGGGAGAGACACGG - Intergenic
1036963751 8:13273730-13273752 AAGGGGGAAGGGGGGAGGGAGGG + Intronic
1036970053 8:13345418-13345440 GAGTGGCAATGAGGGAGGGAAGG + Intronic
1037098035 8:15008747-15008769 GAGGGGGGAGGAGGGAGGGACGG + Intronic
1037128958 8:15384707-15384729 CAAGGAGCATGAGGGAGGCAGGG - Intergenic
1037169433 8:15873952-15873974 GAAGGAGAAGGAGGGAGGCAGGG - Intergenic
1037564200 8:20103680-20103702 CAGCGGGAACGAGGGAGGGTGGG + Intergenic
1037859198 8:22392779-22392801 CAGGAGGAGGGAGGGAGGGAGGG - Intronic
1037867436 8:22457085-22457107 GAGGGGGAAGGAGGGAAGGAAGG - Intronic
1037927401 8:22854568-22854590 CTGGGGCAATGAGGGAGCAAAGG + Intronic
1037985271 8:23287131-23287153 CAGGCGGGATGGGGGAGGGAGGG - Intronic
1038162479 8:25052999-25053021 CAGGCAGAATGGGGAAGGCAGGG - Intergenic
1038262928 8:26013308-26013330 CAGGAGGAAAGAGTGTGGCAAGG - Intronic
1038276849 8:26128276-26128298 GAGGAGGAAGGAGGGAGGGAAGG + Intergenic
1038425721 8:27462669-27462691 CTGGCGGCGTGAGGGAGGCACGG + Intronic
1038475331 8:27862324-27862346 CTGGGAGAATGATGGAGGGAGGG - Intergenic
1038517192 8:28197213-28197235 GAGGTGAAATAAGGGAGGCAGGG - Intergenic
1038770598 8:30475733-30475755 GAGGAGGAAGGAGGGATGCAGGG + Intronic
1039190517 8:34968598-34968620 GAGTGAGAAAGAGGGAGGCAGGG + Intergenic
1039277443 8:35948874-35948896 CAGAGGGAAGGAGGGAGGGAAGG + Intergenic
1039352984 8:36782396-36782418 AAGAAGGAAGGAGGGAGGCAGGG - Intergenic
1039401007 8:37269186-37269208 CATAGTGAATGAGGGAGGAAAGG - Intergenic
1039465640 8:37783401-37783423 CTGGAGGAGTGAGGGAAGCAGGG + Intergenic
1039781650 8:40792535-40792557 CAGAGGGAGGGAGGGAGGGAAGG + Intronic
1040057486 8:43072496-43072518 CAGGAGGATTGAGTGAGGCCAGG + Intronic
1041038082 8:53816222-53816244 CATGTGGAAGGAGGGAGGGAGGG + Intronic
1041098116 8:54369821-54369843 AGGGGGGAGGGAGGGAGGCAAGG - Intergenic
1041120205 8:54578912-54578934 GAAGGGGGATGAGGCAGGCATGG - Intergenic
1042171931 8:66000079-66000101 CAGAGGGAGGGAGGGAGGGAGGG - Intergenic
1043037748 8:75218985-75219007 AAGGGGGAAGGAGGGAAGGAGGG + Intergenic
1043084387 8:75810682-75810704 GAGGGGGAAGGAGAGAGGGAAGG - Intergenic
1043998403 8:86847585-86847607 GAGAGGGAAGGAGGGAGGGAGGG + Intergenic
1044058730 8:87605714-87605736 CAGGGGGAAGGTGGGGGGGAGGG + Intronic
1044231960 8:89788806-89788828 GAGAGGGAGGGAGGGAGGCAGGG + Intronic
1044542994 8:93428891-93428913 CATGGGGAGGGAGGGAGGGAGGG - Intergenic
1044778170 8:95715565-95715587 GAGAGGGAAGGAGGGAGGTAGGG - Intergenic
1044811147 8:96063534-96063556 AGAGGGGAATGAGGTAGGCAAGG - Intergenic
1045043168 8:98246810-98246832 CAGGGGCAAGGAGGGAGGGAGGG - Intronic
1045285085 8:100783604-100783626 GAGAGGGAAGGAGGGAGGGAGGG - Intergenic
1045325589 8:101115470-101115492 AAAGGGGAAGGAGGGACGCAAGG - Intergenic
1045348226 8:101314238-101314260 CAGATGGCATGAGGGAGGGATGG + Intergenic
1045647584 8:104314815-104314837 CAGGGGCAGTGAGTGAGGCCTGG - Intergenic
1046106275 8:109670857-109670879 AAGAGGGAAGGAGGGAGGGAGGG + Intronic
1046181020 8:110647777-110647799 CAAGAGGCAGGAGGGAGGCATGG + Intergenic
1046483241 8:114851113-114851135 GAGGGGGAAGGAAGGAGGGAAGG + Intergenic
1046834096 8:118780073-118780095 CAGAGAGAAGGAGGGAGGGAAGG - Intergenic
1046854161 8:119010172-119010194 CAGGGGTTAGGAGGGAGGGAGGG - Intronic
1047434628 8:124825922-124825944 CAGGGGCTAGGAGAGAGGCATGG - Intergenic
1047517253 8:125565825-125565847 AAGAGGGAATGAGCCAGGCATGG - Intergenic
1047720632 8:127635695-127635717 GAGGAGGAATGAAGGATGCATGG + Intergenic
1047921509 8:129639413-129639435 GAGGGAGAATCAGGGAGGTATGG + Intergenic
1048054101 8:130846973-130846995 CAGAAGGAAAGAGGGAGGGAGGG - Intronic
1048117733 8:131544296-131544318 GAGTGGGAATGATGGAGGCTTGG - Intergenic
1048165595 8:132059028-132059050 GAGAGGGAAAGAGGGAGGAAGGG - Intronic
1048170840 8:132104709-132104731 CAGGGATGGTGAGGGAGGCAGGG + Intronic
1048214320 8:132481100-132481122 CCCGGGGAAGGAGGGAGGGAGGG - Intergenic
1048363182 8:133715431-133715453 GAGGGGGAGAGAGGGAGGGAGGG - Intergenic
1048445124 8:134487602-134487624 GTGGGGGAAGGAGTGAGGCAGGG - Intronic
1048451091 8:134534629-134534651 CAGGGGGAGAGAGGGAGAGAGGG + Intronic
1048709668 8:137195216-137195238 GAGCGGGAAGGAGGGAGGCAGGG + Intergenic
1048951829 8:139502685-139502707 CAGGGGGACTGTGGGGAGCAAGG + Intergenic
1049010270 8:139882651-139882673 CAGGGGGTAGGAGGGTGGCGAGG + Intronic
1049363436 8:142225142-142225164 CTGGGGGGAGGGGGGAGGCAGGG - Intronic
1049549819 8:143252033-143252055 CAGTGGGCATGAGAGAGGCTGGG - Intronic
1049664188 8:143835730-143835752 CCTGCGGAAGGAGGGAGGCATGG + Exonic
1049775290 8:144401154-144401176 CAGGGGGAGGGAGGGTGGCTGGG + Intronic
1050309739 9:4340567-4340589 CAGCAGGAATGAGGGAGTGAGGG + Intronic
1050527994 9:6562947-6562969 GAGGGGGAAAGGGAGAGGCAGGG - Intronic
1050969083 9:11846317-11846339 GATGGGGAAGGAGGGAGGGAGGG - Intergenic
1051613077 9:18980528-18980550 CGGGGGGAGGGAGGGAGGGAGGG + Intronic
1051846745 9:21459604-21459626 GTGGGGGAATGGGGGAGGGATGG + Intergenic
1052291163 9:26842778-26842800 CAGGGGAAAAGAGGGTGGCATGG - Intronic
1052833159 9:33231770-33231792 GAGTGGGAATAAGGAAGGCAGGG - Intronic
1052976696 9:34416257-34416279 AAGGGGGAGGGAGGGAGGGAAGG + Intronic
1053000422 9:34574574-34574596 AAGGGGCCAGGAGGGAGGCAGGG + Intronic
1053020590 9:34691395-34691417 CAGGGGGAAGAAGGGGGGCAGGG - Intergenic
1053308260 9:36999354-36999376 CTGGGGGAAAGAGTAAGGCAGGG - Intronic
1053337260 9:37286878-37286900 GAGGGGGAGGGAGGGAGGGAAGG - Intronic
1053337297 9:37286947-37286969 GAGGGGGAGGGAGGGAGGGAAGG - Intronic
1053514743 9:38721259-38721281 AAGGAGGAAAGAGGGAGGAAGGG - Intergenic
1055074234 9:72197274-72197296 CAGGGAGAGGGAAGGAGGCAAGG - Intronic
1055186049 9:73455426-73455448 GAGGGGGAGGGAGGGAGGAAGGG - Intergenic
1055294611 9:74821386-74821408 CAGGGGGAGTGAGGGAGGTGTGG - Intronic
1055782018 9:79830616-79830638 AAGAGGGAAGGAGGGAGGGAGGG - Intergenic
1055861727 9:80758551-80758573 CAGAGAGAATGAATGAGGCAGGG + Intergenic
1055976610 9:81961651-81961673 CAGTGGGAGTGAAGGAAGCAGGG - Intergenic
1056261688 9:84855054-84855076 CATGGGGAATGAGGCAGGGAGGG + Intronic
1056474853 9:86944057-86944079 CAGGGGAAAAGGGGGAGGCGGGG + Intergenic
1056685570 9:88756304-88756326 CAGGAGGATTGAGTGAGCCATGG - Intergenic
1056693601 9:88828028-88828050 CAGGAGGAAAGAGGTAGGAAAGG + Intergenic
1056874219 9:90312476-90312498 CAGGGGGACTGACAGAGACAGGG - Intergenic
1056932755 9:90892515-90892537 GAGGGGGAAGGAGTGAAGCATGG - Intronic
1057026510 9:91737987-91738009 CAGGGGTTATGAGGGAGGGAGGG + Intronic
1057044256 9:91872747-91872769 CAGTAGAAATGAGGAAGGCATGG + Intronic
1057321179 9:94014435-94014457 CAGGGGGAGGGAGGGAGGAAAGG - Intergenic
1057959399 9:99439953-99439975 GAGAGGGAAGGAGGGAGGGAAGG + Intergenic
1058054402 9:100435117-100435139 CAGAGGGAATGAGGCAGGGCCGG + Intronic
1058136718 9:101315891-101315913 GAGGCGGAATGTGGGAGGAAGGG + Intronic
1058177994 9:101760491-101760513 CTGTGGGAAAGAGGGAGGGATGG + Intergenic
1059450446 9:114368316-114368338 CCAGGGGAAGGAGGGAGGCAAGG - Intronic
1059739768 9:117138339-117138361 CTGGGGGAAAGAAAGAGGCATGG + Intronic
1059801092 9:117750224-117750246 CAGGAGGCATAAGGAAGGCAGGG + Intergenic
1059926776 9:119217778-119217800 TAAGAGGAAGGAGGGAGGCAAGG - Intronic
1060228288 9:121809392-121809414 TAGGAGGAATAAGGGAGGGAGGG - Intergenic
1060331362 9:122673885-122673907 CACGGGGAATGAGAGAGTGAGGG - Intergenic
1060411032 9:123400408-123400430 CAGATGGAATGATGGAGGGATGG + Intronic
1060435016 9:123585846-123585868 TAGGGGGAGTGAGAGAAGCAGGG - Intronic
1060542596 9:124440908-124440930 CAGGCGGAAGGTGTGAGGCATGG + Intergenic
1060674118 9:125496887-125496909 CAGGGGGAAAGAGCCAGGCCTGG + Intronic
1060948017 9:127581804-127581826 CATGGGGAGAGAGGGAGGGAGGG - Intergenic
1060948039 9:127581885-127581907 CATGGGGAGAGAGGGAGGGAGGG - Intergenic
1060948048 9:127581912-127581934 CATGGGGAGAGAGGGAGGGAGGG - Intergenic
1060948080 9:127582016-127582038 CATGGGGAGAGAGGGAGGGAGGG - Intergenic
1060948089 9:127582043-127582065 CATGGGGAGAGAGGGAGGGAGGG - Intergenic
1060948887 9:127588073-127588095 AAAGGGGAGGGAGGGAGGCAAGG - Intergenic
1060952519 9:127612853-127612875 GAGGGGGAAGGAGGGTGGGATGG - Intronic
1060965029 9:127707467-127707489 CATGGGGCAGGAGTGAGGCAGGG - Intronic
1061064910 9:128271601-128271623 TATGGGGAGTGGGGGAGGCAGGG - Intronic
1061217593 9:129230909-129230931 CAGGGGGATTGCTGGAGGCCGGG - Intergenic
1061220309 9:129246704-129246726 CAGAGGGACAGAGGGAGGCGCGG + Intergenic
1061339222 9:129965795-129965817 AGGGGGGAAGGAGGGAGGGAGGG + Intronic
1061440523 9:130600115-130600137 GAGGGGGAAAGAGGGAGGGAGGG - Intronic
1061486685 9:130923873-130923895 CCGGGAGCCTGAGGGAGGCAAGG + Exonic
1061494246 9:130962653-130962675 CAGAGGGACTGAGGGAGGAGGGG + Intergenic
1061495405 9:130971071-130971093 CAGGAGGGAGGAGGGAGGAAGGG + Intergenic
1061505990 9:131032177-131032199 TAGGAGGGAGGAGGGAGGCAGGG + Intronic
1061634859 9:131901083-131901105 GAGAGAGAATGAGGGAGGGAGGG + Intronic
1061780948 9:132995835-132995857 CAGAGGGAATGCGGGGTGCAGGG - Intergenic
1061817623 9:133206209-133206231 CACGGGGAATGCGGGGGACATGG + Intronic
1061923575 9:133795208-133795230 CAAGGGGAGAGAGGGAGGCATGG + Intronic
1062008511 9:134254387-134254409 GAGGGAGAAGGAGGGAGGGAGGG + Intergenic
1062050470 9:134444319-134444341 GAAGGGGAAGGAGGGAGGGAGGG - Intergenic
1062050496 9:134444380-134444402 GAGGGGGAAGGAAGGAGGGAGGG - Intergenic
1062050528 9:134444460-134444482 AAGAGGGAAAGAGGGAGGCAGGG - Intergenic
1062050549 9:134444519-134444541 GAGGGGGAAGGAGGGAGGGACGG - Intergenic
1062050625 9:134444713-134444735 AAGGGGGAAGGAAGGAGGGAGGG - Intergenic
1062080841 9:134622598-134622620 GAGGGGGAAGGAAGGAGACAGGG - Intergenic
1062080872 9:134622697-134622719 GAGGGGGAAGGAAGGAGACAGGG - Intergenic
1062080903 9:134622798-134622820 GAGGGGGAAGGAAGGAGACAGGG - Intergenic
1062144030 9:134979002-134979024 GAGAGGGAGGGAGGGAGGCAGGG + Intergenic
1062242749 9:135548890-135548912 CACGGGGAATGCGGGGGACATGG - Intronic
1062348341 9:136125905-136125927 CAGGGGCCATCAGGGAGGCATGG + Intergenic
1062405182 9:136392881-136392903 CAGGGAGGGTGAGGGAGGCTCGG - Intronic
1062588672 9:137263349-137263371 AAGGGAGAAGGAGGGAGGGAGGG - Intronic
1062588703 9:137263428-137263450 TGGGGGGAAGGAGGGAGGGAGGG - Intronic
1062601202 9:137319356-137319378 CAGGGCCAAAGAGGTAGGCACGG - Intronic
1203364379 Un_KI270442v1:244022-244044 GAGAGGGAAGGAGGGAGGGAGGG + Intergenic
1203364403 Un_KI270442v1:244076-244098 ACGGGGGAAAGAGGGAGGGAGGG + Intergenic
1203365151 Un_KI270442v1:249577-249599 CAGAGGGAGGGAGGGAGACAGGG + Intergenic
1185479233 X:433751-433773 GAAGGGGAAGGAGGGAGGGAAGG + Intergenic
1185627586 X:1493375-1493397 AAGGAGGAAGGAGGGAGGGAGGG + Intronic
1185712339 X:2314266-2314288 AGGAGGGAATGAGGGAGGGAAGG + Intronic
1185712346 X:2314286-2314308 AGGAGGGAATGAGGGAGGGAAGG + Intronic
1185712351 X:2314298-2314320 GGGAGGGAAGGAGGGAGGCAGGG + Intronic
1185734296 X:2485610-2485632 CAGAGGGAAGGAAGGAGGGAGGG + Intronic
1185734306 X:2485635-2485657 GAGAGGGAAGGAGGGAGGGAGGG + Intronic
1185779164 X:2829936-2829958 CAGGGGCATCGGGGGAGGCAGGG + Intronic
1185861262 X:3581710-3581732 GAAGGGGAATGATGAAGGCAGGG + Intergenic
1186017850 X:5218151-5218173 GAGAGGGAAAGAGGGAGGGAGGG + Intergenic
1186291868 X:8109091-8109113 AAGGAGGAAGGAGGGAGGCAGGG - Intergenic
1186695179 X:12022861-12022883 TAGGGGGAAAGAGGGAGGATTGG - Intergenic
1186705039 X:12132056-12132078 AAGGGACAATGAGGGAAGCAAGG + Intergenic
1186911126 X:14167607-14167629 TAGGGGGAATGGGCGGGGCAGGG - Intergenic
1187137158 X:16559194-16559216 CAGGGAGAGAGAGGGAGGGAGGG - Intergenic
1187530226 X:20089833-20089855 AAGGGGGAACGAGGGAGGAGAGG - Intronic
1187561816 X:20410601-20410623 AAGAGAGAATGAGGGAGGGAGGG - Intergenic
1187672478 X:21682168-21682190 CCAGGGTAATGAGGGAGGCTGGG + Intergenic
1187882916 X:23862949-23862971 AAGGGAGAAGGAGGGAGGGAGGG + Intronic
1188297725 X:28470363-28470385 CAGAGGAAATGAGGTAGGGAGGG - Intergenic
1188517076 X:30999124-30999146 GAGAGGGAAGGAGGGAGGGAAGG - Intergenic
1189988863 X:46576146-46576168 GAGGGGAAATGAGAGAGGGAAGG - Intronic
1190063729 X:47226541-47226563 CAGCTAGAATGAGGGAGTCATGG - Intronic
1190397371 X:49998646-49998668 GAGAGGGAAGGAGGGAGGGAGGG - Intronic
1190429945 X:50369544-50369566 AGGAGGGAAGGAGGGAGGCAGGG - Intronic
1190472996 X:50801223-50801245 GAGGGAGAAGGAGGGAGGGAAGG + Intronic
1190510789 X:51172142-51172164 CAAGGGGAAGGAGGGACACACGG - Intergenic
1190599742 X:52078190-52078212 CAGGGGAGATGAGGGAGCGATGG + Intergenic
1190608451 X:52169685-52169707 CAGGGGAGATGAGGGAGCGATGG - Intergenic
1190686118 X:52875401-52875423 GAGGGGCAGTGGGGGAGGCAGGG + Intergenic
1190699453 X:52975985-52976007 GAGGGGCAGTGGGGGAGGCAGGG - Intronic
1190743507 X:53306336-53306358 CAGGGGTCCAGAGGGAGGCAGGG + Intronic
1190789033 X:53682789-53682811 CAGGGGAAATGGAAGAGGCAGGG + Intronic
1190789046 X:53682861-53682883 GGGGAGGAATGAGGAAGGCAAGG + Intronic
1190913326 X:54791267-54791289 GAGGCTGAATGAGGGAGGGAGGG - Intronic
1191090858 X:56619158-56619180 GAGAGGGAAGGAGGGAGGAAAGG + Intergenic
1191689978 X:63929632-63929654 CAGGTGCAGGGAGGGAGGCACGG + Intergenic
1192048543 X:67701937-67701959 AAGGGTGAAGAAGGGAGGCAGGG + Intronic
1192202573 X:69076132-69076154 CAGTGGGAATTTGGCAGGCAGGG + Intergenic
1192219361 X:69186707-69186729 GAGGGGGAATGAGGGTGCTAGGG + Intergenic
1193037845 X:76972758-76972780 GAGGGGGGCTGTGGGAGGCAGGG + Intergenic
1194690265 X:96975983-96976005 GAGAGGGAAGGAGGGAGGGAGGG - Intronic
1194831279 X:98625264-98625286 AAGAGGGAAGGAGGGAGGGAGGG - Intergenic
1195234892 X:102887748-102887770 AAGAGGGAAGGAGGGAGGGAGGG - Intergenic
1195329014 X:103781212-103781234 CATGGGAAAGGAGGGAGGGAGGG + Intronic
1195477684 X:105304999-105305021 CAGGAGGAAAGGGGGAGGGAAGG + Intronic
1195923263 X:110002907-110002929 CAGAGGGAAGGCGGGAGGCCGGG - Intronic
1195941952 X:110174380-110174402 GAGAGGGAAAGAGGGAGGGAGGG - Exonic
1195966648 X:110435110-110435132 GAGGAGGAAGGAGGGAGGGAGGG + Intronic
1196028146 X:111064439-111064461 GAGGGGGAGGGAGGGAGGGAGGG - Intronic
1197583935 X:128320496-128320518 GAGAGGGAGGGAGGGAGGCAGGG + Intergenic
1198036401 X:132805427-132805449 CAAGGGGGATGGGGGAGGCAGGG - Intronic
1198188373 X:134278580-134278602 GGGAGGGAATGAGGGAGGGAGGG - Intergenic
1199048334 X:143204384-143204406 CAGGGGGAAAAAGGGAAGTAGGG + Intergenic
1199296485 X:146164650-146164672 CAGAGGGAGGGAGGGAGGGAGGG + Intergenic
1199351736 X:146809994-146810016 GAGGGGGTTTGAGTGAGGCAAGG - Intergenic
1199352171 X:146814499-146814521 GAGGGGGTTTGAGTGAGGCAAGG + Intergenic
1199649280 X:149937929-149937951 CAGGGGCCAAGCGGGAGGCAGGG + Intronic
1199872593 X:151912701-151912723 ATGGGGGTATGAGGGTGGCACGG - Intronic
1201073587 Y:10170849-10170871 CAGAGGGAGGGAGGGAGACAGGG - Intergenic
1201074243 Y:10175186-10175208 CGGAGGGAAAGAGGGAGGGAGGG - Intergenic
1201452981 Y:14136190-14136212 GAGAGGGAAGGAGGGAGGGATGG - Intergenic
1201496320 Y:14594214-14594236 CAGAAGGAATGAGGGTGCCAGGG - Intronic
1201737418 Y:17283812-17283834 AGGAGGGAAAGAGGGAGGCAGGG - Intergenic
1201741128 Y:17325540-17325562 GAGAGGGAGGGAGGGAGGCAGGG + Intergenic
1201762796 Y:17557987-17558009 AAGGGGGAAAGAGGGAGGGAGGG - Intergenic
1201838756 Y:18348002-18348024 AAGGGGGAAAGAGGGAGGGAGGG + Intergenic
1202273886 Y:23096223-23096245 CAGAAGAAATGAGGGAGGGAGGG + Intergenic
1202275097 Y:23109720-23109742 CAGTGGGAAGAAGGCAGGCAGGG - Intergenic
1202290931 Y:23310969-23310991 CAGTGGGAAGAAGGCAGGCAGGG + Intergenic
1202292140 Y:23324454-23324476 CAGAAGAAATGAGGGAGGGAGGG - Intergenic
1202426882 Y:24729968-24729990 CAGAAGAAATGAGGGAGGGAGGG + Intergenic
1202428088 Y:24743442-24743464 CAGTGGGAAGAAGGCAGGCAGGG - Intergenic
1202442703 Y:24926649-24926671 CAGTGGGAAGAAGGCAGGCAGGG + Intergenic
1202443909 Y:24940126-24940148 CAGAAGAAATGAGGGAGGGAGGG - Intergenic