ID: 915078858

View in Genome Browser
Species Human (GRCh38)
Location 1:153337483-153337505
Sequence GGAATGAGGGAGGCAGGGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1936
Summary {0: 1, 1: 0, 2: 16, 3: 209, 4: 1710}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915078846_915078858 12 Left 915078846 1:153337448-153337470 CCTTGCCAATGGAGTGCTGGTAA 0: 1
1: 0
2: 0
3: 8
4: 101
Right 915078858 1:153337483-153337505 GGAATGAGGGAGGCAGGGTAGGG 0: 1
1: 0
2: 16
3: 209
4: 1710
915078847_915078858 7 Left 915078847 1:153337453-153337475 CCAATGGAGTGCTGGTAAACTAG 0: 1
1: 0
2: 1
3: 16
4: 92
Right 915078858 1:153337483-153337505 GGAATGAGGGAGGCAGGGTAGGG 0: 1
1: 0
2: 16
3: 209
4: 1710

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915078858 Original CRISPR GGAATGAGGGAGGCAGGGTA GGG Intronic
900002407 1:21899-21921 TGGAAGAGGGGGGCAGGGTAGGG - Intergenic
900022127 1:192423-192445 TGGAAGAGGGGGGCAGGGTAGGG - Intergenic
900069906 1:762787-762809 GGAGAGAGGGAGGGAGGGGAAGG + Intergenic
900084995 1:888626-888648 GGAAGGAGGGAGGGAGGGAAAGG + Intergenic
900124140 1:1062118-1062140 GGGATGTGGGAGGGAGGGAATGG - Intergenic
900124161 1:1062175-1062197 GGAGGGAGGGAGGGAGGGAAGGG - Intergenic
900182091 1:1315670-1315692 GGAGTGAGGGAGGCGGGGGACGG + Intronic
900292497 1:1929394-1929416 GGAGGGAGGGAGTGAGGGTAGGG + Intronic
900295864 1:1949122-1949144 GGAGGGAGGGAGGGAGGGAAGGG - Intronic
900295876 1:1949148-1949170 GAAAGGAGGGAGGGAGGGGAAGG - Intronic
900315108 1:2052425-2052447 GGAAGGAGGGAGGAAGAGGAAGG - Intronic
900470333 1:2850844-2850866 AGAAAGAGAGAGGCAGGGGAGGG + Intergenic
900471961 1:2859481-2859503 GGAAAGAGGGAGGAAGAGGAAGG + Intergenic
900471971 1:2859513-2859535 GGAAGGAGGGAGGAAGAGGAAGG + Intergenic
900471981 1:2859545-2859567 GGAAGGAGGGAGGAAGAGGAAGG + Intergenic
900522740 1:3113481-3113503 GGAAGGAGGGAGGGAGGGAGGGG + Intronic
900522742 1:3113485-3113507 GGAGGGAGGGAGGGAGGGGAGGG + Intronic
900550237 1:3250907-3250929 GGAAACTGGGAGGCAGGGCAGGG + Intronic
900552672 1:3264532-3264554 GCCAGGAGGGAGGCAGGGGAGGG + Intronic
900552733 1:3264686-3264708 GCCAGGAGGGAGGCAGGGGAGGG + Intronic
900681716 1:3920254-3920276 GGAAGGAGGGAAGGAGGGAAGGG - Intergenic
900697459 1:4021127-4021149 GGGTCGAGGGAGGCAGGGGATGG + Intergenic
900918572 1:5656209-5656231 GGAGAGAGGGAGGGAGGGGAGGG + Intergenic
901038890 1:6352356-6352378 GGAATGAGGGAGGTGGGGAGGGG - Intronic
901059419 1:6465288-6465310 AGAAAGAGGGAGGGAGGGCAGGG - Intronic
901144095 1:7053619-7053641 GGAGTGAGGGAGGAAGGGGAAGG - Intronic
901169970 1:7249958-7249980 GGAAGAGGGGAGGCAGCGTAAGG + Intronic
901178553 1:7323005-7323027 AGAAGGAGGGAGGGAGGGAAGGG - Intronic
901315393 1:8304040-8304062 GGACAGAGGGAGGCAGGTGATGG + Intergenic
901625461 1:10622171-10622193 GGAAGGGGGCAGGCAGGGCAGGG - Intronic
901626958 1:10630043-10630065 CCAGAGAGGGAGGCAGGGTATGG - Exonic
901755853 1:11441062-11441084 CGAATGCTGGAGGCAGGGCAGGG + Intergenic
902113741 1:14104140-14104162 GGGACGAGGGAGGAAGGGTCTGG + Intergenic
902114088 1:14106927-14106949 GGAAGGAGGGAGGGAGGGAAAGG - Intergenic
902160290 1:14524358-14524380 GGAAGCATGGAGGCAGGGTCAGG + Intergenic
902218594 1:14950315-14950337 GGACTGAGGGAGGGATGGGAGGG + Intronic
902232360 1:15036205-15036227 GGGGAGAGGTAGGCAGGGTAGGG - Intronic
902258480 1:15206352-15206374 GGAAGGAAGGAGGGAGGGTAGGG + Intronic
902262490 1:15237306-15237328 GGACAGAGGGAGGCAGGGCCAGG - Intergenic
902403876 1:16172624-16172646 GGAGTGAGGGCGGCAGGCCAAGG + Intergenic
902429518 1:16352301-16352323 GTAATGAGGGAGCCAGGGACAGG + Exonic
902512723 1:16975032-16975054 GGCAGGAAGGAGGCAGGGTCAGG + Intronic
902562656 1:17287408-17287430 GAAATGAGGGAGGTAGGGACAGG + Intergenic
902606691 1:17573105-17573127 AGGATGAGGCAGGCAGGGAAAGG - Intronic
902628304 1:17689477-17689499 GGAGAGAGGGAGGTAGGGGAAGG - Intronic
902688032 1:18091624-18091646 GGAAGGAGGGGGGCTGGGTGGGG - Intergenic
902689475 1:18101250-18101272 GGAAAGAGGAAGGGAGGGGAGGG - Intergenic
902694781 1:18132913-18132935 GGAGTGGGGGAGGGAGGGGACGG + Intronic
902759007 1:18568689-18568711 GGAAGGAGGGAGGGAAGGAAGGG + Intergenic
902833207 1:19030695-19030717 GGAGGGAGGGAGGGAGGGGAGGG + Intergenic
903022065 1:20401546-20401568 GGAATGAGAGAGCCCGGGTCAGG - Intergenic
903038867 1:20513380-20513402 GGAAGGAGGGAGGGAGGAGAGGG + Intergenic
903102788 1:21047571-21047593 GGGAAGAGGGAAGCAGGGTGGGG - Intronic
903282933 1:22260356-22260378 GGAGGGAGGGAGGGAGGGAAGGG - Intergenic
903481183 1:23654516-23654538 GGAAGGAGGGAGGCAGAGGTGGG + Intergenic
903602361 1:24551994-24552016 AGAATGACGGGGGCAGGGTCAGG - Intergenic
903650160 1:24917155-24917177 AGAAAGAGGGAGGCACGGGACGG - Intronic
903728798 1:25474026-25474048 GGAGTGAGTGAGGCAGGCTAGGG + Intronic
903914155 1:26750962-26750984 GGAAAGAGGGGGGCCGGGCATGG + Intronic
904026112 1:27504716-27504738 GGGAGGAGGGAGGCAGGGGCAGG + Intergenic
904087172 1:27917066-27917088 GGAAGGAGGAAGGAAGGGGAGGG - Intergenic
904272054 1:29356559-29356581 GGAAGGAGGGAGCCAGGGCCTGG + Intergenic
905019065 1:34796015-34796037 GGCATGGGGGAGGGAGGGCAAGG - Intronic
905081917 1:35330245-35330267 GGAGGGAGGGAGGAAGGATAAGG + Intronic
905217392 1:36418624-36418646 GGAGGAAGGGAGGCTGGGTACGG + Intronic
905236143 1:36550624-36550646 TGAATGAGAGAGGAAGAGTAGGG - Intergenic
905240867 1:36580687-36580709 GGGAGGAGGGAGGCTGGGGAGGG + Intergenic
905288923 1:36908143-36908165 GGAATGAATAAGGCAGGGTTGGG - Intronic
905481901 1:38267701-38267723 GGAGGGAGGGAGACAGGGAAGGG - Intergenic
905481939 1:38267834-38267856 GGAAGGAGAGAGGCAGAGAAGGG - Intergenic
905573012 1:39021148-39021170 GGAGGGAGGGAGGCTGGGTGTGG - Intergenic
905953797 1:41975223-41975245 GGAATGAGGGAAGCAGGATTGGG - Intronic
905997906 1:42397841-42397863 GGAATGATGCAGACAGGATATGG - Intronic
906063538 1:42963493-42963515 GGAATGAGGGAGACAGAGAGGGG - Intergenic
906197727 1:43939276-43939298 GGAGGGAGGGAGGGAGGGGAGGG + Intergenic
906640446 1:47437999-47438021 GGACTGAGGCAGGCAGGGAGGGG - Exonic
906747674 1:48233019-48233041 GGAGGGAGGGAGGGAGGGAAAGG + Intronic
907112098 1:51935645-51935667 AGACTGAGGGAGGAAGGGAAGGG + Intronic
907234583 1:53033971-53033993 GGATTGAAGGAGGCCGGGCATGG + Intronic
907437741 1:54460169-54460191 GGAAGGAGGGAGGGAGGGAGTGG + Intergenic
907483074 1:54758035-54758057 GGGATGAGGCAGGCTTGGTAAGG + Exonic
907492817 1:54819759-54819781 GAAGGGAGGGAGGGAGGGTAGGG - Intronic
907506537 1:54923157-54923179 GGAGGGAGGGAGGCAGGATCAGG - Intergenic
907709288 1:56863823-56863845 GGAGTGAGAGAGGGAGGGAAGGG - Intronic
907799623 1:57751682-57751704 GGAACCAGGCAGGCAGGGTGGGG + Intronic
908035414 1:60046311-60046333 GGAGAGAGGGAGGGAGGGTAGGG - Intronic
908224929 1:62046241-62046263 GGAGGGAGGGAGGGAGGGAAAGG + Intronic
908389462 1:63671683-63671705 GGAATGGGGGTGGAAGGGAAAGG - Intergenic
909249604 1:73334995-73335017 GGAAGGAGGGAGGGAGGGAAGGG - Intergenic
909620684 1:77663425-77663447 GGAATGAGTGAAGGAGGGAAGGG - Intronic
910473048 1:87576095-87576117 AGAAGGAGAGAGGAAGGGTAAGG - Intergenic
910516049 1:88061382-88061404 GGAGTGAGGGAGGGAGGGAGGGG - Intergenic
911104141 1:94116938-94116960 GAAAGGAGGGAGGGAGGGAAGGG - Intronic
911271399 1:95806193-95806215 GGAGTGAGGGAGGGAGGGAGAGG - Intergenic
911834360 1:102597026-102597048 GGAGGGAGGGAGGAAGGGGAGGG + Intergenic
911888769 1:103340426-103340448 GAAATGAGAGAGGCAGGATGTGG + Intergenic
911893878 1:103404974-103404996 GTAATGGGGGAAGCAAGGTAGGG - Intergenic
911936311 1:103978590-103978612 GTAATGTGGGAGGAAGGATATGG + Intergenic
911995196 1:104758040-104758062 GGGATGGGGGAGGTGGGGTATGG + Intergenic
912275733 1:108256571-108256593 GGAGAGAGGGAGGGAGGGGAGGG - Intergenic
912292493 1:108437783-108437805 GGAGAGAGGGAGGGAGGGGAGGG + Intronic
912692662 1:111815976-111815998 GGGAAAAGGGAGGCAGGGTGGGG + Intronic
912708721 1:111934175-111934197 GGGAGGTGGGAGGCAGGGTTGGG + Intronic
913031549 1:114909447-114909469 GGAAGGAGGGAGGGAGGGCGGGG - Intronic
914195717 1:145446973-145446995 GGGGTGAGGGAGGGAGGGTCAGG + Intergenic
914443011 1:147723422-147723444 GCAATGAGAAAGTCAGGGTATGG - Intergenic
914769178 1:150668336-150668358 GCCATGAGGCAGGCAGGGGAGGG - Intronic
915019373 1:152764831-152764853 GGAGTGAGGAGGGCAGGGTAGGG + Intronic
915057847 1:153152271-153152293 AGAATGGGGGATGCAGGGAAAGG - Intergenic
915078858 1:153337483-153337505 GGAATGAGGGAGGCAGGGTAGGG + Intronic
915103267 1:153515818-153515840 AGAATGAGGGAGGCTGGGGAGGG - Intergenic
915286648 1:154857498-154857520 GGACTGAGGGTGGCACAGTAAGG + Intronic
915322982 1:155066156-155066178 AGAATGAGGGAGGCCAGGTGTGG - Intronic
915553277 1:156647201-156647223 GGAGGGAGGGAGGGAGGGAAGGG + Intronic
915650781 1:157308927-157308949 GGGAAGAGGGAGGGAGGGAAGGG - Intergenic
915859973 1:159433664-159433686 GGAATGAGAGAAGCAGGATGGGG - Intergenic
915978721 1:160407367-160407389 GGGATGAGGGTGGCAGGGCTGGG - Intronic
916080441 1:161228852-161228874 GGAATGGGGGATGCAGAGGAGGG + Intronic
916347882 1:163814721-163814743 GGAAAGAGCGAGGGAGGGCAAGG - Intergenic
916577900 1:166083339-166083361 GGAAAGAGAGAGGAGGGGTAGGG + Intronic
916738705 1:167630190-167630212 GGAGGGAGGGAGGAAGGGGAGGG - Exonic
916744491 1:167674301-167674323 GGCATGCTGGAGGCAGGGAAGGG + Intronic
916822170 1:168410191-168410213 GGAAGGAGGGAGGAAGGGGAAGG + Intergenic
917105001 1:171483312-171483334 GGAGGGAGGGAGGGAGGGGAGGG + Intergenic
917105012 1:171483336-171483358 AGAAGGAGGGAGGGAGGGGAGGG + Intergenic
917646019 1:177029571-177029593 GGAGTGAGGGAGGCGGGGGAAGG - Intronic
917809726 1:178646577-178646599 GGACAGAGGGAGGGAGGGAAGGG + Intergenic
917951277 1:180039275-180039297 GGAGGGAGGGAGGGAGGGGAGGG + Intronic
918038382 1:180897046-180897068 GGAAGGAGGGAGGGAGGGAGGGG + Intergenic
918178848 1:182068992-182069014 GGAAGGAGAGAGGAAGGGAAAGG + Intergenic
918492414 1:185095489-185095511 AAAATGAGGCAGGGAGGGTAAGG - Intronic
918515566 1:185359046-185359068 GGTATGACAGAGGGAGGGTATGG - Intergenic
919085648 1:192917618-192917640 AGACTGAGGGAGGTAGGGCAGGG - Intergenic
919163300 1:193860061-193860083 GGATGGAGGGAGGGAGGGAAAGG - Intergenic
919221140 1:194629928-194629950 GGAAAGAGGGAAGGAGGGAAGGG + Intergenic
919583052 1:199400962-199400984 GGAGGGAGGGAGGGAGGGGAGGG + Intergenic
919766093 1:201128104-201128126 GGAGTGAGGGTGGGAGGGTGGGG - Intergenic
919880000 1:201895008-201895030 GGAAGGAGGGAGGGAGGGAGGGG + Intergenic
919887549 1:201946035-201946057 GGGAGGAGGGAGACAGGGGAGGG - Intronic
919893651 1:201994426-201994448 GCAATGAGGGAGGCAGTGGCAGG - Intronic
919937453 1:202264070-202264092 GGAAATAGGGAGGCTGGGGAGGG + Intronic
920004335 1:202822005-202822027 AAAATGTGGGAGGCAGGGTGTGG + Intronic
920006026 1:202834439-202834461 AGAATGAGGTTGGCAGGGCATGG - Intergenic
920065927 1:203269694-203269716 GGAAGGAGGGAGCCAGGCTGTGG + Intronic
920094241 1:203475690-203475712 GGGAGGAGGGAGGGAGGGGAGGG - Intergenic
920171089 1:204073046-204073068 GGGAGGAGGGAGGGAGGGTGGGG - Intergenic
920208750 1:204313078-204313100 GGAAGGAGGGAGGGAGGGAAGGG - Intronic
920244024 1:204574742-204574764 GGAAGGAGGGAGGCTGCGTGTGG - Intergenic
920294514 1:204947609-204947631 GGAGGGAGGGAGGGAGGGGATGG - Intronic
920294515 1:204947613-204947635 GGAAGGAGGGAGGGAGGGAGGGG - Intronic
920308163 1:205032122-205032144 GGAGTGATGGAGGCCGGGCACGG - Intergenic
920360368 1:205411222-205411244 GGAAGGAGGGAGGGAGGGAAAGG + Intronic
920501430 1:206487841-206487863 GGAAAGAGGGAGGGAGGGGAAGG - Intronic
920548541 1:206838789-206838811 GGAAGGAGAGAGGAAGGGAAGGG - Intronic
920707585 1:208265817-208265839 GGAGGGAGGGAGGAAGGGAAGGG - Intergenic
920748040 1:208647328-208647350 GGAAGGAGGGAGGGAGGGAAGGG - Intergenic
920877106 1:209846691-209846713 GGGAGGAGGAAGGCAGGGTAAGG + Intronic
921156864 1:212445734-212445756 GGGATGTGGGAGGCAAGGCAGGG + Intronic
921185417 1:212665658-212665680 GGAAAGAGGAAGGGAGGGCAGGG - Intergenic
921220149 1:212967876-212967898 GGAATGAGAGTGGCAGAGAAAGG + Intronic
921253848 1:213321971-213321993 GGAATGAGTGAGAGGGGGTAGGG + Intergenic
921272533 1:213485401-213485423 GGATTGGGGGTGGCAGGTTAGGG - Intergenic
921579054 1:216873988-216874010 GGAAGGAGGGAGGGAGGGAGTGG + Intronic
921630857 1:217432143-217432165 GGAAGGAGGGAGGGAAGGGAAGG - Intronic
921873644 1:220169523-220169545 TGAGTGAGAGAGGCAGGGAAAGG + Intronic
922091938 1:222404054-222404076 GGAATGAGAGAGGCAGAAGATGG - Intergenic
922212879 1:223498962-223498984 GGGATGAGACAGGCAGGGTCAGG + Intergenic
922307140 1:224353830-224353852 GAAGAGAAGGAGGCAGGGTAAGG - Intergenic
922323139 1:224504991-224505013 GGAGGGAGGGAGGGAGGGAAAGG - Intronic
922326798 1:224535790-224535812 GGCGTGAAGGAGGCAGGGCAAGG + Intronic
922504461 1:226118556-226118578 GGGAAGAGGGAGGAAGGGAAGGG + Intergenic
922723210 1:227909599-227909621 GGAAGGAGGGAAGGAGGGGAGGG + Intergenic
922758327 1:228109064-228109086 GGAGGGAGGGAGGCAGGGAAGGG - Intronic
922860170 1:228809827-228809849 GGAATGGGTGGGGCAGGGCAGGG - Intergenic
922879393 1:228969325-228969347 GGAAGGAGGGAGTCTGGGGATGG - Intergenic
923448512 1:234094728-234094750 GGCATGAGGGAGGCTTGATAGGG + Intronic
923480969 1:234383051-234383073 GGAGGGAGGGAGGGAGGGAAGGG + Intronic
923524305 1:234760365-234760387 GTAATGAGGCAGGAAGGGAAAGG - Intergenic
923569589 1:235101652-235101674 GGAGGGAGGGAGGGAGGGAAGGG + Intergenic
923588474 1:235296841-235296863 GGAAGGAGGGAGGGAAGGAAGGG + Intronic
924049358 1:240064686-240064708 GGAAGGAGGGAGGAAGAGAAGGG - Intronic
924436531 1:244048506-244048528 GGAGGGAGGGAGGCAGGGGAAGG + Intergenic
924437606 1:244056635-244056657 AGAGTAAGGGAGGGAGGGTAAGG - Exonic
924468013 1:244315478-244315500 AGCATGGGTGAGGCAGGGTAAGG + Intergenic
924744257 1:246818046-246818068 GGCAGGAAGGAGGCAGGGTCAGG - Intergenic
1062780347 10:199276-199298 GGAGTGAGGGAGGGAGGGATGGG - Intronic
1062900180 10:1138138-1138160 GGAAAAAGGAAGGCAGGGGAGGG - Intergenic
1062904713 10:1172042-1172064 GGGATGTGGGAGGCTGGGTGGGG - Intergenic
1063150069 10:3328733-3328755 GGAGGGAGGGAGGGAGGGGAGGG - Intergenic
1063197805 10:3759497-3759519 GGAAAGAGGGAGGGAGAGAAAGG + Intergenic
1063251823 10:4282325-4282347 GGACTGTGGGAGGCAGGGCAGGG - Intergenic
1063379659 10:5576230-5576252 GGAAGGAGGGAGGGAGGGAGTGG - Intergenic
1063434267 10:6017976-6017998 GGTAGGGGGGAGGCAGGGTGGGG + Intronic
1063576310 10:7265174-7265196 GAAGAGAGGGAGGCAGGGGAGGG - Intronic
1063725470 10:8632842-8632864 GGAAGGAGCTAGGCATGGTAGGG + Intergenic
1063763287 10:9106812-9106834 GAAATGAGGGATGTAGGGAAGGG + Intergenic
1064121406 10:12623038-12623060 GGAGGGAGGGAGGGAGGGAAGGG - Intronic
1064149379 10:12849941-12849963 GGAAGGAGGGAGGGAGGGATGGG - Intergenic
1064154677 10:12894218-12894240 GAAAGGAGGGAGGGAGGGAAAGG - Intergenic
1064208951 10:13347748-13347770 GGAAGGAGGGAGGGAGGGCGGGG - Intronic
1064236435 10:13580474-13580496 GAAATGAGGAAGGCTGGGTTTGG + Intergenic
1064341429 10:14489052-14489074 GGAGGGAGGGAGGGAGGGAAAGG + Intergenic
1064341541 10:14489984-14490006 GGAAGGAGGGAGGGAAGGAAAGG + Intergenic
1064405487 10:15058942-15058964 GGAAGGAGGGAGGGAAGGGAAGG - Intronic
1064587694 10:16855078-16855100 GGAAGGAGGGAGGGAGGGGAGGG - Intronic
1064652125 10:17519726-17519748 GGAGGGAGGGAGGAAGGGAAGGG + Intergenic
1064678291 10:17783458-17783480 GGTATGATGTTGGCAGGGTAAGG + Intronic
1064821972 10:19346938-19346960 CCAATGAGGGAGGCTGGGCATGG - Intronic
1065027473 10:21552680-21552702 GCAATGAGAGAGGCCGGGCATGG - Intronic
1065087186 10:22190403-22190425 GGAAGGAGGCAGGCAGTGTCAGG - Intergenic
1065242277 10:23718829-23718851 GGATTGAGGGAGGGAGGGAGGGG + Intronic
1065368018 10:24953253-24953275 GGGATGAGGGAGGTGGGGGAAGG - Intergenic
1065383851 10:25115169-25115191 GGAAGGAGGGAGGTAGAGAAGGG - Intergenic
1065383882 10:25115250-25115272 GGAAGGAGGGAGGTAGAGAAGGG - Intergenic
1065383913 10:25115331-25115353 GGAAGGAGGGAGGTAGAGAAGGG - Intergenic
1065383948 10:25115419-25115441 GGAGGGAGGGAGGAAGGGAAGGG - Intergenic
1065540851 10:26765636-26765658 GGAGGGAGGGAGGAAGGGAAAGG + Intronic
1065767018 10:29039588-29039610 GGAGACAGGGAGGCAAGGTAAGG + Intergenic
1065933513 10:30500081-30500103 GGAGTGAGGGAAGGAGGGAAAGG + Intergenic
1066136702 10:32454421-32454443 GGTGGGAGGGAGGCGGGGTAAGG + Intronic
1066371510 10:34821897-34821919 GGAAGGAGGGAGGGAGGGGAGGG + Intergenic
1066557993 10:36636609-36636631 GGAAGGATGGAGGGAGGGGAAGG + Intergenic
1066561248 10:36672152-36672174 AGAGAGAGGGAGGCAGGGCATGG + Intergenic
1067175541 10:43943348-43943370 GGCATGAGGGTGGCTGGGTGGGG + Intergenic
1067488136 10:46672014-46672036 GGGCTGAGGGAGGGAGGGAATGG + Intergenic
1067682986 10:48451890-48451912 GGATTTGGGGAGGCTGGGTAGGG - Intronic
1067739989 10:48888279-48888301 GGAAAGAGGGAGGGAGGGGGAGG - Intronic
1068120562 10:52779264-52779286 GGGAGGAGGGAGGCAGGGAGGGG - Intergenic
1068556884 10:58468253-58468275 GGAGGGAGGGAGGGAGGGAAAGG - Intergenic
1068556893 10:58468274-58468296 GGAAGGAGGGAGGGAGGGAAGGG - Intergenic
1068829596 10:61478112-61478134 GGAGGGAGGGAGGCAGGGAGAGG + Intergenic
1068850366 10:61731775-61731797 GGAGGGAGGGAGGGAGGGAAGGG + Intronic
1069203968 10:65658559-65658581 GGAGTGTGGGAAGTAGGGTATGG + Intergenic
1069258238 10:66361316-66361338 GGAGGGAGGGAGGAAGGGGAGGG - Intronic
1069464030 10:68622232-68622254 GGAGGGAGGGAGGGAGGGAAGGG - Intronic
1069582947 10:69577654-69577676 GGGATGGTGGAGGCAGGGTAGGG + Intergenic
1069771093 10:70901090-70901112 GGAAGGAGGGAGGGAAGGAAGGG - Intergenic
1069928270 10:71866030-71866052 TGACTGTGGGAGCCAGGGTACGG + Intergenic
1070022376 10:72599655-72599677 GGAAGGATGGAGGCAGGTTTTGG - Intronic
1070125961 10:73622022-73622044 GGAAGGAGGGAGTCTTGGTATGG - Intronic
1070175843 10:73968539-73968561 GGAAGGAGGTAGAGAGGGTAGGG - Intergenic
1070264578 10:74889951-74889973 GGACTGTGGGAGGCAGAGGAAGG + Intronic
1070307596 10:75248842-75248864 GGAGTGAGAGAAGTAGGGTAGGG - Intergenic
1070486990 10:76941103-76941125 GGAGGGAGGGAGGGAGGGAAGGG + Intronic
1070515228 10:77199084-77199106 GGAATGAGGAAGGTAGTGTCGGG - Intronic
1070634509 10:78113604-78113626 GGAGAGAGGAAGGAAGGGTAGGG - Intergenic
1070637103 10:78137821-78137843 GGAGGGAGGGAGGGAGGGAAAGG - Intergenic
1070762703 10:79034668-79034690 GGAGTGAGGGAGGAGGGGCAGGG - Intergenic
1070831471 10:79420364-79420386 GGAATGAGGGTGGGAAGGGAGGG + Intronic
1070843377 10:79503419-79503441 GGGATGAGAGAGGGAGGGGAAGG - Intergenic
1070930286 10:80256179-80256201 GGGATGAGAGAGGGAGGGGAAGG + Intergenic
1071306500 10:84303622-84303644 GGTGTGAGGGAGGCAAGCTATGG + Intergenic
1071393449 10:85198346-85198368 GGTATGAGGTTGGCATGGTAAGG + Intergenic
1071396919 10:85233206-85233228 GGAATGAGGAAAGCAGGGAGGGG + Intergenic
1071437702 10:85662490-85662512 GGGCGGAGGGAGGCAGGGTTCGG - Intronic
1071622232 10:87131366-87131388 GGGCTGAGGGAGGGAGGGAATGG - Intronic
1071893452 10:90038341-90038363 GGAATGAGGTAGGAAGAGAAAGG + Intergenic
1072095979 10:92180424-92180446 GGAATGAAGGAGGTAGGTGAAGG - Intronic
1072735098 10:97873835-97873857 GTGAGGAGGGAGGCAGGGTCAGG - Intronic
1072886917 10:99285483-99285505 GGAGGGAGGGAGGGAGGGAAAGG + Intergenic
1072892083 10:99332549-99332571 GGAGGGAGGGAGGGAGGGAAGGG + Intronic
1072959966 10:99920557-99920579 GGTAGGAGGGAGGCAGGGTGAGG - Intronic
1073113694 10:101078801-101078823 GGAATGAGAGATGCAGAGTGGGG - Intergenic
1073191186 10:101651592-101651614 GGAAGGAGGGGGGCAGAGAAGGG - Intronic
1073487569 10:103829601-103829623 GGACGGAGGGAGGCAGGAAAGGG + Intronic
1073552250 10:104414459-104414481 GGAAAGAGGGAGGGAGGAGAAGG + Intronic
1073597688 10:104817330-104817352 GGGAGGAGGGAGGCAGGGAAGGG - Intronic
1073649098 10:105339976-105339998 GGAAGGAGGGAGGGAGGAGAAGG - Intergenic
1073649752 10:105345577-105345599 GGCATGAGGGAGGGATGGAATGG - Intergenic
1074196471 10:111190933-111190955 GGAGGGAGGGAGGGAGGGCAAGG - Intergenic
1074272316 10:111966660-111966682 GGAGAGAGGGAGGCAGGAGAGGG + Intergenic
1074326428 10:112455422-112455444 GGAAGGAGGGAAGAAGGGAAGGG - Intronic
1074809646 10:117090822-117090844 GGAGGGAGGGAGGGAGGGAAAGG + Intronic
1074816568 10:117145972-117145994 GGAAGGAGGGAGGGAGGGAAGGG + Intergenic
1074843438 10:117376057-117376079 GGAAGGAGGGACGCAGGGAAAGG + Intergenic
1074887666 10:117707025-117707047 GAAGGGAGGGAGGCAGGGTGAGG + Intergenic
1074906046 10:117865006-117865028 GGAGGGAGGGAGGGAGGGAATGG - Intergenic
1075075247 10:119346201-119346223 GGAATCAGTGAGGAAGGGGAAGG + Intronic
1075153514 10:119955785-119955807 GGAGTGAGGGAGGCAGGATTGGG + Intergenic
1075421969 10:122308597-122308619 GGAAGGAGGGAGGTTGGGGAAGG - Intronic
1075471227 10:122691406-122691428 GGTATGAGTGAGTCAGGGTGGGG - Intergenic
1075656235 10:124162988-124163010 GGAGGGAGGGAGGGAGGGAAGGG + Intergenic
1075788980 10:125069871-125069893 GGGGGGAGGGGGGCAGGGTATGG - Intronic
1076296105 10:129386022-129386044 GGAAGGAGGGAGGGAGGGAAGGG + Intergenic
1076296137 10:129386347-129386369 GGAAGGAGGGAGGGAAGGAAGGG + Intergenic
1076376629 10:129992417-129992439 GGAGGGAGGGAGGGAGGGAAAGG + Intergenic
1076516160 10:131045505-131045527 GGAAAGAAGGAAGCAGAGTAGGG + Intergenic
1076541383 10:131217254-131217276 GGAAAGAGAGAAGCAGGATAGGG - Intronic
1076551240 10:131279281-131279303 GGAAGGAGGGAGGGAGGAGAGGG + Intronic
1077023668 11:430553-430575 GGGATGAGGGTGGGAGGGCAAGG + Intronic
1077272303 11:1686984-1687006 GGGAAGAGGGAGGCAGGGAAGGG - Intergenic
1077291462 11:1796915-1796937 GGTTTCAGGGAGGCAGGGAAGGG + Intergenic
1077386683 11:2272530-2272552 GGAAGGAGGGAGGCAGCAGAAGG - Intergenic
1077411561 11:2406204-2406226 GGCATGAGGGAGGAAGGGAAAGG - Intronic
1077415582 11:2422914-2422936 GGAAGAAGCGAGGCAAGGTAAGG - Exonic
1077549684 11:3194539-3194561 GGAAGGAGGGAAGGGGGGTAGGG - Intergenic
1077664788 11:4098263-4098285 GGAGGGAGGGAGGCAGGGATAGG - Intronic
1077672268 11:4167350-4167372 GGAATGAGAGAGAGAGGGAAAGG + Intergenic
1077733832 11:4766690-4766712 GGAGGGAGGGAGGGAGGGAAAGG - Intronic
1077761382 11:5103210-5103232 GGAGGGAGGGAGGGAGGGAAAGG + Intergenic
1077779274 11:5307668-5307690 GGAAGGAGGGAAGGAGGGAAGGG - Intronic
1077779588 11:5311880-5311902 GAATTGAGGGAGGCAGGGAAAGG - Intronic
1077864377 11:6210769-6210791 GGAATGAGGGAGACTGGGGAGGG + Intronic
1078159570 11:8828910-8828932 GGAAGGAGGGAGGCAGGGAAGGG + Intronic
1078450884 11:11439882-11439904 AGGATGATGGAGGCAGGGTGGGG + Intronic
1078589113 11:12622511-12622533 GGAATCTGGGAGGCAGTGGATGG + Intergenic
1078600486 11:12726117-12726139 GGAATGAGCATGGCATGGTAAGG + Intronic
1078625380 11:12950989-12951011 GGAAAGAGGGAGGCAGTTAAGGG + Intergenic
1078849325 11:15149649-15149671 GCAATGAGGGAGGGTGGGAAAGG + Intronic
1078866108 11:15298874-15298896 GGAGGGAGGGAGGGAGGGAAGGG - Intergenic
1078923618 11:15854356-15854378 GGAAGGAAGGAGGGAGGGAAGGG + Intergenic
1078923619 11:15854360-15854382 GGAAGGAGGGAGGGAAGGGAAGG + Intergenic
1079060105 11:17241046-17241068 GGAGTGAAGGAGGGAGGGGAGGG - Intronic
1079089212 11:17469068-17469090 GGAAGGAGGGAGGGAGGGAAGGG - Intronic
1079189370 11:18265057-18265079 GGAAGGAGGGAGGGAGGGAAGGG + Intergenic
1079410157 11:20180026-20180048 GTGGTGAGGGAGGCAGGGCAAGG - Intergenic
1079501512 11:21105906-21105928 GGAATGAGGGAGGGAAGGAAGGG - Intronic
1079788851 11:24710948-24710970 GAAAGGAGGGAGGGAGGGGAGGG + Intronic
1079803034 11:24895498-24895520 GGAGTGAGGGAGGCAGGCAAGGG - Intronic
1079834508 11:25316138-25316160 GGGATGAGGGAAGCAGGAGAGGG + Intergenic
1080123535 11:28704640-28704662 GAAATGGGAGAGGCAGGGCAGGG + Intergenic
1080505667 11:32910830-32910852 GGCATGAGGGAGGTAGGAAAAGG - Intronic
1080541729 11:33272776-33272798 GGAAGGAGGGAGGGAGGGGGAGG - Intronic
1080556594 11:33422558-33422580 GGAAGGAGGGAGGGAGGGAGAGG - Intergenic
1080557398 11:33430073-33430095 GGAGAGAGGGAGGGAGGGAAGGG - Intergenic
1080932871 11:36831096-36831118 GGAAGGAGGGAGGCAGGCATGGG - Intergenic
1081023929 11:37984607-37984629 GGAAGGAGGTAGTCAGGGGATGG - Intergenic
1081286519 11:41276773-41276795 GGAAAGAGAGAGGCAGGAGAGGG + Intronic
1081593815 11:44445640-44445662 GGAGGGAGGGAGGGAGGGAAGGG + Intergenic
1081597134 11:44467149-44467171 GGAATGGGGCAGGGAGGGGAGGG + Intergenic
1081620152 11:44614641-44614663 GGGATAAGGGAGGCCGGGGAGGG + Intronic
1081641324 11:44756310-44756332 GGAGGGAGGGAGGGAGGGAAGGG + Intronic
1081714064 11:45236104-45236126 GAAAAGAGGGAGGAAGGGAATGG - Intergenic
1081824920 11:46040270-46040292 GGAAGGATGGAGGCAGGGTGGGG + Intronic
1081850537 11:46272454-46272476 GGAAGGAGGGAGGCAGCATCAGG - Intergenic
1082185402 11:49174607-49174629 GGATCAAGGGAAGCAGGGTAGGG - Intronic
1082611959 11:55311075-55311097 GGAGGGAGGGAGGGAGGGGAAGG - Intergenic
1082756633 11:57083191-57083213 GCCATGAGGGTGTCAGGGTATGG + Intergenic
1082884104 11:58066093-58066115 GGAGGGAGGGAGGGAGGGGAGGG - Intronic
1083187144 11:61024287-61024309 GGATGGAGGGAGGGAGGGTAGGG - Intergenic
1083332465 11:61905336-61905358 AGAATGAGGGAGGCTGGGAGGGG + Intronic
1083577183 11:63800669-63800691 GGAGGGAGGGAGGAAGGGAAGGG + Intergenic
1083592354 11:63903168-63903190 GGAGTGAGGCAGGCAGGGCCCGG - Intronic
1083829125 11:65219853-65219875 GGAAGCAGGGAGGCCGGTTAAGG + Intergenic
1083861628 11:65423130-65423152 GGAAGGAGGAAGGCAGGGAGAGG + Intergenic
1083985807 11:66214536-66214558 GGAGGGAGGGAGGGAGGGAAAGG - Intronic
1084364025 11:68686008-68686030 GGGAAGAGGGAGGCAGGATTTGG - Intronic
1084672693 11:70616524-70616546 GGGATGAGGGAGGCAGGGCCAGG + Intronic
1084889389 11:72229195-72229217 GGCATGAGGTAGCGAGGGTACGG - Exonic
1084928667 11:72535908-72535930 GGAGGGAGGGAGGAAGGGGAGGG + Intergenic
1085042329 11:73333894-73333916 TGAAGGAGGGAGGCAGAGAAGGG - Intronic
1085287072 11:75370026-75370048 GGAAGGAGGGAAGCAGGGTAGGG - Intergenic
1085478341 11:76802148-76802170 GGAGGGAGGGAGGGAGGGAAGGG - Intergenic
1085490854 11:76915591-76915613 GGCATGAGTGAGGCCGGGGAGGG - Intronic
1085705197 11:78780840-78780862 GAAATGATGGAGGCAGGCTCAGG + Intronic
1085750297 11:79155607-79155629 GGAGGGAGGGAGGGAGGGAAAGG - Intronic
1085774199 11:79350953-79350975 GGTCTGAGGGAGGTAGGGGAGGG - Intronic
1085853223 11:80145946-80145968 GGAAGGAGGGAAGGAGGGAAGGG + Intergenic
1086323982 11:85680030-85680052 GGAATGAGGTGGTCAGGGTTAGG - Intronic
1086917178 11:92544587-92544609 GGAATGGGGGTGGCAGGTGATGG - Intronic
1087138881 11:94746457-94746479 GGTATGAGTGATGCAGGTTATGG - Intronic
1087237180 11:95733058-95733080 GGAAGGAGGGAGGGAGGGAGGGG + Intergenic
1087261479 11:96017388-96017410 GGAGGGAGGGAGGGAGGGAAGGG - Intronic
1087391979 11:97546835-97546857 GGTTTGAGGGAGGAAGGGGATGG - Intergenic
1087527176 11:99330252-99330274 GGAAGGAGAGAGACAGAGTAAGG + Intronic
1088031938 11:105262017-105262039 GGAGGGAGGGAGGGAGGGAAGGG + Intergenic
1088381254 11:109195018-109195040 AGAAGGAGGGAGGGAGGGAATGG - Intergenic
1088537215 11:110874414-110874436 GGAGGGAGGGAAGCAGGGTAGGG - Intergenic
1088584999 11:111354081-111354103 GAAGTGAGGGAGGGAGGGGAAGG + Exonic
1088789752 11:113214113-113214135 GGAATGCAGGAGGCAGGACATGG - Intronic
1088919637 11:114251603-114251625 GGGATGAGGGAAGCTGGGCAAGG + Intergenic
1089223290 11:116893702-116893724 GGAGAGAGGGAGGGAGGGCAAGG + Intronic
1089596246 11:119582598-119582620 GGTATGAGGGAGGCCAGTTATGG + Intergenic
1089610383 11:119665358-119665380 GGTGGGAGGGAGGCAGGGAAAGG + Intronic
1089635505 11:119809087-119809109 GGAGTGAGGGAAGCAGCATATGG - Intergenic
1089782671 11:120884547-120884569 GGAAGGAGAGAGGCAGGAGAGGG - Intronic
1089804166 11:121068236-121068258 GGGGTGAGGGAGGCAGGGTAAGG - Intronic
1089996595 11:122913704-122913726 GGAATGAGGGAGGTACTGGAAGG - Intronic
1090018331 11:123105350-123105372 GGAGGGAGGGAGGGAGGGAAGGG - Intronic
1090020633 11:123125449-123125471 GGGAGGAGGGAGGGAGGGAAGGG - Intronic
1090423680 11:126592678-126592700 GGGAGGAGGGAGCCAGGGTGGGG + Intronic
1090569516 11:128031119-128031141 GGAAGGAGGGAGGGAGGGAGGGG + Intergenic
1090882824 11:130849174-130849196 GGAATTAGGGAGGGAGTGCAGGG - Intergenic
1091007408 11:131965950-131965972 GGAGGGAGGGAGGGAGGGAAGGG + Intronic
1091375826 12:23961-23983 TGGAAGAGGGGGGCAGGGTAGGG - Intergenic
1091618910 12:2071044-2071066 GGAGGGAGGGAGGAAGGGAAGGG - Intronic
1091686689 12:2567500-2567522 GCAGAGAGGGAGGCAGGGAAAGG - Intronic
1091860499 12:3777212-3777234 GGAAGGAGGGAGGGAGGGAAAGG + Intergenic
1091930597 12:4392441-4392463 GGAAGGGAGGAGGCAGGGCAGGG - Intergenic
1092098142 12:5861296-5861318 GAAATTAGGGAGGCAGGGGAAGG + Intronic
1092198258 12:6563190-6563212 GGAATAAGTGAGGCTGGCTAAGG + Intronic
1092374882 12:7947291-7947313 GGAGGGAGGGAGGGAGGGGAGGG - Intergenic
1092588595 12:9926583-9926605 GGAATGAGGAAGGAAAGGAAAGG + Intronic
1092597385 12:10022417-10022439 GGAGGGAGGGAGGCAGGGAAAGG - Intergenic
1093076876 12:14768254-14768276 TGAATGAGGGGGGCGGGGTGGGG - Intronic
1093472920 12:19524052-19524074 GGAGGGAGGGAGGGAGGGAAGGG - Intronic
1093755921 12:22851727-22851749 GGAAGGAGGGAGGGAAGGAAGGG - Intergenic
1094085275 12:26584175-26584197 GGAATGTAGCAGGCAGGGTGGGG + Intronic
1094230215 12:28094097-28094119 GGAAAGAGGGAGGGAGGGGAGGG - Intergenic
1094312395 12:29098713-29098735 GGAATGGATGAGGCAGGGTAAGG - Intergenic
1094689726 12:32756765-32756787 GGAGTGAGGGAGGCCGGGTTGGG + Intergenic
1094691312 12:32772050-32772072 GGAAGGAGGGAGGGAGGGAGGGG + Intergenic
1095181840 12:39154873-39154895 GGGATGAGGGAGGGGTGGTATGG + Intergenic
1095207681 12:39457061-39457083 GGAAGGAGGGAGGGAGGGACGGG + Intergenic
1095385519 12:41645656-41645678 GGAGAGAGGGAGGGAGGGAAAGG + Intergenic
1095405427 12:41862119-41862141 GGAATGAGCGAAGCAGGGGAGGG - Intergenic
1095945592 12:47751550-47751572 GGAAGGAGGGTGGCAGGGAGAGG + Intronic
1095969992 12:47894904-47894926 GGCATGAGGGCGGCAGGACAGGG + Intronic
1096009550 12:48201498-48201520 GGAAGGAGGGAGGGAGGGAAGGG - Intergenic
1096221098 12:49828469-49828491 GGGAGGAGGGAGGCGGGGTCAGG - Intronic
1096335974 12:50756955-50756977 GGAAGGAGGGAGGGAAGGGAAGG - Intergenic
1096372727 12:51082907-51082929 GGGATGCGGAAGGCTGGGTAGGG - Intronic
1096397999 12:51281302-51281324 GGATGGAGGGAGGCAGGCTGGGG - Exonic
1096410609 12:51374527-51374549 GGAAGGAGGGAGGCTGGGGGAGG + Intronic
1096462510 12:51829752-51829774 GAAAGGAGGGAGGGAGGGAAGGG + Intergenic
1096617641 12:52843029-52843051 GGAGGGAGGGAGGGAGGGAAGGG + Intronic
1096628073 12:52907332-52907354 GGAAGGAGGGAGGGAGGGGCTGG + Intronic
1096711971 12:53464303-53464325 GGAGGGAGGGAGGGTGGGTAGGG - Intronic
1096944185 12:55385989-55386011 GGAAGGAGGGAGGGAGGGAGAGG - Intergenic
1098051973 12:66463730-66463752 GGAAAGATGGGGGCAGGGAAGGG + Intronic
1098501128 12:71193164-71193186 GGAGGGAGGGAGGGAGGGGAGGG + Intronic
1098802429 12:74978427-74978449 GGAAGGAGGGAGGAAGGGAAGGG + Intergenic
1099274512 12:80558081-80558103 GAAAGGAGGGAGGGAGGGAAGGG - Intronic
1099553184 12:84073748-84073770 GGAGTAAGGGAAGCAGGATAGGG + Intergenic
1099628404 12:85107729-85107751 GGAGTGAGTGAGGCATGGAAAGG - Intronic
1100034450 12:90234342-90234364 GGAAGGAGGGAAGGAGGGAAGGG - Intergenic
1100034896 12:90238128-90238150 GGAGTGAGGGAAGCAGGATTAGG - Intergenic
1100209222 12:92383987-92384009 GTAATGAAGGAGGCATGGTTAGG + Intergenic
1100255537 12:92879560-92879582 GGAGAGAGGGAGGGAGGGAAGGG + Intronic
1100272900 12:93043486-93043508 GGGAGGAGGGAGGGAGGGTGGGG - Intergenic
1100289822 12:93202891-93202913 GGAAGGAAGGAAGCAGGGAAGGG + Intergenic
1100341692 12:93685281-93685303 GGTATGAGGGAGGCAGGGATGGG + Intronic
1100647619 12:96547855-96547877 GGAATGAAGGATGGAGGGGAAGG - Intronic
1100783076 12:98049910-98049932 GGAGGGAGGGAGGGAGGGAAAGG - Intergenic
1100787104 12:98089977-98089999 GGAAGGAGGGAGGGAGGGGGAGG + Intergenic
1100892298 12:99139336-99139358 GGAGGGAGGGAGGGAAGGTAGGG - Intronic
1101093643 12:101313736-101313758 GGAAGGAGGGAGGGAAGGAATGG + Intronic
1101209740 12:102523894-102523916 GGAAGGAGGGAGGGAGGGAGGGG + Intergenic
1101220144 12:102630470-102630492 GGAGTGAAGGAAGCAGGATAGGG + Intergenic
1101556666 12:105816586-105816608 GGGATGAGGGAAGCAAGGCAAGG + Intergenic
1102099692 12:110269022-110269044 GGAAGGAAGGAGGCCGGGTGTGG - Intergenic
1102099741 12:110269327-110269349 GGAAGGAAGGAGGCAGGGTGCGG - Intergenic
1102423684 12:112824113-112824135 GGAATGAGGGAAGCAGGAAAGGG + Intronic
1102484387 12:113246231-113246253 GGATTCAGGGAGGGAGGTTAAGG + Intronic
1102501025 12:113352511-113352533 GGAGGGAGGGAGGGAGGGGAGGG - Intronic
1102717454 12:114986530-114986552 GGAAGGAGGGAGGAAGGAAAAGG - Intergenic
1102822933 12:115923709-115923731 GGAAGGAAGATGGCAGGGTAGGG - Intergenic
1102864055 12:116360360-116360382 GGAGGGAGGGAGGGAGGGGAGGG - Intergenic
1102913693 12:116737624-116737646 GGAAGGAGGAAGGAAGGGAAGGG + Intronic
1102921471 12:116794675-116794697 GGAGGGAGGGAGGGAGGGAAGGG + Intronic
1103145838 12:118595166-118595188 GGAATGAGAGAGGGAGGATGGGG + Intergenic
1103172584 12:118834201-118834223 GGAATGAGGGAAGGGGAGTATGG + Intergenic
1103229105 12:119312995-119313017 GGAAGGAGGGAGGGAGGGAGGGG + Intergenic
1103245781 12:119455949-119455971 GGAAGGAAGGAGGGAGGGGAGGG + Intronic
1103307137 12:119973967-119973989 GGAGGGAGGGAGGGAGGGAAGGG + Intergenic
1103651493 12:122436323-122436345 GGAAGGAGAGAGGGAAGGTAGGG + Intergenic
1103721866 12:122979544-122979566 GGAGTCAGGGAAGCAGGGGAGGG + Exonic
1104127871 12:125864648-125864670 GAAATCATGGAGGCAGGGGATGG - Intergenic
1104134490 12:125924248-125924270 GGAGGGAGGGAGGGAGGGGAAGG - Intergenic
1104191103 12:126482504-126482526 GGAAGGAGGGAGGGAGGGAGAGG - Intergenic
1104451667 12:128874014-128874036 GGAGGGAGGGAGGAAGGGGAAGG - Intronic
1104466866 12:128997408-128997430 GGAATGAGGGAGGCAAGACAAGG + Intergenic
1104668896 12:130667126-130667148 GGAAGGAGAGAGGGAGGGAAGGG + Intronic
1104675576 12:130709902-130709924 GGCAGGAGGGAGGCAGGGGAAGG + Intronic
1104738647 12:131156232-131156254 GGAAGGAAGGAGGAAGGGAAGGG - Intergenic
1105274807 13:18910447-18910469 GGAAGGAGGGAGGAAAGGAAAGG - Intergenic
1105325896 13:19370493-19370515 GGAGTGAGGGAGGCAGGACGTGG + Intergenic
1105867611 13:24474601-24474623 GGAGTGAGGGAGGCAGGACGTGG - Intronic
1105937308 13:25114619-25114641 GGAAAGAGGGAGACAAGTTAGGG - Intergenic
1106168040 13:27266222-27266244 AGAAGGAGGGAGGGAGGGGAGGG - Intergenic
1106179385 13:27358000-27358022 GGAGGGAGGGAGGGAGGGGAGGG + Intergenic
1106232036 13:27827961-27827983 GACAGGAGGGAGGCAGGGTGAGG - Intergenic
1106235014 13:27854040-27854062 GAAAGGAGGGAGGGAGGGAAAGG - Intergenic
1106397691 13:29397040-29397062 GGAGTAAGGGAAGCAGGATAGGG + Intronic
1106894869 13:34289061-34289083 ATAATGAGGGAGGCAGAGAAAGG + Intergenic
1106951213 13:34885724-34885746 GGAGGGAGGGAGGGAGGGAAGGG + Intergenic
1107043522 13:35973087-35973109 GGAATGAGGATGGCAGGTGAGGG + Intronic
1107296685 13:38916547-38916569 GGAAAGAGGGAGTCAGTGTGTGG - Intergenic
1107328626 13:39272768-39272790 GGAAGGAGGGAGGGAAGGAAGGG + Intergenic
1107579213 13:41764281-41764303 GGAATGAAGGAGACAAGGAATGG - Intronic
1107624351 13:42267727-42267749 GTGATGAGGCAGGCAGGGTCTGG + Intergenic
1108039048 13:46322304-46322326 GAAATTAGGGATGCAGGGTGTGG + Intergenic
1108526649 13:51291324-51291346 GGCAAGAGGGAGGCATGGGATGG - Intergenic
1109671321 13:65612222-65612244 GGAGGGAGGGAGGGAGGGAAGGG + Intergenic
1110056542 13:70981326-70981348 GGAGGGAGGGAGGGAGGGGAGGG - Intergenic
1110180990 13:72616460-72616482 GGAATCAGGGTGGCAGAGGATGG + Intergenic
1110552992 13:76828236-76828258 GGGAGGGGGGAGGCAGGGAAGGG + Intergenic
1110641518 13:77830189-77830211 GGAAGAAGGGAGGGAGGGGAGGG - Intergenic
1110641537 13:77830230-77830252 GGAAGAAGGGAGGGAGGGGAGGG - Intergenic
1110834367 13:80066611-80066633 GGATGGAGGGAGGGAGGGGAGGG + Intergenic
1111146924 13:84194640-84194662 GGGAGGAGGGAGGGAGGGAAGGG - Intergenic
1111319189 13:86603085-86603107 GGAAGGAAGGAGGGAAGGTATGG - Intergenic
1111529865 13:89522147-89522169 GGAAGGAGGGAGGGAAGGAAAGG + Intergenic
1111759500 13:92443804-92443826 TGAATAAGGAAGGCAGGGAAGGG + Intronic
1111834241 13:93368262-93368284 GGAAGGAGGGAGGGAGGAAAGGG - Intronic
1112004538 13:95243181-95243203 GGTATTAGGGCGGCAGGCTAAGG - Intronic
1112051009 13:95644071-95644093 GGGATGGGGGAGGGAGGGAACGG - Intronic
1112292530 13:98157445-98157467 GGAAGGAGGTAGGCAGGGACTGG - Intronic
1112444771 13:99454175-99454197 GGAGAAAGGGAGGCAGGGTTTGG - Intergenic
1112539876 13:100298604-100298626 GGAGGGAGGGAGGGAGGGGAGGG - Intronic
1112539887 13:100298625-100298647 GGAGGGAGGGAGGGAGGGGAGGG - Intronic
1112727909 13:102326612-102326634 GGAAGGAGGGAAGGAGGGAAAGG + Intronic
1113202846 13:107886400-107886422 GAAATGAGAGAAGCAGGGTTGGG - Intergenic
1113207267 13:107931495-107931517 GGAAGGAAGGAGGGAGGGAAGGG + Intergenic
1113207268 13:107931499-107931521 GGAAGGAGGGAGGGAAGGGAAGG + Intergenic
1113401564 13:109998973-109998995 GGAATGAGTCAGGCAGAGTGGGG - Intergenic
1113489435 13:110679667-110679689 GGAGGGAGGGAGGGAGGGAAAGG + Intronic
1113754736 13:112803692-112803714 GGAATGAGAGAAGGAGGGGAGGG - Intronic
1113754751 13:112803735-112803757 GGAATGAGAGAAGGAGGGGAAGG - Intronic
1113850396 13:113414411-113414433 GGACTGAGGGAGGGAGGGTGGGG - Intergenic
1114245494 14:20909626-20909648 GGATGGAGGGAGGGAGGGTAGGG + Intergenic
1114416528 14:22548522-22548544 TGAATGAAGGAGGCAGGGCCGGG + Intergenic
1114483003 14:23047113-23047135 GGAAAGAGGGAGGAAGGGGAGGG - Exonic
1114557072 14:23568186-23568208 GGAAGGAGGGAGGCAAGCCAAGG + Exonic
1114663989 14:24368027-24368049 GGACAGAGGGAGGGAGGGTGGGG + Intronic
1114758979 14:25290433-25290455 GGAGGGAGGGAGGGAGGGGAGGG - Intergenic
1114765091 14:25361716-25361738 GAAATGAGGAAAGCAGGGTAGGG + Intergenic
1114840496 14:26257234-26257256 AGAATGAGAGAGGAAAGGTATGG + Intergenic
1115042435 14:28948054-28948076 GAAATGCTGGAGGCAGGGGAAGG - Intergenic
1115353267 14:32420328-32420350 AGAAAGAGAGAGACAGGGTAGGG - Intronic
1115399595 14:32941245-32941267 GGAAGGAGGGAGGAGGGGAAAGG - Intronic
1115445063 14:33480542-33480564 GGAGGGAGGGAGGAAGGGTGGGG - Intronic
1115632445 14:35258637-35258659 GGGATGGGGCAGGCAGGGTGTGG + Intronic
1115736012 14:36330901-36330923 GGGATGAGGGAAGTAGGGGATGG - Intergenic
1115741497 14:36393910-36393932 GGAGTGAGGGAGGCAGGATGGGG + Intergenic
1115815696 14:37162033-37162055 GTAATGAGGGAGGCAGAGATTGG + Intronic
1115863121 14:37711764-37711786 GGATTGAAGGAGGGAGGGTCTGG + Intronic
1116427329 14:44807005-44807027 GGAGGGAGGGAGGGAGGGGAAGG + Intergenic
1116475173 14:45331386-45331408 GGAGGGAGGGAGGGAGGGGAGGG - Intergenic
1116475194 14:45331432-45331454 GGAGGGAGGGAGGGAGGGGAGGG - Intergenic
1116475220 14:45331486-45331508 GGAAGGAGGGAGGGAAGGAAGGG - Intergenic
1116971022 14:51066104-51066126 GGAGGGAGGGAGGGAGGGGAGGG + Intronic
1116994049 14:51303985-51304007 GGAGGGAGGGAGGGAGGGGAGGG - Intergenic
1117063367 14:51984775-51984797 GGGTTTAGGGAGGCAGGGTTGGG - Intergenic
1117336790 14:54762760-54762782 GGAATGAGGATGGCAGGGTTTGG - Intronic
1117505984 14:56403546-56403568 GGAAGGAAGGAGGAAGGGAAGGG - Intergenic
1117819417 14:59632307-59632329 GGGAGGAGGGAGGAAAGGTAGGG - Intronic
1118451536 14:65907026-65907048 GGAAGGAGGAAAGGAGGGTAAGG + Intergenic
1119184809 14:72632743-72632765 GGAAGGATGGAGGGAGGGGAAGG + Intronic
1119198184 14:72732838-72732860 GAAAGGAGGGAGGGAGGGAAAGG - Intronic
1119235398 14:73015301-73015323 GGAGGGAGGGAGGGAGGGAAGGG + Intronic
1119377467 14:74206382-74206404 GGAGGGAGGGAGGCAGGGAGGGG - Intergenic
1119378502 14:74214047-74214069 GCAGTGAGGGAGGAAGGGTCCGG - Intergenic
1119517703 14:75261380-75261402 GGAAGGAGGGAGGGAGGGAAAGG - Intronic
1119659150 14:76438119-76438141 GAAATGAGAGAGGGAGGGTTTGG + Intronic
1119673799 14:76539090-76539112 GGAAAGGGGGAGGGAGGGGAGGG - Intergenic
1119764347 14:77179081-77179103 GGAGGGAGGGAGGGAGGGAAGGG - Intronic
1120018122 14:79497517-79497539 GGAAAAAGTAAGGCAGGGTAAGG - Intronic
1120325906 14:83025779-83025801 GGAAGGAGGGAGGGAAGGAAGGG + Intergenic
1121209530 14:92197680-92197702 GAAGTGAGGGAGGCAGGGACTGG + Intergenic
1121502876 14:94452271-94452293 GGAATGACTGATGCAGGGTTAGG + Intronic
1121550105 14:94792851-94792873 GGAAGGAGGGAGGGAGGGAAGGG + Intergenic
1121612826 14:95293199-95293221 GGAAGGAGGGAGGGAAGGAAGGG - Intronic
1121614274 14:95302354-95302376 GGAAGGAGGGAGGAAGGAAAAGG + Intronic
1121620919 14:95347751-95347773 GGAATGGGGGTGTTAGGGTAGGG + Intergenic
1121623002 14:95363158-95363180 GGAAGGAGGGAGGAAGGGAATGG - Intergenic
1121659506 14:95624347-95624369 GGAGGGAGGGAGGGAGGGAAAGG + Intergenic
1121741823 14:96257959-96257981 GGAAGGAGGGAAGGAGGGTAGGG + Intronic
1121769101 14:96516347-96516369 AGAATGAGGGAGGGAGGGGAAGG - Intronic
1121779966 14:96616039-96616061 GGAAAGAGGGAGGGAAGGAATGG - Intergenic
1121825229 14:97004957-97004979 GGAAGGAGGGAGGGAGGGAGGGG - Intergenic
1121847577 14:97186750-97186772 GGAGGGAGGGAGGGAGGGGAAGG - Intergenic
1121944376 14:98105038-98105060 GGAATGATGGCAGCAGGGTGAGG - Intergenic
1121956105 14:98214897-98214919 GGGATGTGGGAGGCAGGTCAGGG - Intergenic
1122096452 14:99376474-99376496 GGAGGGAGGGAGGGAGGGAAGGG + Intergenic
1122096545 14:99376679-99376701 GGAGGGAGGGAGGGAGGGAAGGG + Intergenic
1122211066 14:100174492-100174514 GGAGGGAGGGAGGGAGGGAAAGG + Intergenic
1122316490 14:100828506-100828528 GGAAGGAGGGGGGCAGGGAGAGG - Intergenic
1122519570 14:102333974-102333996 GGGATGTGGGTGGCAGGGGAGGG - Intronic
1122612260 14:102993546-102993568 GGAAAGAGGGAGGGAGGGAGGGG + Intronic
1122624647 14:103078182-103078204 GGAAGGAGGGAAGCAGAGGAAGG + Intergenic
1122704829 14:103614170-103614192 GGAAGGAGGGAGGGAAGGGAAGG - Intronic
1122738883 14:103859480-103859502 GAAGTGAGGGAGCCAGGGGAGGG + Intergenic
1123215868 14:106808861-106808883 GGAGAGAGGGAGGCAGGATTGGG - Intergenic
1123222581 14:106870894-106870916 AGAAGGATGGAGGCAGGATATGG + Intergenic
1123581961 15:21723451-21723473 GGAGGGAGGGAGGGAGGGAAGGG - Intergenic
1123618610 15:22166051-22166073 GGAGGGAGGGAGGGAGGGAAGGG - Intergenic
1123757253 15:23406634-23406656 GGAAGGAAGGAGGAAGGGAAGGG - Intergenic
1123778388 15:23602532-23602554 GGCATGAGTGGGGCAGGATAGGG - Intronic
1124050202 15:26190070-26190092 TGAATGAGGGAGTCATGGGAGGG - Intergenic
1124172385 15:27387862-27387884 GGAAGGAGGGAGGGAGGGAGGGG + Intronic
1124172386 15:27387866-27387888 GGAGGGAGGGAGGGAGGGGAAGG + Intronic
1124172424 15:27387973-27387995 GAAAGGAAGGAGGGAGGGTAAGG + Intronic
1124172448 15:27388048-27388070 GAAAGGTGGGAGGGAGGGTAAGG + Intronic
1124172472 15:27388125-27388147 GAAAGGAGGGAGGGAGGGTAAGG + Intronic
1124172486 15:27388175-27388197 GAAAGGAGGGAGGGAGGGTAAGG + Intronic
1124172512 15:27388258-27388280 GAAAGGAGGGAGGGAGGGTAAGG + Intronic
1124172533 15:27388335-27388357 GAAAGGTGGGAGGGAGGGTAAGG + Intronic
1124172548 15:27388385-27388407 GAAAGGAGGGAGGGAGGGGAAGG + Intronic
1124562562 15:30788850-30788872 GGAAGGAGGGAGGGAGTGAAGGG - Intergenic
1124637940 15:31376849-31376871 AGAAAGAGAGAGGCAGGGCAGGG - Exonic
1125339515 15:38661058-38661080 GGAGGGAGGGAGGGAGGGGAGGG - Intergenic
1125452339 15:39822410-39822432 GTAATGAGTGAGGCAGTGTTTGG - Intronic
1125641104 15:41231304-41231326 GGAAGGAGGGAGGGAAGGAAGGG - Exonic
1125887177 15:43237840-43237862 AGAGTGAGGGAGACAGGGAAGGG - Intronic
1126163108 15:45632191-45632213 GGAGGGAGGGAGGGAGGGGAGGG - Intronic
1126173383 15:45713084-45713106 GGAGGGAGGGAGGGAGGGGAGGG - Intergenic
1126213870 15:46132112-46132134 GCATTGATGGGGGCAGGGTAGGG + Intergenic
1126250095 15:46557177-46557199 GGGAGGAGGGAGGAAAGGTAGGG + Intergenic
1126322182 15:47436955-47436977 GAAAGGAAGGAGGCAGGGAAAGG + Intronic
1126520715 15:49591358-49591380 GGAGGGAGGGAGGGAGGGTGTGG - Intronic
1126520724 15:49591379-49591401 GGAAGGAGGGAGGGAGGGAAGGG - Intronic
1126860413 15:52877548-52877570 GGAGGGAGGGAGGGAGGGAAAGG - Intergenic
1126949645 15:53867422-53867444 GGAGAGAGGGAGGCAGGATGTGG - Intergenic
1127075203 15:55318813-55318835 TCAACGAGGTAGGCAGGGTAGGG - Intronic
1127179002 15:56395120-56395142 GGATTGAGGGGAGCAGGGTCAGG - Intronic
1127534983 15:59881748-59881770 GGAATGAAGGAGGCAGAATCGGG - Intergenic
1127899705 15:63331809-63331831 GGACTGAGGGATGCTGGTTAAGG + Intronic
1128149324 15:65353220-65353242 GGAGGGAGGGAGGGAGGGGAAGG - Intronic
1128149325 15:65353224-65353246 GGAAGGAGGGAGGGAGGGAGGGG - Intronic
1128451906 15:67810728-67810750 GGTAGGAGGGAGGGAAGGTAGGG + Intergenic
1128669746 15:69566197-69566219 GGAAGGAAGGAGGCCGGGCAGGG - Intergenic
1129139441 15:73583956-73583978 GGAAATAGGAAGGCAGGGCAAGG + Intronic
1129336374 15:74854427-74854449 TGAACCCGGGAGGCAGGGTAAGG - Intronic
1129338098 15:74866015-74866037 GAAAGGAGGGAGGGAGGGGAGGG + Intronic
1129351772 15:74959468-74959490 GGAGTGAGGGAGGAAGGATGGGG + Intronic
1129605845 15:77024723-77024745 GGAGGGAGGGAGGGAGGGAAGGG - Intronic
1129698500 15:77754245-77754267 GGAGTGAGGGGGGAAGGGGATGG + Intronic
1129899558 15:79136061-79136083 GGAGGGAGGGAGGGAGGGGAAGG - Intergenic
1129933041 15:79428235-79428257 GGAAGGAGGGAGGGAGAGGAGGG - Intergenic
1129933103 15:79428441-79428463 GGAAGGAGGGAGGGAGGAAAGGG - Intergenic
1129937506 15:79463157-79463179 GCCTTGAGGGAGGCAGGGTAGGG - Exonic
1129954840 15:79626822-79626844 GGAGGGAGGGAGGGAGGGAAAGG + Intergenic
1130127357 15:81105134-81105156 GGAGGGAGGGAGGGAGGGGAGGG - Intronic
1130391542 15:83460019-83460041 GGAGGGAGGGAGGGAGGGGAGGG - Intronic
1130549363 15:84879981-84880003 GGGATAAGGGAGGCAGAATAGGG - Intergenic
1130740582 15:86595577-86595599 GGAATGAGAGAGACAGGAGAGGG - Intronic
1130855994 15:87840714-87840736 GGAAGGAGGGAGGGAGGGAGGGG + Intergenic
1131283252 15:91038016-91038038 GGAAGGAGGGAGGGAGGAGATGG + Intergenic
1131388880 15:92031027-92031049 GGAGGGAGGGAGGGAGGGAAGGG + Intronic
1131460054 15:92611309-92611331 GGAGGGAGGGAGGCAGGGAGGGG + Intergenic
1131507570 15:93031091-93031113 GGGATGAAGGAGGCTGGGGACGG - Intergenic
1132079915 15:98854965-98854987 AGAACTAGGAAGGCAGGGTAAGG - Intronic
1132137756 15:99360157-99360179 GGAAACAGGGATGCAGGGTATGG - Intronic
1132437664 15:101822716-101822738 GGAGTGTGGGAGGGAGGCTAGGG - Intergenic
1132451105 15:101969040-101969062 TGGAAGAGGGGGGCAGGGTAGGG + Intergenic
1132664601 16:1075876-1075898 GGAGAGAGAGAGACAGGGTAGGG - Intergenic
1132755874 16:1485125-1485147 GGAGGGAGGGAGGGAGGGAACGG + Intergenic
1132802479 16:1761190-1761212 GGAAGGAGGCAGGGAGGGTGAGG - Intronic
1132918039 16:2364735-2364757 GGAGGGAGGGAGGGAGGGGAAGG + Intergenic
1133158001 16:3889419-3889441 GGAGGGAGGGAGGGAGGGGAGGG - Intergenic
1133299969 16:4776443-4776465 GGAATGAGGAAGGTGGGGGATGG + Intergenic
1133402659 16:5500111-5500133 GGAAGGAGGGAAGGAGGGAAGGG - Intergenic
1133402680 16:5500162-5500184 GGAGGGAGGGAGGCAGGGAGTGG - Intergenic
1133446466 16:5865348-5865370 GGAATGAGGGAGGGGAGGGAAGG + Intergenic
1133513491 16:6483597-6483619 GGAGAGAGGGAGGGAGGGAAGGG + Intronic
1133588283 16:7217006-7217028 GGAGGGAGGGAGGGAGGGAAGGG - Intronic
1133594011 16:7273041-7273063 GGAAGGAGGGAGGGAAGGGAGGG - Intronic
1133647175 16:7775245-7775267 GGAAGGAGGGAGGAAGGGAAGGG + Intergenic
1133724017 16:8520855-8520877 GGAGGGAGGGAGGGAGGGAAAGG + Intergenic
1133729130 16:8564926-8564948 GGAATGAGTGAGTGAGGGAATGG + Intergenic
1134201853 16:12205686-12205708 AGAATGAGGGAGGCAGCACAAGG - Intronic
1134291736 16:12907136-12907158 GGAGGGAGGGAGGGAGGGAAAGG - Intronic
1134318218 16:13139355-13139377 GGAGGGAGGGAGGGAGGGGAGGG - Intronic
1134459076 16:14416101-14416123 GGAAGGAGGGAGGGAGGTAAGGG + Intergenic
1134748045 16:16602953-16602975 GGAGGAAGGGAGGCAGGGGAGGG - Intergenic
1134760435 16:16709798-16709820 GGAGGGAGGGAGGGAGGGTAGGG - Intergenic
1134985625 16:18649375-18649397 GGAGGGAGGGAGGGAGGGTAGGG + Intergenic
1134997417 16:18750674-18750696 GGAGGAAGGGAGGCAGGGGAGGG + Intergenic
1135093523 16:19541704-19541726 GAAAAGAGGGAGGGAGGGAAGGG + Intronic
1135671526 16:24379744-24379766 GGAATGAGAGGGGCTGGGTTTGG - Intergenic
1135822140 16:25693373-25693395 GGAGCGCGGGAGGCAGGGCAGGG - Intronic
1135836221 16:25828122-25828144 GGAGGGAGGGAGGGAGGGAAGGG - Intronic
1135913128 16:26579165-26579187 GGAAGGAGGGAGGGAGGGAAGGG - Intergenic
1135927705 16:26709863-26709885 GGAGGGAGGGAGGGAGGGAAGGG + Intergenic
1135937470 16:26793310-26793332 GGAAGGAGGAAGACAGGGGAAGG + Intergenic
1136349564 16:29698023-29698045 GGAGGGAGGGAGGGAGGGAAAGG + Exonic
1136505830 16:30702564-30702586 GGAGGGAGGGAGGGAGGGAAGGG - Intronic
1136556032 16:31008398-31008420 GGTAAGGGGGAGGCAGGGGAGGG - Intronic
1136686350 16:31996944-31996966 GGAGGGAGGGGGCCAGGGTAAGG + Intergenic
1136769360 16:32821976-32821998 GGAAGGAGGAAGGCAAGGGAAGG - Intergenic
1136786963 16:32940473-32940495 GGAGGGAGGGGGCCAGGGTAAGG + Intergenic
1136798747 16:33049158-33049180 GGAAGGAGGAAGGCAAGGGAAGG + Intergenic
1136882810 16:33913316-33913338 GGAGGGAGGGGGCCAGGGTAAGG - Intergenic
1137057275 16:35751744-35751766 GAAATGAGGGAGCCAGAGTCAGG - Intergenic
1137219765 16:46437143-46437165 GGAAGGAAGAAGGCAGGGGAAGG - Intergenic
1137364929 16:47852424-47852446 GCAATGAGGGAGGCAGCCTCAGG + Intergenic
1137479612 16:48840969-48840991 GGAAAGAACGAAGCAGGGTATGG + Intergenic
1137520010 16:49184445-49184467 GGAATGATACAGGCAGGGTGGGG + Intergenic
1137558004 16:49484773-49484795 GGAAGGAGGGAGGGAGGGAAGGG - Intergenic
1137784300 16:51125200-51125222 GGAAGGTGGGAGGGAGGGTCTGG + Intergenic
1137799416 16:51248506-51248528 GGAGGGAGGGAGGGAGGGAAAGG - Intergenic
1137801016 16:51262137-51262159 GGAAGGAGGGAGGTAGGGAAAGG - Intergenic
1138264141 16:55647385-55647407 GAAGTGAGGGAGGGAGGGAAGGG + Intergenic
1138420770 16:56897758-56897780 GGACAGAGGGAGGCAGAGGAAGG - Intronic
1138498462 16:57423256-57423278 GGAAGGAGTGAGGGAGGGGAAGG + Intergenic
1138498482 16:57423312-57423334 GGAAGGAGTGAGGGAGGGGAAGG + Intergenic
1138515455 16:57533407-57533429 TGTATGAGTGGGGCAGGGTAGGG - Intronic
1138641445 16:58391205-58391227 GGAATGGGCGAAGCAGGGAAGGG + Intronic
1139004198 16:62551256-62551278 GGAGGGAGGGAGGGAGGGCAGGG - Intergenic
1139209665 16:65064993-65065015 GGGATGCTGGAGGCAGGGTCTGG - Intronic
1139352924 16:66348506-66348528 GGGCTGAGCGGGGCAGGGTAAGG + Intergenic
1139355918 16:66366973-66366995 GGGCTGAGGGGGGCAGGGCAAGG + Intronic
1139439775 16:66960343-66960365 GGAGGGAGGGAGGGAGGGGAGGG - Intergenic
1139614296 16:68079754-68079776 GGGATGAGGAAGGCGGGGGACGG - Intergenic
1139691833 16:68646221-68646243 GGAAGAAGGGGGGCGGGGTAGGG - Intronic
1139732480 16:68958513-68958535 GGAAGGAAGGAAGCAGGGGAGGG + Intronic
1139818620 16:69700104-69700126 GGAAGAAGGGAGGCAGGGAGGGG - Intronic
1140306126 16:73804898-73804920 GGAGGGAGGGAGGGAGGGGAGGG + Intergenic
1140441882 16:74994160-74994182 GGTATGAGGGAGAAAGAGTATGG - Intronic
1140463331 16:75159320-75159342 GGAGGGAGGGAGGGAGGGAAAGG - Intronic
1140914628 16:79482985-79483007 GGAAGGAGGGAGTGAGGGGAGGG - Intergenic
1140914676 16:79483115-79483137 GGAAGGAGGGAGGGAGGGGAGGG - Intergenic
1141090842 16:81129350-81129372 GGAAGGAGGGAGGGAAGGGAAGG - Intergenic
1141411668 16:83838364-83838386 GGAAGGAGGGAGGAAGGGGAGGG + Intergenic
1141922756 16:87146954-87146976 GGAGTGAGTGTGGCAGGGAAAGG - Intronic
1141927434 16:87178661-87178683 GGAAGGAGGGAGAGAGGGAAGGG - Intronic
1141927826 16:87180879-87180901 GGAAGGAAGGAGGCCGGGTGTGG + Intronic
1141980558 16:87547523-87547545 GGACTGAGGGAGGAAGGCTGTGG + Intergenic
1142115939 16:88356144-88356166 GGCACGAGGGATGGAGGGTACGG - Intergenic
1142174632 16:88639486-88639508 GGACAGTGGGAGGCAGGGCACGG - Intronic
1203071776 16_KI270728v1_random:1084081-1084103 GGAAGGAGGAAGGCAAGGGAAGG - Intergenic
1203089199 16_KI270728v1_random:1202143-1202165 GGAGGGAGGGGGCCAGGGTAAGG + Intergenic
1142499235 17:323149-323171 GGAAGGAGGGAGGCGGGTTCAGG + Intronic
1142549832 17:732116-732138 GGAAGGAGGGAGGCGGCGTGTGG - Intergenic
1142675449 17:1510571-1510593 GGAGAGAGGGAGGAAGGGAAGGG - Intronic
1142769316 17:2085272-2085294 GGAACAAGGGAGGGAGGGTAGGG + Intronic
1142928207 17:3259638-3259660 GGACTGAGGGAGCCATGGTTTGG + Intergenic
1142958138 17:3535127-3535149 GGAAGGAGGGAGGAAGGGAGGGG - Intronic
1143091286 17:4450370-4450392 GGAAGGAGGGAGGGAGGGGTAGG - Intronic
1143325320 17:6094733-6094755 GGAAGGAGGGAGGGAGGGAATGG + Intronic
1143473332 17:7190008-7190030 GAAATGCGGGAGGGAGGGTGGGG - Exonic
1143473940 17:7192485-7192507 GGAGGGAGGGAGGGAGGGCAGGG + Intronic
1143551458 17:7632874-7632896 GGCCTAAGGGAGGCAGGGCAAGG - Exonic
1143588786 17:7867177-7867199 GGAAAGCGGGAGGCGGGGGAGGG + Intronic
1143594984 17:7908833-7908855 GGAATGAGGGAGGAAAGGAGCGG + Intronic
1143627757 17:8121073-8121095 GGAAAGAGAGAGATAGGGTAGGG - Exonic
1143896168 17:10137870-10137892 GGAAGAAGGGAGGGAGGGAAAGG + Intronic
1144181584 17:12757209-12757231 GGTATGAAGGATCCAGGGTATGG + Intronic
1144247785 17:13384430-13384452 GAAAGGAGGGAGGGAGGGGAGGG + Intergenic
1144561005 17:16320282-16320304 GGAGGGAGGGAGGAAGGGGAAGG + Intronic
1144572026 17:16406308-16406330 GGAGGGAGGGAGGGAGGGAAGGG + Intergenic
1144587359 17:16495351-16495373 GGAAGGAGGGAGGGAAGGGAGGG - Intergenic
1144587361 17:16495355-16495377 GGAAGGAAGGAGGGAGGGAAGGG - Intergenic
1144624266 17:16836790-16836812 GGGAGGAAGGAGGCAGGGTGCGG - Intergenic
1144659993 17:17061733-17061755 GGTGTGAGGGAGCCAGCGTAGGG + Intronic
1144747562 17:17626079-17626101 GTGAAGAGGGAGGCAGGGCAGGG - Intergenic
1144882163 17:18435929-18435951 GGGAGGAAGGAGGCAGGGTGCGG + Intergenic
1145016442 17:19401722-19401744 GGAAGGATAGAGGCAGGGTAAGG - Intergenic
1145150070 17:20508457-20508479 GGGAGGAAGGAGGCAGGGTGCGG - Intergenic
1145254788 17:21316632-21316654 TGAATGAGGGAGGGAGGGAAGGG + Intergenic
1145321812 17:21771333-21771355 TGAATGAGGGAGGGAGGGAAGGG - Intergenic
1146488444 17:33262446-33262468 GGAAGGAGGGAGGCAAGGTATGG + Intronic
1146678472 17:34790188-34790210 GGAGGGAGGGAGGGAGGGGAGGG + Intergenic
1146691037 17:34876355-34876377 GGAGTGAGGGAAGCAGGATGGGG - Intergenic
1146700065 17:34949508-34949530 GGAGGGAGGGAGGGAGGGAAAGG + Intronic
1146892251 17:36513737-36513759 GGTAGGTGGGAGGCTGGGTAGGG + Intronic
1146913825 17:36665369-36665391 GGAAGGTGGGAGGCCGGGTGAGG - Intergenic
1147147310 17:38492612-38492634 GGAGGGAGGGGGCCAGGGTAAGG + Intronic
1147250039 17:39147657-39147679 GGGAAGAGGGAGGGAGGGAAGGG + Intronic
1147261570 17:39212182-39212204 GGACAGAGGGAGGAAGGGTATGG + Exonic
1147323139 17:39657941-39657963 GGAGGGAGGGAGGAAGGGGAAGG - Intronic
1147383475 17:40069225-40069247 GGAAGGAGGGAGGAAGGGGGAGG - Intronic
1147487682 17:40833492-40833514 GGAAGGAAGGAAGCAGGGGAGGG - Intronic
1147528199 17:41247490-41247512 GGAAGGAGGGAGGGAGGGAAAGG + Intronic
1147578403 17:41615512-41615534 GGGAGGAAGGAGGCAGGGTGTGG - Intronic
1147590480 17:41680022-41680044 GGAGGGAGGGAGGGAGGGGAGGG + Intergenic
1147725270 17:42562913-42562935 GGACTGAGGTGGGCAGGGGAGGG - Exonic
1147762117 17:42805472-42805494 GGAATTAGGGAGGAAAGGAAGGG + Intronic
1147780133 17:42935035-42935057 GAAAGGAGGGAGGGAGGGGAGGG - Intergenic
1147945230 17:44077026-44077048 GGATTGAGGGAGCCAGGGGAGGG - Exonic
1148106526 17:45121597-45121619 GGAAGGAGGGAGATGGGGTACGG - Intronic
1148231937 17:45941617-45941639 GGAAAGAGGGAAGGAGGGAAGGG - Intronic
1148261030 17:46183637-46183659 GGAAGGAGGGAGGGAAGGAAGGG + Intronic
1148771638 17:50070813-50070835 GGATTGAGGGAGGGAGAGTAGGG - Intronic
1148859123 17:50594964-50594986 GGAAAGGGGGAGGCAGGGGAGGG - Intronic
1149007522 17:51821120-51821142 GGAGGGAGGGAGGGAGGGAAGGG - Intronic
1149302914 17:55321191-55321213 GGAGTGAAGGAGGGAGGGGATGG - Exonic
1149333610 17:55611073-55611095 TGTATGAGGGAGGGAGGGAAAGG - Intergenic
1149449694 17:56739905-56739927 GGAGTGAGGGAGGCAGCCTTCGG - Intergenic
1149449932 17:56742028-56742050 GGAGGGAGGGAGGGAGGGAAAGG + Intergenic
1149570692 17:57670285-57670307 GGAATTAGGCATGGAGGGTAGGG - Intronic
1149588394 17:57809186-57809208 GGAGAGAGGGAGGCAGGCAAGGG + Intergenic
1149787961 17:59452444-59452466 GGAAACAGGCAGGCAGGGTGTGG - Intergenic
1150223004 17:63507801-63507823 GGCAGGAGGGAGGCAGGGAGTGG + Intronic
1150269027 17:63850482-63850504 GGAAGGAGGCAGGGAGGGAAGGG + Intergenic
1150293119 17:63993144-63993166 GGAAGGAAGGAGGGAGGGAAGGG + Intergenic
1150293164 17:63993268-63993290 GGAAGGAGGGAGGGAGGGAAGGG + Intergenic
1150293182 17:63993321-63993343 GGAAGGAGGGAGGGAGGGAAGGG + Intergenic
1150293193 17:63993346-63993368 GGAGGGAGGGAGGGAGGGAAGGG + Intergenic
1150293202 17:63993367-63993389 GGAAGGTGGGAGGGAGGGAAGGG + Intergenic
1150293210 17:63993388-63993410 GGAAGGAGGGAGGGAAGGGAAGG + Intergenic
1150293218 17:63993405-63993427 GGAAGGTGGGAGGGAGGGAAGGG + Intergenic
1150293237 17:63993454-63993476 GGAAGGAGGGAGGGAGGGAAGGG + Intergenic
1150533060 17:66006234-66006256 GGAAAGAGGTAGGCATGGTGCGG - Intronic
1150697737 17:67420378-67420400 GGAGGGAGGGAGGGAGGGGAGGG - Intronic
1150698351 17:67425464-67425486 GGAGGGAGGGAGGGAGGGGAAGG - Intronic
1150698352 17:67425468-67425490 GGAAGGAGGGAGGGAGGGAGGGG - Intronic
1150726815 17:67658020-67658042 TGAATCAGGGAGGGAGGGCAAGG + Intronic
1150908742 17:69366412-69366434 GGAAGGAGGAAGGGAGGGGAAGG - Intergenic
1150984862 17:70184559-70184581 GGAGGGAGGGAGGGAGGGGAGGG - Intergenic
1151200181 17:72462114-72462136 GGAAAGAGAGAGGAAGGGAAGGG - Intergenic
1151226253 17:72650487-72650509 GGCATGAGGGAAGCAGAGGAGGG + Intronic
1151276555 17:73038786-73038808 GGGAGGAGGGAGGGAGGGGAGGG + Intronic
1151278684 17:73055612-73055634 GAAATGAGGGAAGGCGGGTAGGG + Intronic
1151327598 17:73388735-73388757 GGAAGGAGGGAGGGAAGGAAGGG - Intronic
1151356721 17:73563003-73563025 GGGAGGAGGAAGGCAGGGGAGGG + Intronic
1151617891 17:75226242-75226264 GGTCTGAGGGAAGAAGGGTAAGG - Intronic
1151643469 17:75413777-75413799 GGAAGGAGGGAGGGAGGGAAGGG - Intergenic
1151956568 17:77383123-77383145 GGAGGGAGAGAGGGAGGGTAGGG - Intronic
1152187091 17:78864324-78864346 GGAAGGAGGGAGGGAGTGAAGGG - Intronic
1152243051 17:79170160-79170182 GGAAGGAGGAAGGAAGGGGAAGG + Intronic
1152417342 17:80171164-80171186 GGAGGGAGGGAGGAAGGGGAGGG - Intronic
1152441512 17:80312774-80312796 GAAAAGAGGGAGGGAGGGAACGG - Intronic
1152456858 17:80421739-80421761 AGGATGAGGGGGGCAGGGCATGG + Intronic
1152460551 17:80439905-80439927 GCAAGGTGGGAGGCAGGCTAAGG + Intergenic
1152570482 17:81119328-81119350 GGCACGCGGGAGGCAGGGCACGG - Intronic
1152674647 17:81632602-81632624 GAAATAAGGGAGGCCGGGTGTGG - Intronic
1152940402 17:83169216-83169238 GGAGGGAGGGAGGGAGGGAAGGG - Intergenic
1153296502 18:3551677-3551699 GGAGGGAGGGAGGGAGGGGAGGG - Intronic
1153299811 18:3582846-3582868 GGAAGGAGGGAGGGAGGGAGGGG - Intronic
1153366795 18:4265638-4265660 GGAGGGAGGGAGGGAGGGAAGGG - Intronic
1153560009 18:6362204-6362226 GGAAGGAGGGAGGGAGGGGAGGG + Intronic
1153870630 18:9316180-9316202 GGAAGGAGGGAGGGAGGTGAGGG + Intergenic
1153954799 18:10087119-10087141 TAAATGAGGGAGGAAGAGTAAGG - Intergenic
1154138640 18:11802956-11802978 GGAATCAGGGAGCCAGGGAATGG + Intronic
1154167190 18:12024733-12024755 AGAAAGAGGGAGGAAGGGCAGGG - Intronic
1154466497 18:14647710-14647732 GGAAGGAGGGAGGAAAGGAAAGG - Intergenic
1155514488 18:26610629-26610651 GGAAGGAGGGAGGGAGAGAAGGG + Intronic
1155829196 18:30491869-30491891 AGAGTGAGGGAGGGAGGGAAGGG + Intergenic
1155922135 18:31614130-31614152 GGAGGGAGGGAGGGAGGGAAGGG + Intergenic
1155993348 18:32303975-32303997 AGAAAGAGGGAGGGAGGGGAGGG + Intronic
1156050596 18:32929061-32929083 GGAGAGAGGGAGGAAAGGTATGG - Intergenic
1156259587 18:35432479-35432501 AGAATGAGGGAGGGAGGGGGAGG + Intergenic
1156291067 18:35748864-35748886 GGAATGAGGGAGACAGGAGAAGG - Intergenic
1157220426 18:45825323-45825345 GGAAGGAGGGAGGGAGAGGAAGG + Intergenic
1157474512 18:48012798-48012820 GGAGGGAGGGAGGGAGGGAAAGG - Intergenic
1158200111 18:54930620-54930642 GGAGGGAGGGAGGGAGGGGAAGG - Intronic
1158522613 18:58184192-58184214 GGAATGAGGGTGTCCTGGTAGGG + Intronic
1158556231 18:58477025-58477047 TGAATGAGGATGGCAGGGAAAGG - Intergenic
1158707993 18:59811321-59811343 GGAAGGAGGGAGGGAAGGGAAGG - Intergenic
1159550799 18:69894423-69894445 GGAGGGAGGGAGGGAGGGAAGGG + Intronic
1159633949 18:70782801-70782823 GGAAGGAGGGAGAAAGGGAAAGG - Intergenic
1159987295 18:74858164-74858186 GGAAAGAAGGAGGGAGGGAAGGG - Intronic
1160174970 18:76585941-76585963 GAAAGGAGGGAGGCAGGGAAGGG - Intergenic
1160201060 18:76795742-76795764 GGAAGGAGGGAGGGAGGGAAAGG + Intronic
1160381309 18:78458276-78458298 GGAAGGAGGCAAGCAGGGGAGGG + Intergenic
1160545052 18:79647406-79647428 GGAGGGAGGGAGGAAGGGGAGGG + Intergenic
1160634159 19:63507-63529 TGGAAGAGGGGGGCAGGGTAGGG - Intergenic
1160872149 19:1282416-1282438 GGAGAGAGGGAGGGAGGGGAAGG + Intergenic
1161100264 19:2418304-2418326 GGAGGGAGGGAGGGAGGGAAAGG - Intronic
1161256162 19:3310990-3311012 GGAGAGAGGGAGGGAGGGAAGGG - Intergenic
1161404082 19:4082063-4082085 GGAAGGAGGGAGGAGGGGCATGG - Intergenic
1161426916 19:4208737-4208759 GGAGAGAGGGAAGCAGGGTCAGG - Intronic
1161442610 19:4300826-4300848 GGAGAGAGGGAGGAAGGGTTGGG + Intronic
1161490853 19:4560422-4560444 AGAATGAAGGAGGCTGGGCATGG - Intergenic
1161491189 19:4562659-4562681 AGAATGAAGGAGGCTGGGCATGG - Intergenic
1161491433 19:4564135-4564157 AGAATGAAGGAGGCTGGGCATGG - Intergenic
1161578464 19:5067626-5067648 GGCATGGGGGAGGGAGGGGAGGG + Intronic
1161600547 19:5179805-5179827 GGAGGGAGGGAGGGAGGGGATGG - Intronic
1161730477 19:5957525-5957547 GGAGGGAGGGAGGGAGGGGAAGG - Intronic
1161754147 19:6119372-6119394 GGAAGGAGGGAGGGAGGGAAAGG - Intronic
1161805592 19:6441435-6441457 TGCCTGAGGGAGGCAGGGTCTGG + Exonic
1161814952 19:6494359-6494381 GGAAGCGGGGAGGGAGGGTAGGG + Exonic
1161918788 19:7250602-7250624 GGAGGGAGGGAGGGAGGGCAGGG + Intronic
1161955901 19:7494995-7495017 GGAAGGAGGGAGGGAGGGGAAGG - Intronic
1161955913 19:7495031-7495053 GGAAGCAGGGAGGGAGGGAAAGG - Intronic
1162030390 19:7914740-7914762 GCAAGGAGGGAGGCAGGGAGCGG - Intergenic
1162072950 19:8165868-8165890 GGAAGGAGGGAGGGAGGGAGGGG + Intronic
1162304480 19:9863412-9863434 GGAACGAGGGAGGGAGGCCAGGG + Intronic
1162797662 19:13095178-13095200 GGAGGGAGGGAGGGAGGGAAGGG - Exonic
1162846086 19:13393760-13393782 GGAGGGAGGGAGGGAGGGAAGGG - Intronic
1162863383 19:13525153-13525175 GGAATGAGCCAGGCAGGGTGAGG + Intronic
1162924773 19:13924842-13924864 GAGATGGGGGAGCCAGGGTAAGG - Intronic
1162994088 19:14322654-14322676 GGAAGGAGAGAGGAAGGGTCAGG - Intergenic
1163128299 19:15256382-15256404 GGCATAGGGGAGGCAGGGGAAGG + Intronic
1163213722 19:15860948-15860970 GGAATGGGGGAGGGGGGGTGGGG + Intergenic
1163607340 19:18282211-18282233 GGAAGGAAGGAGGGAGGGTGAGG - Intergenic
1163630765 19:18417052-18417074 GGAAGGAGGGAGGGAGGCTGAGG - Intergenic
1163758782 19:19121726-19121748 GGAATGGGGGAGGGAGGCAAGGG - Intronic
1164425166 19:28134846-28134868 GGGAGGAAGGAGGAAGGGTAAGG - Intergenic
1164441833 19:28284906-28284928 GGAAGGAGGGTGGAAGGGAAGGG + Intergenic
1164490909 19:28713730-28713752 GGAATGGAGGAGGCAGAGCAAGG + Intergenic
1164494412 19:28746287-28746309 GGAATGGGGAAGGCAGGGGGTGG - Intergenic
1164573222 19:29388880-29388902 GGAAAGAAGGAGGGAGGGCATGG + Intergenic
1164771883 19:30816015-30816037 GGAAAGAGGGAGGAAAGGGAGGG - Intergenic
1164787452 19:30944794-30944816 GGAAAGGGGGAGGGAGGGAAGGG + Intergenic
1164953644 19:32361878-32361900 GGAGGGAGGGAGGGAGGGGAGGG - Intronic
1165189341 19:34049363-34049385 GGAGGGAGGGAGGGAGGGAAGGG + Intergenic
1165345188 19:35242443-35242465 GGAATGACAGAGGCCAGGTATGG + Intergenic
1165614112 19:37183527-37183549 AGAATAAAGGAGGAAGGGTAAGG + Exonic
1165797666 19:38528252-38528274 GGAGTGAGAGGGGCAGGGTCTGG + Intronic
1165803860 19:38568443-38568465 GGGGTGAGGGAGGCTGGGCACGG + Intronic
1165803928 19:38568831-38568853 AGAATGAGGGATGGAGGGAAAGG + Intronic
1165833745 19:38742560-38742582 GGAAGGAGGGAGGCCTGGTGCGG + Intronic
1166076794 19:40418341-40418363 GGAAGGAGGGAGGGAAGGAAGGG - Intergenic
1166213740 19:41322994-41323016 GGAAAGAGGGAGCGGGGGTAGGG - Exonic
1166304987 19:41932471-41932493 GGGAGGAGGGAGGCAGGGAGAGG + Intergenic
1166556354 19:43702706-43702728 GGAAAGGAGGAGGCAGGGAAGGG - Intergenic
1166580667 19:43895819-43895841 GGAGGGAGGGAGGAAGGGAAGGG + Intronic
1166658451 19:44629082-44629104 GGGAGTAGGGAGGCAGGGGAAGG + Intronic
1166820548 19:45576741-45576763 GGAAAGAGGGAGGCAAGAGAGGG - Intronic
1166853719 19:45772086-45772108 GGGCTGAGGGAGGTAGGGAAGGG - Intronic
1166864165 19:45826069-45826091 GGGCTGTGGGAGTCAGGGTAGGG - Intronic
1166978980 19:46621721-46621743 GGGAGGAGGGAGCCAGGGTGGGG - Intronic
1167144276 19:47672591-47672613 GGATGGATGGAGGCAGGGAAGGG + Intronic
1167159734 19:47759488-47759510 GAAATGAGTGAGGCTGGGCATGG + Intergenic
1167206456 19:48105816-48105838 GGAGGGAGGGAGGGAGGGGAGGG - Intronic
1167304425 19:48698979-48699001 GGAGGGAGGGAGGGAGGGAAGGG - Intronic
1167315028 19:48757838-48757860 GGTCTGAGGGAGGCAGGGCTGGG + Intronic
1167379091 19:49128305-49128327 TGAATGAAGGAGACAGGGAAAGG + Intronic
1167554171 19:50182985-50183007 GGAGGGAGGGAGGGAGGGAAAGG - Intergenic
1167555008 19:50189081-50189103 GGAGGGAGGGAGGGAGGGCAAGG - Intronic
1167564148 19:50245929-50245951 GGAGGGAGGGAGGGAGGGAAGGG - Intronic
1167651152 19:50729693-50729715 GGAGTGAGGGGGGGAGGGAAGGG + Intergenic
1167893524 19:52561978-52562000 GAAATGAGGGAGACAGGAAAAGG - Intronic
1168017069 19:53582107-53582129 GGAATGTGGGAGTAGGGGTAGGG + Intergenic
1168220368 19:54956147-54956169 GGAAGGAGGGAAGGAGGGAAGGG + Intronic
1168273434 19:55262727-55262749 AGAATGCTGGAGGCAGGGTCCGG - Intronic
1202682409 1_KI270712v1_random:19043-19065 GGAAGGAGGAAGGCAAGGGAAGG + Intergenic
925160215 2:1678201-1678223 GGAGGCAGGGAGGCCGGGTAAGG - Intronic
925196389 2:1929317-1929339 AGGATGAGGGAGGCAGAGGAGGG - Intronic
925217542 2:2110527-2110549 GGACAGAGGGAGGCAGGGACAGG - Intronic
925231516 2:2237227-2237249 GGAATGAGGTGGGAAGGGAAGGG - Intronic
925293143 2:2761705-2761727 GGCCTGCGGGATGCAGGGTAAGG - Intergenic
925385381 2:3458325-3458347 GGAGTGAGGGAGTGAGGCTAGGG - Intronic
925434694 2:3826917-3826939 GAAGGGAGGGAGGCAGGGGAGGG - Intronic
925434702 2:3826934-3826956 AGAGGGAGGGAGGCAGGGAAGGG - Intronic
925456645 2:4021988-4022010 GGAATTAGGGAGGTAGAGTATGG + Intergenic
925462523 2:4075753-4075775 GGAAGGAGGAAGGAAGGGAAGGG - Intergenic
925622238 2:5805270-5805292 GGAATGAGGAAGACAGAGCAGGG - Intergenic
925657888 2:6168930-6168952 GGAAGGAGGGAGGGAGAGGAGGG - Intergenic
925716087 2:6785684-6785706 GGAAGCAGGGAGGCAGGATATGG + Intergenic
926225031 2:10961306-10961328 GGAATCAGGGAGACCGGGCAGGG + Intergenic
926384522 2:12323247-12323269 CAAATGAGAGAGGCAGGGTTTGG + Intergenic
926418738 2:12676297-12676319 GGAATGAGGGGTGCAGGGGGAGG - Intergenic
926495028 2:13575816-13575838 GGAGGGAGGGAGGGAGGGAAGGG - Intergenic
926667861 2:15544381-15544403 GGAAAGAGGGAAGCAGGGAAGGG + Intronic
926828803 2:16937242-16937264 GGAAGGAGGGAAGGAGGGAAAGG + Intergenic
926828814 2:16937267-16937289 GGAGGGAGGGAGGGAGGGGAAGG + Intergenic
926878897 2:17518585-17518607 GGACTGAGGGAGGCGGGGCGGGG - Intergenic
926937467 2:18100772-18100794 GGAGGGAGGGAGGAATGGTAAGG + Intronic
927003974 2:18828255-18828277 GAAATCAGGGAGGCAGAGTAGGG - Intergenic
927441810 2:23124119-23124141 GGAGTGAGGGAGAGAGGATAGGG - Intergenic
927482453 2:23465150-23465172 GTACTGTGGCAGGCAGGGTATGG + Intronic
927642868 2:24856527-24856549 GGGCTGTGGGAGGCAGGGAATGG + Intronic
927676157 2:25107649-25107671 GGAATGAGGGAAGCAAGGGAGGG - Intronic
927761621 2:25761382-25761404 GGAATGAAAGAGGCTGGGCAAGG + Intronic
927827408 2:26318096-26318118 GGGATGGGGCAGGCAGGGAAGGG + Exonic
928018284 2:27679904-27679926 GGAGTGAGGGAAGCAGGAGAGGG + Intronic
928029749 2:27768215-27768237 GGAATGGGGAATGCAGGGTGAGG + Intergenic
928235499 2:29535964-29535986 GGAGAGAGGAAGGCAGGGCAGGG - Intronic
928254655 2:29711609-29711631 GAAATGATGCAGGCAGGGTGGGG + Intronic
928300779 2:30122085-30122107 AGAAGGAGGGAGACAGGCTAGGG + Intergenic
928436439 2:31257450-31257472 GGAGGGAGGGAGGCAGGGAGCGG + Intronic
928681775 2:33710174-33710196 GGGATGAAGCAGGCAGGGGAAGG - Intergenic
928742634 2:34373192-34373214 GGACGGAGGGAGGGAGGGAAGGG - Intergenic
928921617 2:36533949-36533971 GGAAAGAGGGTGGGAGGGAAAGG + Intronic
928921882 2:36535116-36535138 GGAGGGAGGGAGGGAGGGAAGGG + Intronic
929789382 2:45012330-45012352 GGAATGGGCCAGGCAGGGAAGGG - Intergenic
929839311 2:45440823-45440845 GGAAGGAGGGAGGGAAGGCAGGG + Intronic
930036844 2:47091157-47091179 GGAGGGAGGGAGGGAGGGGAAGG + Intronic
930103919 2:47625188-47625210 GGGATGAGGGAGGCAGGGGCAGG - Intergenic
930107071 2:47648774-47648796 GGACTGAGGGAGGTAAGGTTTGG + Intergenic
930312218 2:49755868-49755890 GGAGAGAGGGAGGGAGGGAAGGG + Intergenic
930366538 2:50446483-50446505 GGAAGGAGGGAGGGAAGGAAGGG - Intronic
930523695 2:52498941-52498963 GGAAGGAGGGAGGGAGGGAGGGG + Intergenic
930833442 2:55770117-55770139 GGAAGGAGGGAGGGAGGGAAAGG - Intergenic
930840685 2:55841793-55841815 GGAGTGAGAGGGGCAGGATATGG + Intergenic
931039439 2:58280617-58280639 GGAATGATGGAAGGAAGGTACGG + Intergenic
931212762 2:60213615-60213637 GGAATGTGGGAGGAGGGCTAAGG - Intergenic
931989048 2:67771040-67771062 GAGATGAGTGGGGCAGGGTAGGG + Intergenic
932368404 2:71167472-71167494 GGAAGAAGGCAGGAAGGGTAGGG + Intergenic
932400613 2:71478773-71478795 GGAGGGAGGGAGGCAGGGAGGGG - Intronic
932508171 2:72257029-72257051 GGCATGAGGGAGTCAGCCTAGGG - Intronic
932734389 2:74244404-74244426 GGAAGGAGGGAGGGAAGGAAGGG - Intronic
932934464 2:76086058-76086080 GGGATAAGGAAGGCAGGGTAGGG - Intergenic
933069249 2:77836770-77836792 GGAGGGAGGGAGGGAGGGCAGGG + Intergenic
933143051 2:78817228-78817250 GGAAGGAGGGAGGGAAGGAAGGG + Intergenic
933206523 2:79513299-79513321 AGGATGAGGGAGGGAGGGTTGGG - Intronic
933254736 2:80068149-80068171 GGAAGGAGAGAGGCAGGAAAAGG + Intronic
933498781 2:83086141-83086163 GGAGGGAGGGAGGGAGGGGAGGG - Intergenic
933570886 2:84010257-84010279 GGAGAGAGGGAGGCAGGCAAAGG + Intergenic
933641197 2:84762074-84762096 GGAATGGGGTAGGTAGGGTAGGG + Intronic
933717132 2:85369830-85369852 GGTATGAGGGTAGCAGGGTTTGG + Exonic
933940657 2:87242116-87242138 AGAATGAGGGAGGGAGGGAGGGG - Intergenic
933945467 2:87282696-87282718 GCAAAGCGGGAGGCAGGCTATGG - Intergenic
934096858 2:88614779-88614801 GACATGTGAGAGGCAGGGTAGGG - Intronic
934547128 2:95227103-95227125 GGAGGGAGGGAGGGAGGGGAGGG - Intronic
934880443 2:97972438-97972460 GGAGGGAGGGAGGGAGGGGAGGG + Intronic
934921618 2:98348557-98348579 GGAATGAGGGAGGAAGGGGAGGG - Intronic
935287485 2:101578467-101578489 GGAAGGAGGGAGGGAAGGAAGGG + Intergenic
935308381 2:101759605-101759627 GGAATGGGGAAGGGAGGGAAGGG - Intronic
935523631 2:104140342-104140364 GGCATCAGGGAGGTAGGGCAGGG - Intergenic
935717019 2:105948069-105948091 GGAAGGAGGGAGGGAGGGAGGGG + Intergenic
935989845 2:108709298-108709320 GGAGGGAGGGAGGCAGGGAGGGG + Intergenic
936174686 2:110209536-110209558 GGAGAAAAGGAGGCAGGGTAGGG + Intergenic
936250874 2:110867175-110867197 GGGATGAGGGAGGCAAGGAAGGG + Intronic
936334742 2:111578892-111578914 GCAAAGCGGGAGGCAGGCTATGG + Intergenic
936506916 2:113115472-113115494 GGAAAGAAGGAGGTAGGGGAAGG - Intronic
936563495 2:113562983-113563005 AGATTAGGGGAGGCAGGGTAGGG - Intergenic
936567318 2:113591521-113591543 TGGAAGAGGGGGGCAGGGTAGGG + Intergenic
936589387 2:113788665-113788687 GGAAGGAGGGAGAGAGGGAAGGG + Intergenic
937305457 2:120867809-120867831 GGAAGGAGGGAGGGAGGATGGGG + Intronic
937342839 2:121102310-121102332 GGACTGGAGGATGCAGGGTAAGG + Intergenic
937375594 2:121333793-121333815 GGAATTGGGGAGGCAGGGCTGGG - Intergenic
937509936 2:122583684-122583706 GAAAGGAGGGAGGGAGGGAAAGG + Intergenic
938341677 2:130540230-130540252 GGAATGTGGGAAGCAAGGTGTGG + Intronic
938348152 2:130580479-130580501 GGAATGTGGGAAGCAAGGTGTGG - Intronic
938367914 2:130749703-130749725 AGAATGAGGGGGGCTGGGTGAGG - Intergenic
938408446 2:131045485-131045507 GGAATGATGTCAGCAGGGTAAGG - Intronic
938968438 2:136408598-136408620 GGCATGAGGGAGTGAGAGTAAGG - Intergenic
939175124 2:138739511-138739533 GGAATGAGGGAGAGAGGAAATGG + Intronic
939241120 2:139560780-139560802 GGAATGCGGGAGAAAGGGGATGG + Intergenic
939399398 2:141671370-141671392 GGAGTGAAGGAGGCAAAGTAGGG + Intronic
939419323 2:141945713-141945735 GGAATGGGGGAGGCAGGGAATGG - Intronic
939714456 2:145566370-145566392 GGAATGGTAGAGGCAGGGAAAGG + Intergenic
939750814 2:146043871-146043893 GGAATGTGAGAGATAGGGTAGGG + Intergenic
939802427 2:146726640-146726662 GGAATGAGGGAGGAATGAAAAGG + Intergenic
939969579 2:148644661-148644683 GGAAGGAGGGAGGGAGGGAGAGG + Intronic
940303324 2:152198794-152198816 GGAATGCGCAAGGCAGGATAAGG - Intergenic
940651689 2:156446999-156447021 GGAATGGGGGATCCAGAGTACGG - Intronic
941284870 2:163598235-163598257 GAAATGGGGGAGGCAGAGTGAGG - Intronic
941502860 2:166302086-166302108 GAAATGAGGGAGGAAAGGTCAGG - Intronic
941691966 2:168509511-168509533 TGAATGATGGAGGCAGGGTCAGG - Intronic
941728195 2:168887076-168887098 GGAATGAGAGAAGCAGTGAAGGG + Intronic
941919987 2:170840640-170840662 GAAAGGAGGGAGGTAGGGAAGGG + Intronic
941919999 2:170840665-170840687 GGAGGGAGGGAGGGAGGGAAGGG + Intronic
942629434 2:177939499-177939521 GGAAGGAGGGAGGGAGGGAAGGG + Intronic
942636731 2:178015745-178015767 GGAAGGAGGGAGGGAGAGAAGGG + Intronic
942671379 2:178379339-178379361 GGAGGGAGGGAGGGAGGGGAAGG + Intronic
942844941 2:180412934-180412956 GGAATGAGGTGGGCTGGGTGAGG + Intergenic
943016457 2:182516672-182516694 GGAAGGAGGGAAGGAGGGAAGGG + Intronic
943300422 2:186191203-186191225 GGAGGGAGGGAGGGAGGGAACGG + Intergenic
943626599 2:190208290-190208312 CGAAAGAGGGAGAAAGGGTAGGG + Intronic
943729302 2:191284975-191284997 GGAAAGAAGTAGGCAGGGAAGGG - Intronic
944233290 2:197417445-197417467 GTAATGGAGGAGGCTGGGTACGG + Intronic
944352173 2:198742099-198742121 GGAAGGAGGGAGGGAGGGAAAGG - Intergenic
945021958 2:205582699-205582721 AGAGTGAGAGAGGCAGGGAAAGG + Intronic
945053089 2:205843974-205843996 GGAGGGAGGGAGGGAGGGGAAGG + Intergenic
945057462 2:205881190-205881212 GGAGGGAGGGAGGGAGGGAAGGG + Intergenic
945108214 2:206337170-206337192 GGAGTGAGGGAAGCAGGATTGGG + Intergenic
945148168 2:206760452-206760474 GGAATGAGGGTGGCAGGATTGGG - Intronic
945461621 2:210116207-210116229 GGAAAGAGGAAGGAAGGGTAGGG + Intronic
945554204 2:211258959-211258981 GGAAGGAAGGAGGGAGGGAAGGG + Intergenic
945554206 2:211258963-211258985 GGAAGGAGGGAGGGAAGGGAGGG + Intergenic
945588360 2:211696052-211696074 GGAAGGAGGGAGGGAGGGAGGGG - Intronic
945876093 2:215279787-215279809 GGAAGGAGGGAGGGAGGGGAGGG + Intergenic
946524826 2:220507300-220507322 GGAGGGAGGGAGGGAGGGGAGGG - Intergenic
946686972 2:222280304-222280326 GGAAGGAGGGAGGAGGGGGAGGG + Intronic
946774638 2:223124865-223124887 AGAATGAGGGAAGCAGGATTGGG + Intronic
946784160 2:223224974-223224996 GGAATGAGGGAAGAAAGGAAGGG + Intergenic
946839273 2:223804040-223804062 GAAATTAGAGATGCAGGGTAGGG - Intronic
947909254 2:233790653-233790675 GGAGGGAGGGAGGGAGGGGAGGG - Intronic
947975022 2:234358000-234358022 GGAGGGAGGGAGGGAGGGGAGGG - Intergenic
948048125 2:234958902-234958924 GGCAGGAGGGAGCCAGGGTTGGG + Intronic
948194711 2:236086864-236086886 GGAGGGAGGGAGGTAGGGCAGGG - Intronic
948211986 2:236201105-236201127 GGAAGGAGGGAAGGAGGGAAGGG - Intronic
948274008 2:236694657-236694679 GGAATGAGGGAGACAGAGGGCGG - Intergenic
948397956 2:237661459-237661481 GGAAGGAGGGAGTCTGGGGAGGG - Intronic
948434912 2:237946467-237946489 GGAGGGAGGGAGGGAGGGAAGGG + Intergenic
948435583 2:237951446-237951468 GGAAGGAGGGAGGGAGGGAGGGG + Intergenic
948465966 2:238151748-238151770 GGAAGGAGGGAGGCAGGGCGTGG + Exonic
948489891 2:238305793-238305815 TGAAAGAGGGAGGCCGGGTGTGG + Intergenic
948684158 2:239659610-239659632 GGAGGGAGGGAGGGAGGGTGAGG - Intergenic
948695613 2:239731781-239731803 GGAAGGAAGGACCCAGGGTACGG + Intergenic
948830378 2:240595704-240595726 AGACTGAGGGAGGCAGGGAGAGG - Intronic
948834725 2:240620469-240620491 GGCACGGGGGAGGCAGGGAAGGG + Intronic
948855234 2:240727265-240727287 GGGAGGAGGGAGGCAGGACAGGG + Intronic
1168933987 20:1647235-1647257 GAAAGGAGGGAGGCAGGGAAGGG - Intronic
1169208914 20:3754857-3754879 GGAGTGAGGGGGGCAGGGCAGGG + Intronic
1169371489 20:5031553-5031575 GGAAGGAAGGAGGGAGGGAAGGG - Intergenic
1169376820 20:5073029-5073051 GGAATGAAGGAGGCAGGTCAGGG + Intronic
1169422050 20:5468676-5468698 GGACTGAGGGAAGAAGGGAATGG + Intergenic
1169520973 20:6372684-6372706 GGAGTGAGGGAAACAGGGGAGGG - Intergenic
1169807698 20:9576418-9576440 GGAGTGAGGGAGGGATGCTATGG + Intronic
1169867414 20:10217227-10217249 GGAGGGAGGGAAGCGGGGTAGGG - Intergenic
1169961752 20:11167977-11167999 GCAATGAGTGAAGCAGGGTAAGG + Intergenic
1170000930 20:11612603-11612625 GGAAGGAGGAAGGGAGGGAAAGG - Intergenic
1170035088 20:11981554-11981576 GGAAAGAGGGAGGGAAGGAAAGG - Intergenic
1170035095 20:11981580-11981602 GGAAAGAGGGAGGGAAGGAAAGG - Intergenic
1170268755 20:14499786-14499808 GGAAGGAGGGAAACAGGGAAAGG - Intronic
1170278468 20:14619434-14619456 GGAGGGAGGGAGGAAGGGAAGGG + Intronic
1170504163 20:17007524-17007546 GGAATGGGGGATGGAGAGTAGGG - Intergenic
1170578537 20:17681711-17681733 GGAGGGAGGGAGGCAGGGAGCGG + Intronic
1170725813 20:18925357-18925379 GGAAAGCGGGAGGCGGTGTAGGG - Intergenic
1170848859 20:19985579-19985601 GAAATGAGTGAGGCTGGGCATGG + Intronic
1170938276 20:20827988-20828010 GGAAGGAGGAAGGAAGGGGAAGG + Intergenic
1171128364 20:22624665-22624687 GGAAGTAGGGAGGGAGGGCAGGG - Intergenic
1171148007 20:22802690-22802712 GGAAAGAGAGAGGGAGGGAATGG + Intergenic
1171206043 20:23282241-23282263 GGAAGAAGGGAGGAAGGGAAGGG + Intergenic
1171756428 20:29113889-29113911 GGAGGGAGGGAGGGAGGGAAGGG + Intergenic
1171774526 20:29352933-29352955 GGAAGGAGGGAGGGAAGGAAGGG - Intergenic
1171938853 20:31304725-31304747 GGAATGAGGGAGTGGGGGGATGG - Intronic
1172109951 20:32538749-32538771 GGAATGGGGGAGGCAGCGGCAGG + Intronic
1172360556 20:34309933-34309955 GGAAGGAGGGAGGGAAGGGAAGG + Intronic
1172565724 20:35928833-35928855 GGAAGGAGGAAGGCATGGTTGGG + Intronic
1172775762 20:37405874-37405896 GGAAGGAGGGAGGAGGGGAAGGG - Exonic
1172970785 20:38871629-38871651 GGAAGGAGGGAGGCAAAGAAAGG + Intronic
1173160408 20:40648000-40648022 GGAATGGAGCAGGCAGGGAATGG + Intergenic
1173182272 20:40814367-40814389 GGGATGGGGGCGGCAGGGTGGGG + Intergenic
1173198214 20:40933337-40933359 GGAATGAATGAGGCCGGGCATGG - Intergenic
1173297118 20:41769570-41769592 AGCATAAGGGAGGCAGGGGAAGG + Intergenic
1173313110 20:41917860-41917882 GGAAGGAGGGAGGGAGGGAAGGG - Intergenic
1173438880 20:43057403-43057425 GGAAGGAGGGAAGGAGGGGAGGG + Intronic
1173569478 20:44067245-44067267 GGGGTGAGGGAGGCAGGACAGGG + Intronic
1173687034 20:44931058-44931080 GGAGGGAGGGAGGGAGGGAAGGG - Intronic
1173746873 20:45444417-45444439 GGAAGGAGGGAGGAAGGCTGTGG - Intergenic
1174210631 20:48875343-48875365 GAAAGGAGGGCAGCAGGGTAAGG + Intergenic
1174228488 20:49024390-49024412 TGAGTGAGGCAGGCTGGGTAAGG + Intronic
1174304912 20:49608319-49608341 GGGAGGAGGGAGGCAGGATGAGG - Intergenic
1174355568 20:49995695-49995717 GGAGTGAGGGGGGCGGGGAAAGG - Intergenic
1174410327 20:50330891-50330913 GGCATGATGGAGGCATGGTGGGG + Intergenic
1174418164 20:50381137-50381159 GGAGGGAGGGAGGGAGGGGAGGG + Intergenic
1174588420 20:51626196-51626218 GAAATTAGGGAGGCCGGGTGTGG + Intronic
1174656594 20:52177039-52177061 CCACTGAGGGAGGGAGGGTAGGG - Intronic
1174823049 20:53744097-53744119 GGAGAGAGGGAGGGAGGGAAGGG - Intergenic
1174835617 20:53853621-53853643 GGGAGGAGGGAGGGAGGGGAAGG + Intergenic
1175212835 20:57372283-57372305 GGAAATGGGGAGGCAGGGAAGGG - Intronic
1175293692 20:57894718-57894740 GGAAGGAAGGAGGGAGGGAAGGG + Intergenic
1175432452 20:58915622-58915644 GGAGGGAGGGAGGGAGGGGAGGG - Intergenic
1175470849 20:59226421-59226443 GGAATAAGGGAAGCAGGGAGGGG - Intronic
1175565020 20:59967767-59967789 GGAAGGAAGGAGGGAGGGAAGGG - Intronic
1176000588 20:62829732-62829754 GGAAGGAGGGTGTCAGGGCAGGG - Intronic
1176162193 20:63653545-63653567 GGGAGGAGGGAGGGAGGGTTGGG + Intergenic
1176198340 20:63848103-63848125 GGAATGCGGAGGGCAGGGGAGGG + Intergenic
1176214547 20:63941933-63941955 GGAAGGAAAGAGGCAGGGCACGG + Intronic
1176808097 21:13510891-13510913 GGAAGGAGGGAGGAAAGGAAAGG + Intergenic
1177046883 21:16182517-16182539 GGAGGGAGGGAGGGAGGGGAGGG - Intergenic
1177635793 21:23785075-23785097 GGAGGGAGGGAGGGAGGGAAAGG + Intergenic
1177635824 21:23785227-23785249 GGAGGGAGGGAGGGAGGGAAAGG + Intergenic
1177637514 21:23806670-23806692 GGAGGGAGGGAGGGTGGGTAAGG + Intergenic
1178063464 21:28877059-28877081 GGAAGGAGGGAGGGAAGGGAAGG + Intronic
1178319871 21:31597220-31597242 GGAAGGAGGGAGGGAGGGGAAGG - Intergenic
1178357876 21:31923582-31923604 GGAGGGAGGGAGGGAGGGAAGGG + Intronic
1178407946 21:32339910-32339932 GGAAGGAGGGAGGCCGGGCAAGG - Intronic
1178420990 21:32443021-32443043 GGAAGGAAGGAGGAAGGGTGGGG + Intronic
1178481091 21:32979603-32979625 GGATGGAGGGAGGGAGGGAAGGG + Intergenic
1178570030 21:33727651-33727673 GGAATGAGGGATGGAGGAGAGGG - Intronic
1178728886 21:35080777-35080799 GAAAGTAGGGAGGCAGGGGAAGG + Intronic
1178741586 21:35206765-35206787 GGAAGGAGGAAGGGAGGGGAAGG - Intronic
1178868167 21:36347872-36347894 GGAATGAGAGAGACAGGATAAGG + Intronic
1179151895 21:38816067-38816089 GGAGGGAGGGAGGGAGGGGAGGG + Intronic
1179166402 21:38938568-38938590 TGAATGCGGGAGCCCGGGTAAGG - Intergenic
1179413375 21:41179121-41179143 GGAGTGAGGGTGTCAGGGTGAGG + Intronic
1179413386 21:41179164-41179186 GGAGTGAGGGTGTCAGGGTGAGG + Intronic
1179447855 21:41445710-41445732 GGGCTGAGGGAGGCAGGGCAGGG + Intronic
1179462351 21:41545790-41545812 GGAGGGAGGGAGGGAGGGAAAGG + Intergenic
1179560263 21:42211444-42211466 GGAAGGAAGGAGGAAGGGAAAGG - Intronic
1179565547 21:42245615-42245637 GGTGTGAGGGAGGCAGGGAATGG + Intronic
1179892795 21:44345382-44345404 GGGATGAGGGGGGCAGGGAGAGG + Intergenic
1179952149 21:44714359-44714381 GGAGGGAGGGAGGCAGGGGAGGG + Intergenic
1180161560 21:46000631-46000653 GGAAGGGGGGAGGCCGGGGAAGG + Intronic
1180320009 22:11311174-11311196 GGAAAGAGGGAGGGAAGGAAGGG - Intergenic
1180538968 22:16423651-16423673 GGGATGAGGGTGGCGGTGTAGGG - Intergenic
1180900905 22:19371626-19371648 GGTCTGAGGGAGGGAGGATAAGG - Intronic
1181094544 22:20496327-20496349 TGAGTGAGGGAGGAAGGGAATGG - Intronic
1181388678 22:22563355-22563377 GCAATGAGGGAAGCAAGGGACGG + Intronic
1181442603 22:22944546-22944568 GGCATCAGGGTGGCAGGGTCTGG - Intergenic
1181484591 22:23222722-23222744 GGCATGAGGGAGGAAGGCTTGGG - Intronic
1181774189 22:25147973-25147995 GGAGGGAGGGAGGGAGGGGAAGG - Intronic
1181830680 22:25558133-25558155 GGATTGAAGGAGGGAGGGTTTGG + Intergenic
1181963278 22:26638383-26638405 GGAATGAGGGAGGAAAGGAAGGG + Intergenic
1182012665 22:27013762-27013784 GGAATGAGGGAGACAGTGGCTGG + Intergenic
1182023753 22:27101476-27101498 GGATGGAGAGAGGCAGGGGAAGG - Intergenic
1182043863 22:27259383-27259405 GGCAGGAGGAAGGCAGGGTGGGG - Intergenic
1182103274 22:27672015-27672037 GGAAGGAGGGAGGGAAGGAAGGG + Intergenic
1182164735 22:28161817-28161839 GGAAGGAGGGAGGGAGGGGAAGG + Intronic
1182410485 22:30181015-30181037 GAAGAGAGGGAGGGAGGGTAGGG - Intergenic
1182680725 22:32077406-32077428 GGAAGGATGGAGGGAGGGAAAGG - Intronic
1182741648 22:32572272-32572294 GGAAGGAGGGAGGGAGGGAGGGG - Intronic
1182747643 22:32617774-32617796 TGTGTGAGGGAGGCAGGGTTAGG + Intronic
1182862938 22:33576461-33576483 GGAGTGAGGGAGGTGGGGCATGG + Intronic
1182876210 22:33693428-33693450 GGAGTGAGGGAGGGAAGGAAGGG + Intronic
1182957271 22:34438349-34438371 GAGATGAGGGAGGCTGGGCATGG + Intergenic
1182997909 22:34831295-34831317 GGAGGGAGGGAGGGAGGGAAAGG + Intergenic
1183007644 22:34916626-34916648 GGAAGGAGGGAGGCAGAGAGGGG + Intergenic
1183042591 22:35193510-35193532 GGAGGGAGGGAGGGAGGGGAGGG + Intergenic
1183042651 22:35193699-35193721 GGAAGGAGGGCGGGAGGGAAGGG + Intergenic
1183085403 22:35483767-35483789 GGAGGGAGGGAGGGAGGGGAGGG + Intergenic
1183309125 22:37099860-37099882 GGAAGGGGAGAGGCTGGGTAGGG + Intronic
1183361143 22:37384140-37384162 GGAAGGAGAGAGGCAGGGGGTGG + Intronic
1183594604 22:38803118-38803140 GGAGGGAGGGAGGGAGGGAAAGG - Intergenic
1183625260 22:38997797-38997819 GGAGGGAGGGAGGGAGGGAAGGG - Intergenic
1184248197 22:43246192-43246214 GAAGTGAAGGAGGCAGGGCAGGG - Intronic
1184313575 22:43664900-43664922 GGAAGCAGGGAGGCAGTGAAGGG + Intronic
1184345427 22:43909954-43909976 GGAGGGAGGGAGGAAGGGAAAGG + Intergenic
1184463802 22:44657420-44657442 GGAGGGAGGGAGGGAGGGGAAGG + Intergenic
1184509352 22:44924055-44924077 GGAGGGAGGGAGGGAGGGGAGGG + Intronic
1184634422 22:45815574-45815596 GGAGGGAGGGAGGGAGGGAAAGG - Intronic
1184642369 22:45879424-45879446 GGAAGGAGGGAGGGAGTGTGTGG - Intergenic
1184943480 22:47784898-47784920 TGAATGTGGGAAGCAGGGGAGGG + Intergenic
1185035521 22:48474700-48474722 GGAGTGAGGGAACCAGGGTGGGG + Intergenic
1185129203 22:49028106-49028128 GGAAGGAGGGAGGAAGGGGAGGG + Intergenic
1185162345 22:49237654-49237676 GGAGAGAGGGAGGGAGGGGAGGG - Intergenic
1185380752 22:50506595-50506617 GGGCTGTGGGAGGCTGGGTAGGG - Intronic
949146754 3:710109-710131 GGAGGGAGGGAGGAAGGGAAAGG - Intergenic
949493547 3:4611016-4611038 GGAGGGAGGGAGGAAGGGGAAGG - Intronic
949576739 3:5345678-5345700 GAAATGGGTGAGGCAGGGTAAGG + Intergenic
950409024 3:12822587-12822609 AGAATGATGGAGGCTGGGCACGG - Intronic
950464962 3:13148280-13148302 GGGAGGAGGGAGGCCTGGTACGG + Intergenic
950753885 3:15155969-15155991 GGAAGGAGGGAGGGTGGGGAAGG + Intergenic
950955075 3:17044232-17044254 AGAGTGAGGGAGGAAGGGAAGGG + Intronic
951523410 3:23630474-23630496 AGAAGGAGGGAGGAAGGGAAGGG + Intergenic
951579058 3:24142980-24143002 GGAATGAGGGAGTAGGGATAGGG - Intronic
951803475 3:26622754-26622776 GGAATGAGGGAGGAGGGGCGAGG - Intergenic
951874574 3:27407754-27407776 GGAATGAAGGAGGGATGGGATGG - Intronic
951955053 3:28244276-28244298 GGAAGAAGGGAGACAGGTTAAGG + Intronic
951979860 3:28553625-28553647 GGAATTAGGGAGGTAGATTATGG - Intergenic
952195851 3:31074832-31074854 GGAGTAAGGGAAGCAGGGTAAGG + Intergenic
952504911 3:33998869-33998891 GGAGTGAGGGAAGCAGGGTGGGG + Intergenic
952543345 3:34391740-34391762 GGAATGTGGGAGGCAGGCTAGGG + Intergenic
952675883 3:36029748-36029770 GGAATGAGCAAGGCAGGAGAGGG - Intergenic
952735906 3:36691362-36691384 GGAGCGAGGGAGGCAGGAGAAGG + Intergenic
952952099 3:38533453-38533475 TGAATGAGGGAGGCAGAGCAGGG + Intronic
953010002 3:39016071-39016093 GGAATGAGAGAAGCAGGGTAGGG + Intergenic
953069648 3:39506431-39506453 GGAATGTGGGAAGCAAGATAAGG + Intronic
953205339 3:40822776-40822798 GGAATAAGGGAAGCAGGGCAGGG - Intergenic
953225307 3:41013508-41013530 GAAATGAGGCAGGGAGGGGAAGG + Intergenic
953492587 3:43363854-43363876 GGCTTGAGGGAGGCAGGTTAGGG + Intronic
953620824 3:44531215-44531237 GGAAGGAGGGAGACAGAGAAGGG + Intergenic
953734080 3:45476372-45476394 GGAATGAGGAGGGAAGGGGAAGG + Intronic
954336833 3:49923341-49923363 GGAGGGAGGGAGGGAGGGAAGGG + Intronic
954445202 3:50542585-50542607 GGATGGAGTGAGGCAGAGTAGGG + Intergenic
954479866 3:50788785-50788807 GCAGGGAGGGAGGCAGGGGAGGG + Intronic
954699931 3:52445796-52445818 GGCCTGAGGGAGGCAGGGCAAGG - Intergenic
954781523 3:53065630-53065652 GGAGGGAGGGAGGGAGGGAAAGG - Intronic
955494864 3:59520682-59520704 GGAATGGGAGAGGAAGGGTGGGG - Intergenic
955496440 3:59538273-59538295 GGAGGGAGGGAGGGAGGGGAAGG - Intergenic
955725334 3:61926578-61926600 GGAGGGAGGGAGGGAGGGAAGGG - Intronic
955927065 3:64017463-64017485 TGACTGAGGGAAGCAGGGAAGGG + Intronic
956080196 3:65549280-65549302 GGAAAGAGGGAGGAAAGGGAAGG - Intronic
956190367 3:66602195-66602217 GGAGGGAGGGAGGGAGGGAAGGG - Intergenic
956190387 3:66602245-66602267 GGAATGAGGGAGGAAATGGATGG - Intergenic
956219314 3:66884758-66884780 GGAGGGAGGGAGGGAGGGAAAGG + Intergenic
956485493 3:69718058-69718080 GGAAGGAGGGAGTCAGGCTATGG - Intergenic
956643436 3:71435363-71435385 GGAGGGAGGGAGGGAGGGAAGGG + Intronic
956665994 3:71642629-71642651 GGAGGGAGGGAGGGAGGGAAGGG - Intergenic
956689635 3:71863912-71863934 AGAATGAGAAAGGCAGGGTAAGG + Intergenic
956837650 3:73108656-73108678 GGACTGGGGGAGGGAGGGAATGG - Intergenic
956968234 3:74489404-74489426 GGAGGGAGGGAGGAAGGGAAGGG - Intronic
957040080 3:75329730-75329752 GGAATGAGGGAGGGAGAGCAGGG - Intergenic
957356518 3:79094908-79094930 GGAGAGAGGGAGGGAGGGGAAGG - Intronic
957421943 3:79982288-79982310 GGAGGGAGGGAGGGAGGGAAGGG - Intergenic
957466673 3:80602487-80602509 GGAGGGAGGGAGGGAGGGAAGGG + Intergenic
958117173 3:89235020-89235042 GGAGGGAGGGAGGGAGGGAAGGG - Intronic
958144911 3:89612234-89612256 GGAGAGAGGGAGGGAGGGGATGG - Intergenic
958191025 3:90185212-90185234 GGAATGAGGGAAGGAGGGGAGGG - Intergenic
958413223 3:93844340-93844362 GGAATGAGGGAAGGAGGGGAGGG - Intergenic
958440075 3:94145739-94145761 GGACTAAGAGAGGCAGGGCACGG - Intergenic
958807046 3:98823902-98823924 GGAATGGGGGTGGCAGGATGGGG + Intronic
959162116 3:102736171-102736193 GAAATGTGGGAGGCAGTGGATGG + Intergenic
959241647 3:103803736-103803758 GAAAGGAGGGAGGGAGGGGAGGG + Intergenic
959758657 3:109930083-109930105 GGAAGGAGGGAAGGAGGGAAGGG - Intergenic
960534664 3:118802872-118802894 GAAATGTGGGAGGCAGTGGACGG - Intergenic
960982186 3:123239906-123239928 GGAATGGGTGAGGCAGGGTAAGG + Intronic
961035969 3:123641799-123641821 GAAAGGAGGGAGGCAAGGGAGGG - Intronic
961044866 3:123701272-123701294 GGAATGAGGGAGGGAGAGCAGGG - Intronic
961175840 3:124834514-124834536 GGAAGGAGGGAGGCGAGGAAGGG + Intronic
961340218 3:126212615-126212637 GGAAGGAGGGAGGCGGGGAGGGG + Intergenic
961813957 3:129538492-129538514 GGAGGGAGGGAGGGAGGGAAAGG - Intergenic
962207874 3:133450013-133450035 GGAAGGAGGGAGGGAGGGGGAGG + Intronic
962307218 3:134299537-134299559 GGAATGAGGGAAGCAGGAACAGG + Intergenic
962316877 3:134364527-134364549 GGAAGGAGGGAGAAAGGGGAGGG - Intronic
962325351 3:134427836-134427858 GGAGGGAGGGAGGGAGGGGAGGG - Intergenic
962380241 3:134892794-134892816 GGATAGAGGGAGGGAGGGGAGGG - Intronic
962619958 3:137168239-137168261 GGAAGGAGGGAGGGAAGGGAGGG - Intergenic
962619960 3:137168243-137168265 GGAAGGAAGGAGGGAGGGAAGGG - Intergenic
962628201 3:137248531-137248553 GGAATAAGGGTGAAAGGGTAAGG + Intergenic
962894329 3:139700323-139700345 GGAAGGTGGGATGCAGGTTAAGG + Intergenic
963550245 3:146711755-146711777 GGAATGAGAGAGGAAAGGAAGGG - Intergenic
963665332 3:148177824-148177846 GGAAGGAGGGAAGGAGGGAAGGG + Intergenic
963839562 3:150091606-150091628 GGAATGCGTGAGGCAGGCTGAGG - Intergenic
963919515 3:150892320-150892342 GGAGTGAGGGAAGCAGGACAGGG - Intronic
964184424 3:153925237-153925259 GGAAAGAGGGAGGAGGGGGAGGG + Intergenic
964269434 3:154939687-154939709 GAAGTGAGGGAGGCAGGGATTGG - Intergenic
964394501 3:156231489-156231511 GGAGGGAGGGAGGGAGGGGAGGG - Intronic
964477487 3:157109923-157109945 AGAATCAGGGAGGAAGGGTGGGG + Intergenic
964903835 3:161693936-161693958 GGAGGGAGGGAGGGAGGGAAAGG - Intergenic
964937314 3:162106230-162106252 GGAGTAAAGGAGGCATGGTAAGG + Intergenic
965045898 3:163576552-163576574 GGAAGGAGGGAGGGAGGGAGGGG - Intergenic
965342395 3:167506164-167506186 GGGCTGAGGGATGCAGGGAAGGG - Intronic
965373929 3:167897700-167897722 GGAAGGAGAGAGGGAGGGGAGGG + Intergenic
965447584 3:168794601-168794623 GAAATGAGGGAGGGAGGGGGAGG - Intergenic
966519726 3:180860003-180860025 GGAGAGAGGGAGGGAGGGAAGGG + Intronic
966782666 3:183597158-183597180 GGAGGGAGGGAGGGAGGGAAAGG + Intergenic
966811988 3:183855141-183855163 GGAAGGAGGGAAGGAGGGAATGG + Intronic
967003993 3:185365926-185365948 GGAGGGAGGGAGGGAGGGAAGGG - Intronic
967033699 3:185631577-185631599 GGAAGGGGGGAGGGAGGGTGGGG - Exonic
967169577 3:186812665-186812687 GGGATGAGGGAGGCAGGACTGGG - Intergenic
967277380 3:187789915-187789937 GGAAGGAGGGAGGGAGGGGGAGG + Intergenic
967303458 3:188038904-188038926 GGAGTGAGGGAAGCAGGATTGGG + Intergenic
967323004 3:188212651-188212673 GGAATGAAGGGGGAAGGGTGGGG - Intronic
967337533 3:188361429-188361451 GGAAGGAGGGAGGGAGGGGAGGG - Intronic
967350690 3:188511089-188511111 GGAAGGAGGGAGGGAGGGAGGGG - Intronic
967356472 3:188577788-188577810 GGAAGGAGGGAGGGAGGGAAGGG - Intronic
967360463 3:188624668-188624690 GGAAGGAGGGAGGGAGGGGAAGG - Intronic
967627076 3:191699502-191699524 GGAAAGAGGGAGGAAAGGGAGGG + Intergenic
967789479 3:193531422-193531444 GGAAGGAGGGAAGGAGGGAAGGG + Intronic
968418676 4:463757-463779 GGAATGAGGGGGCTAGGGGAGGG + Intronic
968529974 4:1086585-1086607 GGCATGAGGGTGGCAGGAGAGGG + Intronic
968565357 4:1309719-1309741 GGCATGAAGGAGGCCGGGGAGGG - Intronic
968601516 4:1512105-1512127 GGAATGAGGGAGGAAGGGCAGGG + Intergenic
968698431 4:2043558-2043580 GGCATGAGGGTGGCAGGGAGTGG + Intronic
968725899 4:2247679-2247701 TGACAGAGGGAGGCAGGGCACGG + Exonic
968738004 4:2308507-2308529 GGAGGGAGGGAGGGAGGGGAGGG + Intronic
968937110 4:3617254-3617276 GGAAGAAGGGAGGGAGGGGAGGG - Intergenic
968937141 4:3617353-3617375 GGAAGAAGGGAGGGAGGGGAGGG - Intergenic
968940092 4:3633288-3633310 GGAAGGAGGGAGGGAGGGGAAGG - Intergenic
968942942 4:3648535-3648557 GGAAGGAGGGAGCCCGGGCATGG - Intergenic
969033037 4:4228383-4228405 AGAATGATGGTGGCAAGGTAAGG - Intergenic
969132837 4:5004295-5004317 GGAAGGATGGAGGGAGGGGAGGG + Intergenic
969353832 4:6613701-6613723 GAAGTGAGGGAGGGAGGGGAAGG + Intronic
969374226 4:6752715-6752737 GGAATGGGGGAAGGAGGGTGTGG + Intergenic
969480867 4:7446164-7446186 GGAAGGAGGTAGGGAGGGGAGGG + Intronic
969923031 4:10558831-10558853 GCAATGAGGCAGGCAGGTCAGGG + Intronic
970043887 4:11828093-11828115 GGAGGGAGGGAGGAAGGGGAAGG - Intergenic
970077949 4:12246223-12246245 GGAGGGAGGGAGGGAGGGAAGGG - Intergenic
970113074 4:12660531-12660553 GGAAGGAGAGAGGGAGGGAATGG + Intergenic
970159346 4:13173318-13173340 GGAAGGAGGGAGGGAGGAAACGG + Intergenic
970377010 4:15468923-15468945 GGAATAGGTGAAGCAGGGTAGGG + Intergenic
970444486 4:16112629-16112651 GGAGGGAGGGAGGGAGGGGAGGG + Intergenic
970468920 4:16356512-16356534 GGAATGAAGGAAGCAGAATAGGG + Intergenic
970550270 4:17173555-17173577 GGGAGGAGACAGGCAGGGTAGGG + Intergenic
970618169 4:17787482-17787504 GGAATGAGTCAGGCATAGTAGGG - Intergenic
970669861 4:18383896-18383918 GAGAGGAGGGAGGGAGGGTAGGG + Intergenic
970683307 4:18536243-18536265 GGAGGGAGGGAGGGAGGGAAGGG - Intergenic
970683525 4:18538433-18538455 GGGATGAGAGAGGGAGGGTATGG - Intergenic
972940941 4:44194746-44194768 GGAGGGAGGGAGGGAGGGAAGGG - Intronic
972940958 4:44194778-44194800 GGAGGGAGGGAGGGAGGGAAGGG - Intronic
972943828 4:44229180-44229202 GGCATGAGTGAGGCAGGAGAGGG + Intronic
973767215 4:54173590-54173612 GGAAGGAGGGAGGGAGGGAAGGG + Intronic
973818622 4:54642054-54642076 GGAATGATGGAGGATGGGTGGGG + Intergenic
973834482 4:54795681-54795703 GCAATGAGAGAGGGAGGGAATGG + Intergenic
973911863 4:55589847-55589869 GGTATGTGGGAGGCAAGTTATGG + Intronic
973916246 4:55637017-55637039 GGAAAGAGGGAGTCAGGTCACGG - Intergenic
974392537 4:61290698-61290720 GGAAGGAGGGAAGGAGGGAAGGG + Intronic
974877732 4:67718201-67718223 GGAAGTGGGGAGGCAGGGTGAGG + Intergenic
975087462 4:70359632-70359654 GGAGAGAGGGAGGGAGGGAAAGG + Intergenic
975177211 4:71301576-71301598 GCTATGAGGGAGGCAGAATAAGG - Intronic
975580642 4:75904296-75904318 GGAATGGGTGAGGCAGGGTAAGG - Intergenic
975884069 4:78943473-78943495 GGAAGGAGGGAAGGAGGGGAGGG - Intergenic
975937205 4:79596451-79596473 GGAAGGAGAGAGAGAGGGTAAGG - Intergenic
976036129 4:80823270-80823292 GCAAAGAGGGAGGCAGGTGAAGG - Intronic
976168200 4:82276778-82276800 GGATGGAGGGAGGCAGGCTGGGG + Intergenic
976307815 4:83578880-83578902 AGAAAGAGGGAGGGAGGGAAGGG - Intronic
976637527 4:87301552-87301574 GGTGTGTGGGAGGTAGGGTACGG + Intergenic
977202798 4:94136737-94136759 GGAAGGAGGGAGGAAGGGAAGGG + Intergenic
977319120 4:95489082-95489104 GGAGAGAGGGAGGCAGGAAAGGG + Intronic
977416875 4:96744196-96744218 GGAAGGAGGGAGGGAGGCAAAGG - Intergenic
977763581 4:100771122-100771144 GGAGGGAGGGAGGGAGGATAGGG + Intronic
977790931 4:101102231-101102253 GGAGGGAGGGAGGCAGAGAAAGG + Intronic
978728635 4:111999350-111999372 GGAAGGAGGGAGGGAGGGGAGGG + Intergenic
978876153 4:113642468-113642490 GGAATGTGGGAGACAGGGAATGG - Intronic
979538451 4:121851418-121851440 GGAAGGAGGGAAGGAGGGAAGGG + Intronic
979603287 4:122609300-122609322 AGAATGAGGAGGGCAGGGGATGG + Intergenic
980128876 4:128800097-128800119 GGAGTTAGGGAGGTAGGATAAGG + Intergenic
980223580 4:129951151-129951173 GGAGGGAGGGAGGAAGGGAAGGG + Intergenic
980244749 4:130224383-130224405 GGAAGGAGGGAGGGAGGGGCAGG + Intergenic
980845880 4:138324608-138324630 GGGATGTGGGAGGCAGTGAAGGG - Intergenic
980962760 4:139492722-139492744 AGAAAGAGGGAGGGAGGGAAGGG - Intergenic
981413377 4:144458881-144458903 GGAAGGAGGGAGGAAGGGGGAGG + Intergenic
981489930 4:145328405-145328427 GGAGAGAGGGAGGGAGGGAAGGG + Intergenic
981631202 4:146820740-146820762 AGAATGAGGTAGGCTGGGCACGG + Intronic
981685373 4:147448676-147448698 GAAATGTAGGAGACAGGGTAAGG + Intergenic
981949903 4:150393473-150393495 GGAGGGAGGGAGGGAGGGAAAGG - Intronic
983110355 4:163742329-163742351 GGAGAGAGGGAGGGAGGGAAAGG - Intronic
983263723 4:165485928-165485950 GAAGTGAGGGAAGCAGGGCAAGG + Intronic
983387404 4:167082763-167082785 GGAGGGAGGGAGGGAGGGAAGGG + Intronic
983727960 4:170953720-170953742 GAAGGGAGGGAGGGAGGGTAAGG - Intergenic
984008505 4:174342424-174342446 GGAGGGAGGGAGGGAGGGGAGGG + Intergenic
984607648 4:181804014-181804036 AGAAATAGGGAGGGAGGGTAAGG + Intergenic
985096104 4:186414734-186414756 GGGAGGTGGGAGGCAGGGAAGGG + Intergenic
985382366 4:189408123-189408145 GGAATGAGGAAGCCATGCTATGG + Intergenic
986662890 5:10074866-10074888 GAGGTGAGGGAGGCAGGGGAAGG + Intergenic
986724589 5:10584828-10584850 GGGATAAGGTAGGCAGGGAAAGG + Intronic
986789302 5:11144529-11144551 GGGCTGAGTGAGTCAGGGTAAGG + Intronic
986826808 5:11531276-11531298 GGAAAGAGGGAGTCAGGGATGGG + Intronic
987363918 5:17131255-17131277 GGAGGCAGGAAGGCAGGGTAAGG + Intronic
987589423 5:19904339-19904361 GGAGGGAGGGAGGGAGGGGAAGG + Intronic
987766949 5:22244610-22244632 GGAAGGAGGGAGGGAAGGAAGGG + Intronic
988444034 5:31265005-31265027 GGAAAGAGGGATGCAGAGAATGG - Intronic
988475232 5:31578704-31578726 GGAGGGAGGGAGGGAGGGGAAGG + Intergenic
988550968 5:32200588-32200610 GGAGGGAGGGAGGGAGGGGAGGG + Intergenic
989056592 5:37371368-37371390 GGAAGGAGGGAGGAGGGATACGG + Intergenic
989277983 5:39610907-39610929 GGAAGGAAGGAGGGAGGGGAAGG - Intergenic
989513832 5:42319129-42319151 GGAAGGAGGGAGGAAGGGAGGGG + Intergenic
990136884 5:52655997-52656019 GGAGGGAGGGAGGGAGGGAAAGG + Intergenic
990346174 5:54873881-54873903 GAAGTGAGGGAAGCAGGATAGGG - Intergenic
990543428 5:56797621-56797643 GGAAGGAGGGAGGGAGGAAAGGG + Intergenic
990741868 5:58920491-58920513 GGAATGAGGGAGGGAGGGTGGGG - Intergenic
990886035 5:60594725-60594747 GGATGGAGGGAGCCAGGGAAAGG + Intergenic
991316963 5:65319699-65319721 GGAGGGAGGGAGGGAGGGAAGGG + Intronic
991460727 5:66855575-66855597 GGAATGAGGGAGGAGAGATAAGG + Intronic
991974775 5:72175034-72175056 GGAAGGAGGGAGGGAGGGAAGGG - Intronic
992183986 5:74225891-74225913 GGAAAGAGGGAGGGAGGGAAGGG - Intergenic
992339520 5:75808220-75808242 GGAATGAGGGAAGCAGGATTGGG + Intergenic
992362044 5:76048891-76048913 GGAGAGAGGGAGGGAGGGAAGGG + Intergenic
992362054 5:76049029-76049051 GAAAAGAGGGAGGGAGGGGAGGG + Intergenic
992441519 5:76801462-76801484 GGAATGCAGGAGACAGGGTTGGG + Intergenic
992487453 5:77210447-77210469 GGAGCGAGGGAGGGAGGGGACGG + Intronic
992740828 5:79771766-79771788 GAAATGATGGAGTGAGGGTATGG + Intronic
992792764 5:80228229-80228251 GGAGGGAGGGAGGGAGGGAAAGG + Intronic
992792781 5:80228271-80228293 GGAGGGAGGGAGGGAGGGAAAGG + Intronic
993187472 5:84637782-84637804 GAAAAGAGGGAGGGAGGGAAGGG - Intergenic
993273046 5:85819320-85819342 GGCATGAGCGAGGCAGGAGAGGG - Intergenic
993845063 5:92931104-92931126 GTGACGAGGGAGGCAGGGTGAGG + Intergenic
993979901 5:94532489-94532511 GGAAAGAGGGAGGGAGGAAATGG - Intronic
994087302 5:95773374-95773396 GGAATGGTGGAGGCAGGATCTGG + Intronic
994192447 5:96883266-96883288 GGAGTGAGGGAAGCAGGACAGGG - Intronic
994197530 5:96936294-96936316 GGGCTGAGGGAGGCAGGGAGAGG + Intronic
994491144 5:100445219-100445241 GGAATCTGGGAGGCAGGATGTGG + Intergenic
994535610 5:101025997-101026019 GGCATGAGGGAGGCGGGAGAGGG + Intergenic
994628550 5:102252085-102252107 GGAAGAAGGGAGGAAGGGAAGGG + Intronic
994673671 5:102794237-102794259 TGAAGGAGGGAGGCTGGGAATGG + Intronic
994761977 5:103865614-103865636 GGAAAGTGGGAGGCATAGTAAGG + Intergenic
995047809 5:107670672-107670694 GGAGGGAGGGAGGCAGGCAAAGG + Exonic
995142837 5:108752206-108752228 GGAAGGAGGAAGGGAGGGAAGGG - Intronic
996403638 5:123087375-123087397 GGTAGGGGGGAGGCAGGGTTGGG + Intergenic
996563071 5:124851473-124851495 GGAGGGAGGGAGGGAGGGGAAGG - Intergenic
996861690 5:128074177-128074199 GAAATGAGGAAGGCAGGATTGGG + Intergenic
997309241 5:132866329-132866351 CGAATGCGGGAGGCGGGGGAGGG - Intronic
997739892 5:136244146-136244168 GGAAGGAGGGAGGGAAGGGAGGG - Intronic
997854176 5:137358437-137358459 GGAGGGAGGGAGGGAGGGAAGGG + Intronic
997883379 5:137610615-137610637 GGGATGAGGGAAGCAGGAGAGGG - Intergenic
997997415 5:138597719-138597741 AGAATGAAGGAAGCAGGGAAGGG - Intergenic
998059084 5:139105016-139105038 GCAATGAGGGGAGCAGGGCAGGG + Intronic
998296242 5:140971656-140971678 GGAATTAGAGAGGAAGAGTAAGG + Intronic
998352653 5:141511513-141511535 GGGAGGAGGGAGGCATGGGATGG - Exonic
998355538 5:141532453-141532475 GGAATTAAGGAGGCTGGGCATGG - Intronic
998589433 5:143461850-143461872 GGAGGGAGGGAGGGAGGGAAAGG - Intergenic
998826192 5:146103736-146103758 GGCATGTGGGAGACATGGTAGGG - Intronic
998834505 5:146190636-146190658 GGAAGGAGGGAGGGAGGGAAAGG + Intergenic
999147626 5:149406565-149406587 GGAGAGAGGGAGGCAGGGAGAGG - Intergenic
999524135 5:152383975-152383997 GGAGGGAGGGAGGGAGGGGAAGG - Intergenic
1000132070 5:158309926-158309948 GGAGGGAGGGAGGTAGGGAAGGG - Intergenic
1000132134 5:158310087-158310109 GGAGGGAGGGAGGGAGGGAAGGG - Intergenic
1000132158 5:158310144-158310166 GGAGGGAGGGAGGTAGGGAAGGG - Intergenic
1000513612 5:162213048-162213070 GGAGGGAGGGAGGGAGGGAAAGG + Intergenic
1001089461 5:168726523-168726545 GGAGGGAGGGAGGGAGGGGAGGG + Intronic
1001320429 5:170676120-170676142 GGAGCGAGGGAGGCGGGGGAGGG + Intronic
1001546075 5:172571118-172571140 GGAAGGAAGGAGGGAGGGAAAGG + Intergenic
1001546629 5:172574476-172574498 GGAGGGAGGGAGGGAGGGGAAGG - Intergenic
1001578879 5:172784745-172784767 GGAACGAGAGAGACAGGGTGTGG - Intergenic
1001647015 5:173289718-173289740 GGAAGGAGGAAGGGAGGGAAGGG - Intergenic
1001752206 5:174140262-174140284 GGACTGAGCGAGGCAGTGGATGG + Intronic
1001786556 5:174418810-174418832 GGAGAGAGGGAGGGAGGGCAGGG + Intergenic
1001866968 5:175114148-175114170 GGAAGGAGGGAGGGAGGGGCAGG + Intergenic
1001896312 5:175384951-175384973 GGAAGGAAGGAGGAAGGGAAGGG + Intergenic
1001977909 5:176015458-176015480 GAAAAGAGGGAGGAAGGATAGGG - Intronic
1002073804 5:176696412-176696434 GGACTGGGGAAGGCAGGGTCGGG + Intergenic
1002076079 5:176709317-176709339 GGAGAGAGGGAGGGAGGGAAGGG - Intergenic
1002184758 5:177448982-177449004 GGAATGAGTGAGGCGGGCCAGGG + Intronic
1002239511 5:177828304-177828326 GAAAAGAGGGAGGAAGGATAGGG + Intergenic
1002334472 5:178468503-178468525 CAGATGAGGGAGGCAGGGTGAGG - Intronic
1002400494 5:178989180-178989202 GGAAGGCGGGAGGCCGGGTTCGG - Intronic
1002579589 5:180199685-180199707 GGAGGGAGGGAGGGAGGGGAGGG - Intronic
1002579591 5:180199689-180199711 GGAAGGAGGGAGGGAGGGAGGGG - Intronic
1002726076 5:181297489-181297511 GGAGAGAGGGAGGGAGGGGAAGG - Intergenic
1002884346 6:1280730-1280752 GGAATGAGGGAGGAGGGAGAGGG + Intergenic
1003430581 6:6033662-6033684 GGAATGCTGCAGGCAGGGAAAGG - Intergenic
1003491742 6:6628275-6628297 GGAGGGAGGGAGGAAGGGGAGGG - Intronic
1003538884 6:7000640-7000662 GGAGGGAGGGAGGGAGGGAAAGG + Intergenic
1003550999 6:7101848-7101870 GGAACGAGGGATGGGGGGTAAGG - Intergenic
1004139289 6:13000644-13000666 GGAGGGAGGGAGGAAGGGGAAGG + Intronic
1004250776 6:14021712-14021734 GGAAGAAGGGAGGGAGGGGAGGG - Intergenic
1004250791 6:14021743-14021765 GGAAGGAGGGAGGGAGGGAGGGG - Intergenic
1004447053 6:15710135-15710157 GGAGGGAGGGAGGGAGGGGAAGG - Intergenic
1004447061 6:15710152-15710174 GGAGTGAGTGAGGGAGGGGAGGG - Intergenic
1004516527 6:16326588-16326610 TGAAGTAGGGAGGCAGCGTAGGG + Exonic
1004582721 6:16970009-16970031 GGAAGGAAGGAGGGAGGGGAAGG + Intergenic
1004675788 6:17841036-17841058 TGGATGCGGGAGGCAGGTTATGG - Intronic
1005013485 6:21357345-21357367 GGATCCAGGGAGGCAGGCTAAGG - Intergenic
1005060700 6:21774508-21774530 GGAATGAGGGAGAAAGGGAAGGG - Intergenic
1005661203 6:28001172-28001194 GGAACGTGGGAGGCACGGGACGG + Intergenic
1005668100 6:28078365-28078387 GCAGTGAGGGGGTCAGGGTATGG - Intergenic
1005927999 6:30460711-30460733 TGAAGGAGGGAGGGAGGGAAAGG - Intergenic
1006101318 6:31687954-31687976 GGAAGGAGGGAGGAAGGTTCAGG - Intronic
1006122248 6:31814685-31814707 AGAATGGGGGAGGCGGGGGAAGG - Intronic
1006625661 6:35396063-35396085 GGAGACAGGGAGGCAGGGAATGG - Intronic
1006785954 6:36667425-36667447 GGAAGGAGTGAGCCAGGGTTTGG - Intergenic
1006836153 6:36999937-36999959 GGAAGGTGGGAGGGAGGGTGAGG - Intergenic
1007070648 6:39035801-39035823 GGAGTGAAGGAGGCAGGACAGGG + Intergenic
1007232085 6:40355561-40355583 GGAAGGAGGGAGCCTGGGTAGGG - Intergenic
1007515977 6:42411692-42411714 GGGATGAGGCAGGCAGGGTCTGG + Intronic
1007578223 6:42939501-42939523 GGAGAGAGGGAGGGAGGGAACGG - Intergenic
1007589761 6:43014011-43014033 GGAATGACGGAGGCGGGGCAAGG - Intergenic
1007597485 6:43060341-43060363 GCAATGAGGGAGGCTGGCTTGGG + Intronic
1007718419 6:43870554-43870576 GGAGGGAGGGAGGGAGGGAAGGG - Intergenic
1007991290 6:46258922-46258944 TGAATGAGGGAGGCAGAGCGGGG + Intronic
1008561557 6:52729625-52729647 GCAGTGAGGGGGTCAGGGTATGG + Intergenic
1008730444 6:54475698-54475720 GGAAAGTGGGAGGGAGGCTAGGG + Intergenic
1008863251 6:56176957-56176979 GGAATGAGGGAGGCAGGAGCAGG + Intronic
1008935608 6:56988670-56988692 AGAATGAGGCAGGCAGGGAATGG - Intronic
1009023223 6:57967892-57967914 GTAATGAAGGAGGCACGGAAGGG - Intergenic
1009198791 6:60719426-60719448 GTAATGAAGGAGGCACGGAAGGG - Intergenic
1009408157 6:63333590-63333612 GGAAGGGGGGAGGGAGGGAAGGG + Intergenic
1009761523 6:68012939-68012961 GGAAGGAGGGAGGGAGGGAAGGG + Intergenic
1010507256 6:76675643-76675665 GGAAGGAGGGAGGGAGAGAAGGG - Intergenic
1010921191 6:81682910-81682932 GGAGGGAGGGAGGGAGGGGAGGG + Intronic
1011161291 6:84393282-84393304 GAAGTGAGAGAAGCAGGGTAGGG + Intergenic
1011222233 6:85066910-85066932 GGAAGGAGGGAGGGAGGGATGGG + Intergenic
1012305576 6:97653400-97653422 GGAGGGAGGGAGGGAGGGGAGGG - Intergenic
1012734191 6:102918061-102918083 GGAGGGAGGGAGGGAGGGAAAGG - Intergenic
1013457203 6:110340969-110340991 GGAATGTGAGAAGTAGGGTAAGG - Intronic
1013658854 6:112273649-112273671 GGAGGGAGGGAGGGAGGGAAGGG - Intergenic
1013702943 6:112796034-112796056 GGAGGGAGGGAGGGAGGGAAAGG - Intergenic
1013971599 6:116026507-116026529 GGAAGGAGGGAGGGAGGGAGGGG + Intronic
1014054476 6:116997819-116997841 GGAAAGAGGGAGGTAGGTGATGG - Intergenic
1014138183 6:117911396-117911418 GGAGGGAGGGAGGGAGGGGAGGG - Intronic
1014248635 6:119094001-119094023 GGAGAGAGGGAGGGAGGGGAGGG - Intronic
1014570131 6:122997517-122997539 GGAAAGAGGGAGCCAAAGTAGGG + Exonic
1014676987 6:124379142-124379164 GGAGGGAGGGAGGGAGGGGAGGG + Intronic
1014810806 6:125883547-125883569 GAGATGAGGGTGGCAGGGAAGGG - Intronic
1014980885 6:127945388-127945410 GGGATGAGGGAGGCAAGATTGGG - Intergenic
1014999672 6:128199584-128199606 GGAGGGAGGGAGGGAGGGAAAGG + Intronic
1014999812 6:128200912-128200934 GGAGGGAGGGAGGGAGGGGAAGG + Intronic
1015042548 6:128739746-128739768 GAAGCGAGGGAGGGAGGGTAAGG - Intergenic
1015190228 6:130464233-130464255 AGAGTGAGGGAGGCAGGGTAGGG - Intergenic
1015503039 6:133953042-133953064 GGAAGGAGGAAGGAAGGGTGGGG + Intronic
1015506341 6:133992702-133992724 GGAAAGTAGGAAGCAGGGTAAGG + Intronic
1015572602 6:134636841-134636863 GGAGGGAGGGAGGGAGGGAAGGG + Intergenic
1015769201 6:136752105-136752127 TGAATGAGGGAGAGAGGGAACGG - Intronic
1015771161 6:136769796-136769818 GGAGGGAGGGAGGGAGGGGACGG + Intronic
1015771182 6:136769839-136769861 GGAGGGAGGGAGGGAGGGGAAGG + Intronic
1015890503 6:137965360-137965382 GGAAGGAGGGAGGAAGGGAGGGG + Intergenic
1015996697 6:139001867-139001889 GAAATAAGGGAGGCTGGGCACGG - Intergenic
1016096215 6:140040948-140040970 GGAATGGAGGAGGCATGGAAAGG + Intergenic
1016713401 6:147198254-147198276 GGAATGCGGGATGCAGTGGAAGG + Intergenic
1016815439 6:148298726-148298748 GGAGGGAGGGAGGGAGGGAAAGG + Intronic
1016997550 6:149970901-149970923 GGAATGAATGGGGCAGGGCAAGG + Intronic
1017001250 6:149999275-149999297 GGAATGAATGGGGCAGGGCAAGG - Intergenic
1017010972 6:150063794-150063816 GGAATGAATGGGGCAGGGCAGGG - Intronic
1017138869 6:151172268-151172290 GGAGGGAGGGAGGGAGGGAAGGG - Intergenic
1017669545 6:156756816-156756838 AGAAAGAGGGAGGGAGGGAAGGG + Intergenic
1017692856 6:156984235-156984257 AGAATGAGGGAGCCATGGCAGGG + Intronic
1017926715 6:158917122-158917144 GGAAGGAGGGAGGGAGGGAGGGG - Intergenic
1018276032 6:162132663-162132685 GGAAATGGGGAGGCAGGGTCTGG + Intronic
1018315561 6:162553357-162553379 GGAAAGAAAGAGGCAGGGGAGGG + Intronic
1018613995 6:165668780-165668802 GGAGGGAGGGAGGAAGGGGAAGG + Intronic
1018861225 6:167712262-167712284 GGAATGAGGGTGGCTGGGACTGG + Intergenic
1018978453 6:168583254-168583276 GGAAGGAGTGAGGCAGGGCAGGG - Intronic
1018978465 6:168583295-168583317 GGAAGGAGTGAGGCAGGGCAGGG - Intronic
1019256422 7:55286-55308 GGAAGCAGGGAGGCAGGGAATGG - Intergenic
1019273904 7:166091-166113 GGAAGGAGGGAGGGAGGGAGGGG - Intergenic
1019290307 7:247019-247041 GGAAGGAGGCAGGGAGGGAAGGG + Intronic
1019315066 7:380524-380546 GGACAGAGGGAGGGAGGGGAGGG + Intergenic
1019315080 7:380554-380576 GGACAGAGGGAGGCAGGGGAGGG + Intergenic
1019315095 7:380584-380606 GGACAGAGGGAGGGAGGGGAGGG + Intergenic
1019315110 7:380614-380636 GGACAGAGGGAGGGAGGGGAGGG + Intergenic
1019315125 7:380644-380666 GGACAGAGGGAGGGAGGGGAGGG + Intergenic
1019315138 7:380674-380696 GGACAGAGGGAGGGAGGGGAGGG + Intergenic
1019334954 7:478623-478645 GGAAGGAGGGAGGGAGGGGGAGG + Intergenic
1019416703 7:931001-931023 GGAAGGAAGGAAGGAGGGTAGGG + Intronic
1019515570 7:1438456-1438478 GGCATTAGGGAGGCAGGGCTGGG - Intronic
1019529609 7:1496842-1496864 GGGAGCAGGGAGGCAGGGTGGGG - Intronic
1019563818 7:1670154-1670176 GGAGGGAGGGAGGGAGGGAAGGG + Intergenic
1019609380 7:1929238-1929260 GGGAGGAGGGAGGCAGGGGGAGG - Intronic
1019637206 7:2082265-2082287 GGAAGGAGGGAGGGAAGGGAAGG + Intronic
1019686830 7:2386597-2386619 GGAGGGAGGGAGGGAGGGAATGG + Intergenic
1019994504 7:4715429-4715451 AGAAGGAGGGAGGCAGGGCAAGG - Intronic
1020128973 7:5548966-5548988 GGAAGGAGGGAGGGAAGGAAGGG + Intronic
1020128992 7:5549015-5549037 GGAAGGAGGGAGGGAAGGAAGGG + Intronic
1020129012 7:5549065-5549087 GGAAGGAGGGAGGGAAGGAAGGG + Intronic
1020129039 7:5549132-5549154 GGAAGGAGGGAGGGAAGGAAGGG + Intronic
1020131064 7:5558884-5558906 GGAATGAGGGGTGGAGGGAAGGG + Intronic
1020305520 7:6831025-6831047 TGAATGGAGGAGGCAGGGGATGG + Intergenic
1020434801 7:8151236-8151258 GGAATGAGAGAGGTGGGGGATGG + Intronic
1020752310 7:12157588-12157610 GGAGGGAGGGAGGAAGGGAAGGG + Intergenic
1020958125 7:14769146-14769168 AGAAAGAGGGAGGGAGGGAAGGG + Intronic
1021040563 7:15857055-15857077 GGACTGAGTGTGGCAGGTTAAGG + Intergenic
1021085785 7:16420441-16420463 GAAATGAAGGAGACAGGGAATGG - Intronic
1021447503 7:20749195-20749217 GGAGGGAGGGAGGGAGGGGAAGG - Intronic
1021469165 7:20981639-20981661 GGAAGGAGGGAGGAGAGGTACGG - Intergenic
1021781797 7:24113903-24113925 GGAATGGTGGAGGCAAGGTCGGG + Intergenic
1022013650 7:26330136-26330158 GGAATGAAGGAGGTAGGCTAAGG + Intronic
1022092588 7:27117361-27117383 GGAAGGAGGGAGCCAGGATTAGG - Intronic
1022096166 7:27142888-27142910 GGAAGGAGGAAGGCAGGGGAGGG + Intronic
1022112073 7:27238057-27238079 GGGATGGGGGTGGCAGGGTGAGG + Intergenic
1022207900 7:28180633-28180655 GGAGGGAGGGAGGCCGGGTGGGG + Exonic
1022342264 7:29479792-29479814 GGATTCAGGGAGGCAGGGGCCGG - Intronic
1023024079 7:36035454-36035476 GGAGTGAGGGAGGAAGGAGAAGG - Intergenic
1023991129 7:45129531-45129553 GGAATAAGGCAGGCAGGAAAGGG + Intergenic
1024070968 7:45785049-45785071 GGAGAGAGGGAGGGAGGGGAAGG - Intergenic
1024263610 7:47589922-47589944 GGAAGGAGGGAGGGAGGGAGAGG - Intergenic
1024350851 7:48361345-48361367 GGAATGAAGGAGGATGAGTAGGG - Intronic
1025147086 7:56514304-56514326 GGAGTGAGGGAAGGAGGGGAAGG - Intergenic
1025147093 7:56514325-56514347 GGAGTGAGGGAAGGAGGGGAAGG - Intergenic
1025147100 7:56514346-56514368 GGAGGGAGGGAGGGAGGGGAAGG - Intergenic
1025789951 7:64680065-64680087 GGATATAGGGAGGCATGGTATGG - Intronic
1025913416 7:65846426-65846448 GGAAGGAGGAAGGGAGGGTGGGG - Intergenic
1026112086 7:67466418-67466440 GGAAAAAGGGAGGGAGGGGAGGG - Intergenic
1026207257 7:68268888-68268910 GGAGAGAGGGAGGGAGGGGAGGG - Intergenic
1026214769 7:68338558-68338580 GAAATTATGTAGGCAGGGTAAGG - Intergenic
1026300166 7:69090806-69090828 GGAATGAGGGAAGGAAGGGAGGG + Intergenic
1026492143 7:70872185-70872207 GGAGGGAGGGAGGAAGGGAAGGG + Intergenic
1026520497 7:71113661-71113683 GGAAGGAGAGAGGGAGGGAAAGG - Intergenic
1026545909 7:71321918-71321940 GGAGGGAGGGAGGGAGGGGAAGG - Intronic
1026567306 7:71500207-71500229 GTAATAAGGGAGACAGGGCAAGG - Intronic
1026597034 7:71741996-71742018 GGAGTGAGGGAGGGAGGAGAGGG - Intergenic
1026605908 7:71815741-71815763 GGAAAGAAGGAGGAAGGGAATGG - Intronic
1026662850 7:72317264-72317286 GGAGGGAGGGAGGAAGGGAAGGG + Intronic
1026871071 7:73852208-73852230 GGAAGGAGGGAAGCAGGGAAGGG - Intergenic
1026921316 7:74157746-74157768 TGGATTAGGGAGGGAGGGTAGGG - Intergenic
1026927395 7:74204041-74204063 GGAATGAGGGAAGGAGGGGAGGG + Intronic
1026927421 7:74204114-74204136 GGAATGAGGGAAGGAGAGGAGGG + Intronic
1026940948 7:74287664-74287686 GTAATGATGGAGGCTGGGCATGG - Intergenic
1027793572 7:82662335-82662357 GGAAATGGGGAGGCAGGGAACGG + Intergenic
1027947324 7:84765417-84765439 GAAAGTAGGGAGGCAGGGTGTGG - Intergenic
1028636780 7:92997980-92998002 GGAAGGAGGGAAGGAGGGAAGGG - Intergenic
1029207416 7:98878206-98878228 TGAAGGTGGCAGGCAGGGTAGGG - Intronic
1029249182 7:99223798-99223820 GGAGCGAGGGAGGGAGGGGAGGG + Intergenic
1029412973 7:100427197-100427219 GGAAGGAAGGAGGGAGGGAAGGG - Intronic
1029412984 7:100427223-100427245 GGAAGGAAGGAGGGAGGGAAGGG - Intronic
1029580512 7:101434039-101434061 GGAGGGAGGGAGGGAGGGAAGGG - Intronic
1029725692 7:102402463-102402485 GGAGTGAGGGAGGGAGAGAAAGG + Intronic
1030173810 7:106630740-106630762 GGAATGATGGAGGCAGAGGTTGG - Intergenic
1030173814 7:106630761-106630783 GGAATGAGGGAAGCAGAGGTTGG - Intergenic
1030173818 7:106630782-106630804 GGAATGATGGAGGCAGAGGTTGG - Intergenic
1030173834 7:106630866-106630888 GGAATGATGGAGGCAGAGGTTGG - Intergenic
1030173838 7:106630887-106630909 GGAATGATGGAGGCAGAGGTTGG - Intergenic
1030173864 7:106631034-106631056 GGAATGAGGGAAGCAGAGGTTGG - Intergenic
1030173895 7:106631244-106631266 GGAATGAGGGAAGCAGAGATTGG - Intergenic
1030173898 7:106631265-106631287 GGAATGAGGGAAGCAGAGGCTGG - Intergenic
1030173908 7:106631328-106631350 GGAATGAGGGAAGCAGAGGTTGG - Intergenic
1030173928 7:106631433-106631455 GGAATGAGGGAAGCAGAGACTGG - Intergenic
1030173964 7:106631662-106631684 GGAATGAGGGAAGCAGAGGTTGG - Intergenic
1030173980 7:106631767-106631789 GGAATGATGGAAGCAGGGGTTGG - Intergenic
1030173985 7:106631788-106631810 GGAATGAGGGAAGCAGAGATTGG - Intergenic
1030173988 7:106631809-106631831 GGAATGAGGGAAGCAGAGGTTGG - Intergenic
1030174045 7:106632166-106632188 GGAATGAGGGAAGCAGAGGTTGG - Intergenic
1030174062 7:106632250-106632272 GGAATGAGGGAAGCAGAGGTTGG - Intergenic
1030174079 7:106632376-106632398 GGAATGAGGGAAGCAGAGGTTGG - Intergenic
1030287332 7:107840031-107840053 GGAAAGAGGAATGCAGAGTATGG + Intergenic
1030301301 7:107977100-107977122 GGAGGGAGGGAGGAAGGGAAGGG - Intronic
1030856008 7:114558511-114558533 GGAAGAAGGGTGGTAGGGTAGGG - Intronic
1030916537 7:115321393-115321415 GGAGGGAGGGAGGGAGGGAAAGG - Intergenic
1030997707 7:116378289-116378311 GGAAAGAGGGAAGGAGGGGAGGG + Intronic
1031271399 7:119654089-119654111 GGAATGAGAGAGGCCGGGCACGG + Intergenic
1031426709 7:121614301-121614323 GGAATGAGCAAGGCTTGGTATGG + Intergenic
1031540630 7:122990888-122990910 GGAAGGAGGGAGGGAGGGAGGGG - Intergenic
1031742142 7:125446982-125447004 GGGATGAGGGAGGGAGGGATAGG - Intergenic
1032061324 7:128727717-128727739 GGGATGAAGGAGGCATGGGATGG - Intronic
1032355965 7:131210741-131210763 GGAGGGAGGGAGGGAGGGGAGGG + Intronic
1032364091 7:131283300-131283322 GGAGGGAGGGAGGGAGGGAAGGG - Intronic
1032675820 7:134129109-134129131 GGAAAGAGGGAGGGAGGGGAAGG - Intronic
1032996104 7:137448523-137448545 GGAGTGAGGGAGGGAGGGAAGGG + Intronic
1033263689 7:139865912-139865934 GGAAAGAGGGAGGGAAGGAAGGG + Intronic
1033570259 7:142620703-142620725 CAAAAGAGGGAGGCAGGCTAAGG + Intergenic
1033597057 7:142865877-142865899 GGAAGGAAGGAGCCAGGGGAGGG - Intronic
1033619462 7:143049285-143049307 GGATCTAGGGAGGCAGGGAATGG - Intergenic
1033680459 7:143589413-143589435 AGAATGAAGGAGGCAGGTGATGG + Intergenic
1033704435 7:143872399-143872421 AGAATGAAGGAGGCAGGTGATGG - Intronic
1033786457 7:144737198-144737220 GGAGGGAGGGAGGGAGGGGAGGG + Intronic
1034065857 7:148136032-148136054 GGAGGGAGGGAGGGAGGGGAAGG + Intronic
1034120953 7:148627373-148627395 GGCATGGGGGAAGCAGGGGAAGG + Intergenic
1034451598 7:151139928-151139950 GGAAGAAGGGAGGCAGAGGAGGG - Intronic
1034461164 7:151198757-151198779 GGAATGAAGGATGGAGGGTAGGG + Intronic
1034543244 7:151773078-151773100 GGAGGGAGGGAGGGAGGGAAGGG + Intronic
1034605329 7:152307377-152307399 GGAAGGAGGGAGGAAGGGAGGGG + Intronic
1034884770 7:154790836-154790858 GGAAGGAGGGAGGGAGGGGAGGG + Intronic
1034995153 7:155572232-155572254 GGAAGGAGGGAGGAAGGCAAGGG + Intergenic
1035392317 7:158513080-158513102 GGAAAGAGGGAAGCGGGGTGAGG + Intronic
1035535935 8:391325-391347 GCAATGAGCCAGGCAGGGAAGGG - Intergenic
1035710578 8:1710223-1710245 AAAAAGAGGGAGGCCGGGTATGG + Intergenic
1035770412 8:2142703-2142725 GGAGGGAGGGAGGGAGGGAAGGG - Intronic
1035902386 8:3471547-3471569 GGAAGGAGGGAGGGAGAGGAGGG - Intronic
1035945297 8:3955104-3955126 GGTATGAGGGGGGCAGGAGACGG - Intronic
1035961933 8:4147341-4147363 GGACTGAGGGAAGAAGGGTGGGG - Intronic
1036495767 8:9268587-9268609 GGAAGGAGGGGGGGAGGGGAGGG + Intergenic
1036499197 8:9297720-9297742 GGAGGGAGGGAGGGAGGGAAAGG + Intergenic
1036522756 8:9507233-9507255 GGAATGTGGGAGGGAGGTGATGG + Intergenic
1036685340 8:10905659-10905681 GGAGGGAGGGAGGCAGGGAGGGG - Intronic
1037461874 8:19118754-19118776 GGGATGGGGGAAGCAGGGAATGG - Intergenic
1037480692 8:19302369-19302391 GGAGGGAGGGAGGGAGGGAAGGG + Intergenic
1037752844 8:21693787-21693809 GGAAGGAGAGAGGAAGGGAAGGG + Intronic
1037774403 8:21823392-21823414 GGAAGGAGGGAAGGAGGGAAAGG - Intergenic
1037789143 8:21920504-21920526 GAAATGAGAGATGCAGGGTTGGG + Intronic
1037867419 8:22457048-22457070 GGAGGGAGGGAGGGAGGGGAAGG - Intronic
1037912727 8:22753703-22753725 GGAAGGTGGGAGCCAGGGTCTGG + Intronic
1037994376 8:23341870-23341892 GGGATCAGGGAGGTAGGGTTGGG + Intronic
1038038956 8:23707876-23707898 GGAGGGAGGGAGGGAGGGAAAGG - Intergenic
1038395249 8:27241655-27241677 GGTAGGAGGGAGGCAGCGGAGGG - Exonic
1038675096 8:29616144-29616166 GGAAGGAGGGAAGGAGGGAAGGG + Intergenic
1038820938 8:30951266-30951288 CGAAGGAGGGAGGGAGGGAAGGG - Intergenic
1039397181 8:37236470-37236492 AGAATGTGGGAGGCAAGGTGGGG + Intergenic
1039601493 8:38842099-38842121 GGAAAGAACAAGGCAGGGTAAGG - Intronic
1039680567 8:39730671-39730693 GGAAGGAGGGAGGCTGGATGGGG + Intergenic
1039812658 8:41063390-41063412 GGAGGGAGGGAGGGAGGGAAGGG + Intergenic
1040360309 8:46658649-46658671 GGAATGAGGGAGGCTGCCTTTGG + Intergenic
1040672067 8:49703958-49703980 GGAGGGAGGGAGGTAGGGGAGGG - Intergenic
1040835239 8:51724023-51724045 GGAAAGAGGGAGGCATGGAGCGG + Intronic
1041230736 8:55748549-55748571 GGAGAGAGGGAGGGAGGGGAGGG + Intronic
1041538456 8:58955413-58955435 GGAATGAAGGAAGCAAGGCAGGG + Intronic
1041546815 8:59054977-59054999 GGAGGGAGGGAGGGAGGGAAAGG + Intronic
1041577298 8:59413514-59413536 GGAGAGAGGGAGGCAGGTAAGGG + Intergenic
1041772481 8:61486765-61486787 TGAATCAGGGTGGCAGGGAAAGG - Intronic
1042345173 8:67719641-67719663 GGAAGCAGAGAGGCAAGGTAGGG + Intronic
1042397812 8:68311870-68311892 GGAGGGAGGGAGACAGGGAAGGG - Intronic
1042502719 8:69526857-69526879 GGAAAGAAGGAGGAAGGGAAGGG + Intronic
1042602185 8:70509963-70509985 GGAAGGAGGAAGGGAGGGGAGGG - Intergenic
1042869958 8:73389537-73389559 CGAAAGAGGAAGGCTGGGTAGGG + Intergenic
1043141975 8:76602034-76602056 GGAGTGGGGGAGGCAGAGGAGGG + Intergenic
1043260489 8:78188496-78188518 GGAGGGAGGGAGGGAGGGGAGGG + Intergenic
1043602041 8:81952540-81952562 GGAGGGAGGGAGGGAGGGTGAGG - Intergenic
1043912611 8:85880666-85880688 AGGATCAGGGAGGCAGGGAAAGG - Intergenic
1044251599 8:90009162-90009184 GGAAGGAGGGAGACAGGGGCAGG - Intronic
1044810224 8:96053077-96053099 GGAATGGGGGAGGCAGGTGGAGG + Intergenic
1044822223 8:96161942-96161964 GGAATGAGCGAGGCAGTGGGCGG - Intergenic
1044956032 8:97481892-97481914 AGAAGGAGGGAGGAAAGGTAGGG + Intergenic
1045081448 8:98630028-98630050 GGAACAGGCGAGGCAGGGTAAGG - Intronic
1045193905 8:99910866-99910888 GGAAGAAGGGAGGGAGGGTTGGG + Intergenic
1045312843 8:101018154-101018176 GGAGTGAGGCAGGCAGGAAAGGG + Intergenic
1045326757 8:101122993-101123015 GGCTTGAGGGATGCATGGTATGG + Intergenic
1045349976 8:101329748-101329770 GGAAGGAGGGAGGCAGGACAGGG - Intergenic
1045510010 8:102806696-102806718 GGAGCGAGGGAGGAAGGGTGCGG + Intergenic
1045679359 8:104642168-104642190 GGAGGGAGGGAGGGAGGGAAAGG - Intronic
1045755194 8:105533966-105533988 GGAAGGAGGGAGGGAGGAGAGGG - Intronic
1045806464 8:106168174-106168196 GGAAAGAGGGAGGAGAGGTAAGG - Intergenic
1045950718 8:107848929-107848951 GGAGGGAGGGAGGAAGGGGAAGG + Intergenic
1046028694 8:108756752-108756774 GGAGGGAGGGAGGGAGGGGAGGG + Intronic
1046106276 8:109670862-109670884 GGAAGGAGGGAGGGAGGGAGAGG + Intronic
1046476112 8:114745918-114745940 GGAAGGAGGGAGGGAGGGAAAGG + Intergenic
1046489878 8:114937497-114937519 GGAAGGAGGGAAGGAGGGAAGGG + Intergenic
1046573029 8:115990810-115990832 GGAGGGAGGGAGGGAGGGGAGGG + Intergenic
1046592214 8:116220455-116220477 GGAAAGAGGGAAGGAGGGAAAGG - Intergenic
1046768567 8:118096699-118096721 GGAAGGAGGGAGGGAAGGAAAGG + Intronic
1046852332 8:118988514-118988536 GGAATGAGGCAGCCAGGGAAAGG + Intergenic
1046980051 8:120327442-120327464 GCAGTGAAGGAAGCAGGGTAGGG - Intronic
1047059524 8:121209059-121209081 GGAGGGAGGGAGGGAGGGGAAGG - Intergenic
1047059540 8:121209097-121209119 GGAGGGAGGGAGGGAGGGGAGGG - Intergenic
1047214300 8:122864216-122864238 GGGAGGAGGGAGGTAGTGTAGGG + Intronic
1047484867 8:125320215-125320237 GGAAGGAGGGAGGGAGGGAAGGG + Intronic
1047552236 8:125887381-125887403 GGAAGGAGGGAAGGAGGGAAGGG - Intergenic
1047598788 8:126405993-126406015 GGAAGGAAGGAGGGAGGGGAGGG - Intergenic
1047641537 8:126826474-126826496 GGATGGAGGTAGGGAGGGTAAGG + Intergenic
1047809326 8:128391205-128391227 GGAATGAGTTAGAAAGGGTAAGG - Intergenic
1048217488 8:132509755-132509777 GGAATGAGGGTGGAATGATATGG - Intergenic
1048313073 8:133340914-133340936 CAAATGATGGATGCAGGGTAGGG - Intergenic
1048363137 8:133715252-133715274 GGAAGGAAGGAGGGAGGGAAAGG - Intergenic
1048458890 8:134603291-134603313 GGAAAGAGGGAGGCAAGAGAAGG + Intronic
1048599847 8:135908031-135908053 GTAATCAGGAAGGCAGGGGATGG - Intergenic
1048808538 8:138263591-138263613 GGCATAAGGGAGACAGGGTCAGG + Intronic
1049071658 8:140359884-140359906 GGAAGGAGGGAGCCAAGGCATGG + Intronic
1049208948 8:141376505-141376527 GAGGTGAGGGAGGCTGGGTAGGG + Intergenic
1049336004 8:142085712-142085734 GGAGGGAGGGAGGGAGGGAAGGG + Intergenic
1049406516 8:142453967-142453989 GGAAGGTGGGAGGCAGGACAGGG + Intronic
1049424098 8:142530425-142530447 GGGTTGAGGGAGGCAGGGCACGG - Intronic
1049726558 8:144149004-144149026 GGTAAGAGGCAGGCAGGGTAGGG + Intronic
1049771503 8:144384245-144384267 GGAAGGAGGCAGGGAGGGTGTGG + Intronic
1049885213 9:22012-22034 TGGAAGAGGGGGGCAGGGTAGGG - Intergenic
1049889236 9:52742-52764 AGATTAGGGGAGGCAGGGTAGGG + Intergenic
1050407136 9:5321597-5321619 GGAAGGAGGGATGGAGGGAAGGG + Intergenic
1051065116 9:13093608-13093630 GGAATTGGGGACGGAGGGTATGG - Intergenic
1051231126 9:14956821-14956843 GGGATGAGGGAGTCAATGTAAGG - Intergenic
1051432044 9:16989315-16989337 GGAATGAGGAAGGAAGAGGAAGG - Intergenic
1051531113 9:18104589-18104611 GGCAGGAGGGAGGGAAGGTAGGG + Intergenic
1051679556 9:19593445-19593467 GGGCTGAGGGAGACAGGGGAGGG + Intronic
1051858767 9:21600254-21600276 GGAAGGAGGGAGGGAGGGAAGGG + Intergenic
1052001328 9:23285106-23285128 GGAGAGAGGGAGGCAGAGGAAGG + Intergenic
1052106355 9:24522037-24522059 GGAAAGAGGGAGGGAGGGGAGGG - Intergenic
1052352201 9:27469422-27469444 TGATTGAGGGAGACAGGTTAGGG - Intronic
1052526119 9:29622023-29622045 GGAAGGAGGGAGGGAAGGAAGGG + Intergenic
1052833157 9:33231765-33231787 GGAATAAGGAAGGCAGGGAAGGG - Intronic
1052998507 9:34564558-34564580 GGAAGGAGGGAGGCTGGATGAGG + Intronic
1053293370 9:36896739-36896761 CCCATGAGGGAGGCAGGGCAGGG - Intronic
1053346209 9:37380140-37380162 GGATAAAGGGAGGCAGGGAAGGG + Intergenic
1053455353 9:38229312-38229334 GCAAGGAGGGATGCAGGGTTGGG + Intergenic
1053485199 9:38447930-38447952 GGAGTGAGGGAGGGAGGGAAGGG - Intergenic
1053535793 9:38924125-38924147 GGAGAGAAGGAGGGAGGGTAAGG + Intergenic
1053730720 9:41054027-41054049 AGATTAGGGGAGGCAGGGTAGGG + Intergenic
1054208015 9:62148538-62148560 GGAGAGAAGGAGGGAGGGTAAGG + Intergenic
1054450658 9:65401985-65402007 AGAAGGAGGGAGGGAGGGGAAGG + Intergenic
1054454030 9:65420418-65420440 GGAAGAAGGGAGGGAGGGGAGGG + Intergenic
1054697779 9:68378053-68378075 AGATTAGGGGAGGCAGGGTAGGG - Intronic
1055106991 9:72523264-72523286 GGAAGGAGGGAGGAAGAGTGAGG + Intronic
1055202946 9:73689768-73689790 GGCAAGAGGGAGGCAGGATCTGG + Intergenic
1055258629 9:74405238-74405260 GGAAGGAAGGAGGGAGGGAAGGG - Intergenic
1055515707 9:77031147-77031169 GGAAGGAGGGAGGGAGGGAGGGG - Intergenic
1055528121 9:77155791-77155813 GGAATGAGGGAAACAGGGCTGGG + Intergenic
1055595088 9:77857647-77857669 GGAAGGAGGGAAGGAGGGGAAGG + Intronic
1055595095 9:77857664-77857686 GGAAGGAGGGAAGGAGGGGAAGG + Intronic
1055861730 9:80758556-80758578 AGAATGAATGAGGCAGGGGAGGG + Intergenic
1056031571 9:82559110-82559132 AGAAAGAAGGAGGCAGGGCAGGG + Intergenic
1056111292 9:83397522-83397544 GGAATGAGGGAAGCAGGCAAGGG + Intronic
1056259490 9:84833638-84833660 GGAAGGAGGGAGGCAGGGGAGGG + Intronic
1056368215 9:85927996-85928018 GGAGGGAGGGAGGGAGGGGAGGG - Intergenic
1056368217 9:85928000-85928022 GGAAGGAGGGAGGGAGGGAGGGG - Intergenic
1056399523 9:86213053-86213075 GGAAGGAAGGAGCCAGGGAAAGG - Intergenic
1056796077 9:89659773-89659795 GGGATGGGGGAGGCAGGCTGGGG + Intergenic
1056855626 9:90127172-90127194 GGAGGGAGGGAGGGAGGGAAGGG - Intergenic
1056940780 9:90954264-90954286 GGCATGAAGGAGGCAGTGAATGG + Intergenic
1057063799 9:92029266-92029288 GAAAGGAAGGAGGCAGGGCAAGG - Intergenic
1057724427 9:97558102-97558124 GGAAAGAGGAAGGAAGGGAAGGG - Intronic
1057912792 9:99033382-99033404 GGAGTGAGGGTGGGAGGGGAGGG + Intronic
1057930024 9:99185147-99185169 GGCGAGAGGGAGGCAGGGCAGGG + Intergenic
1057959401 9:99439958-99439980 GGAAGGAGGGAGGGAAGGAAGGG + Intergenic
1058136720 9:101315896-101315918 GGAATGTGGGAGGAAGGGGAAGG + Intronic
1058369269 9:104246048-104246070 GGAGGGAGGGAGGGAGGGGAGGG + Intergenic
1058643896 9:107112631-107112653 AGTATGAGGGAGGCGAGGTAAGG - Intergenic
1058669266 9:107346906-107346928 GGAGGGAGGGAGGGAGGGAAGGG + Intergenic
1058739982 9:107933354-107933376 GGAATGTGGGGGGCGGGGTGGGG - Intergenic
1058991789 9:110260890-110260912 GGCATGAGTGAGGCAGGAGAGGG + Intergenic
1059035336 9:110748203-110748225 GAAAAGAGGGAGGGAGGGAAGGG - Intronic
1059300239 9:113306663-113306685 GGAGGGAGGGAGGGAGGGGAAGG + Intergenic
1059493524 9:114690197-114690219 TGAAAGAGGGAGGGAGGGGAGGG - Intergenic
1059517715 9:114911331-114911353 GGAATGAAGAAGCCAGGGCATGG - Intronic
1059761754 9:117344405-117344427 GGAATGAATGAAGCAGGGGAGGG - Intronic
1059929835 9:119249859-119249881 GGAGGGAGGGAGGGAGGGAAGGG + Intronic
1059958782 9:119545189-119545211 GGCCTGAGGAAGACAGGGTAGGG - Intergenic
1059961923 9:119574003-119574025 GAGATGAAGGAGGCAGGTTAGGG - Intergenic
1060101109 9:120842018-120842040 GCAGTGAGGGGGTCAGGGTATGG - Intronic
1060660770 9:125404052-125404074 GGACTGAGGGACCCTGGGTAGGG - Intergenic
1060736231 9:126068060-126068082 GAAAAGAGGGAGGGAGGGGAGGG - Intergenic
1060934143 9:127506051-127506073 GGCAGGAGGGAGGCAGGCTGGGG + Exonic
1060991759 9:127853603-127853625 GGTAGGAGGGAGGCAGGGCAGGG + Intronic
1061060288 9:128246795-128246817 GGACGGAGGGAGGGAGGGAAGGG - Intronic
1061278824 9:129585384-129585406 GGAGGGAGGGAGGGAGGGGAGGG + Intergenic
1061404534 9:130386069-130386091 GGAAGGAGGGAGGGAGGGCAGGG - Intronic
1061496906 9:130980299-130980321 GGAGTGAGGGAGGCAGGAAAGGG - Intergenic
1061643435 9:131978920-131978942 GGAAAGTGGGAGAAAGGGTAGGG - Intronic
1061670582 9:132185996-132186018 GGAGAGAGGGAGGCCGGGTGAGG - Intronic
1061754723 9:132804516-132804538 GGGATGCGGGAGGCAGGGGAAGG - Intronic
1061762381 9:132859623-132859645 GGAAGGAGGGGGACAGGGTAGGG - Intronic
1062050526 9:134444455-134444477 GGAAAGAGGGAGGCAGGGGAAGG - Intergenic
1062050623 9:134444708-134444730 GGAAGGAAGGAGGGAGGGGAAGG - Intergenic
1062093972 9:134693670-134693692 GGAAGGGGCGAGGCGGGGTATGG - Intronic
1062144015 9:134978955-134978977 GAAAGGAGGGAGGGAGGGGAGGG + Intergenic
1062144033 9:134979007-134979029 GGAGGGAGGGAGGCAGGGAGGGG + Intergenic
1062158178 9:135065658-135065680 AGACAGAGAGAGGCAGGGTAAGG - Intergenic
1062333694 9:136055746-136055768 GGAAGGAGAGAGGCGGGGCACGG + Intronic
1062359646 9:136181757-136181779 GGAAGGAGGGAGGGAGGGAGGGG + Intergenic
1062396054 9:136353335-136353357 GGAAGGAGGGAGCCAGGGCTTGG + Intronic
1062698949 9:137889377-137889399 GGGGTGAGGGAGGGAGGGTCAGG - Intronic
1203364382 Un_KI270442v1:244031-244053 GGAGGGAGGGAGGGAGGGAATGG + Intergenic
1185478454 X:429031-429053 GGAAGGAGGGAGGAAAGGAAGGG - Intergenic
1185611163 X:1394456-1394478 GGAAAGAGAGAGGCAGGGAAAGG - Intergenic
1185618302 X:1436640-1436662 GGAATGAGGCTGGCCGGGTGCGG - Intronic
1185698380 X:2213143-2213165 GGAAGGAGGAAGGAAGGGAAGGG + Intergenic
1185698400 X:2213213-2213235 GGAAGGAGGAAGGAAGGGAAGGG + Intergenic
1185698445 X:2213355-2213377 GGAAGGAGGAAGGAAGGGAAGGG + Intergenic
1185698546 X:2213706-2213728 GGAAGGAGGAAGGAAGGGAAGGG + Intergenic
1185698564 X:2213780-2213802 GGAAGGAGGAAGGAAGGGAAGGG + Intergenic
1185700569 X:2227893-2227915 GGAGGGAGGGAGGGAGGGAAGGG + Intronic
1185700601 X:2227963-2227985 GGAGGGAGGGAGGGAGGGAAGGG + Intronic
1185700611 X:2227984-2228006 GGAGGGAGGGAGGGAGGGAAGGG + Intronic
1185700675 X:2228122-2228144 GGAGGGAGGGAGGGAGGGAAGGG + Intronic
1185700739 X:2228259-2228281 GGAGGGAGGGAGGGAGGGAAGGG + Intronic
1185700814 X:2228432-2228454 GGAGGGAGGGAGGGAGGGAAGGG + Intronic
1185712361 X:2314323-2314345 GGAAGGAGGGAGGGAGGGAAAGG + Intronic
1185734299 X:2485619-2485641 GGAAGGAGGGAGGGAGGAGAGGG + Intronic
1185734308 X:2485640-2485662 GGAAGGAGGGAGGGAGGGATGGG + Intronic
1185739276 X:2517916-2517938 GGACGGAGGGAGGGAGGGAAGGG - Intergenic
1185768830 X:2749215-2749237 GGAGGGAGGGAGGGAGGGAAAGG - Intergenic
1185914968 X:4025583-4025605 GGAGAGAGGGAGGGAGGGAAGGG - Intergenic
1186020594 X:5251138-5251160 GGAGGGAGGGAGGAAGGGGAGGG + Intergenic
1186020656 X:5251339-5251361 GAAAGGAGGGAGGGAGGGGAGGG + Intergenic
1186077689 X:5898358-5898380 GGAAGGAAGGAGGGAGGGAATGG - Intronic
1186087347 X:6004746-6004768 GGAATGGGGGAAACAGGGTTGGG - Intronic
1186295740 X:8145732-8145754 TGAATGAAGGAGGCAGGAAAGGG - Intergenic
1186406997 X:9313056-9313078 GGAAGGAGGGAAGGAGGGAAGGG + Intergenic
1186623224 X:11263650-11263672 GGAATGAGCCAGGCAGGTTTTGG + Intronic
1186660935 X:11666299-11666321 GGGGTGAGTGAGGCCGGGTAGGG + Intergenic
1186747208 X:12582519-12582541 GGGAGGAGGGAGGCAGGACAGGG + Intronic
1187049118 X:15678653-15678675 AGAAGGAGGGAGGGAGGGAAGGG + Intergenic
1187236671 X:17474517-17474539 GGAGTGAGGGAAGCAGGGCTGGG + Intronic
1187447649 X:19373064-19373086 GGAGGGAGGGAGGGAGGGAAGGG + Intronic
1187652410 X:21423211-21423233 GGAGTGAGGGAGGAACGGAAAGG - Intronic
1187662670 X:21567542-21567564 GGAGTGAAGGAGGTAGGGTAGGG - Intronic
1187751044 X:22465439-22465461 GGATGGAGGGAGGGAGGGCAGGG - Intergenic
1187882879 X:23862861-23862883 GGAGGGAGGGATGCAGGGGATGG + Intronic
1187948639 X:24450794-24450816 GGAGGGAGGGAGGAAGGGAAAGG + Intergenic
1187986563 X:24819796-24819818 GGAAGTAGGGAGGAAGGGGAGGG - Intronic
1188002073 X:24992289-24992311 GCATTGAGGGAGGGAGGCTATGG + Intronic
1188328092 X:28832240-28832262 GGTAGGAGGGAGGGAGGATATGG - Intronic
1188461830 X:30436136-30436158 GGTATGAGGGAGGCAAGAAAAGG - Intergenic
1188699186 X:33237174-33237196 GGAAGGAGGGAGGAAGGGGAGGG - Intronic
1188701686 X:33272172-33272194 GGGATCAGGGAGGCTGGGTATGG - Intronic
1188798512 X:34496698-34496720 GGAAGGAGGGAAGAAGGGGAGGG + Intergenic
1188865846 X:35312290-35312312 GGCATGAGGGAAGCAGGAGAGGG - Intergenic
1188920533 X:35971201-35971223 AGAATGAGGGAAGCAGAATAGGG + Intronic
1189087143 X:38037303-38037325 GGAGTAAGGGAGGCAGGAGAAGG - Intronic
1189140388 X:38599163-38599185 GGGATGAGGGAGGCAGGGGAAGG + Intronic
1189244189 X:39550566-39550588 GGAGTGAGGGAAGCAGGAGAGGG + Intergenic
1189382864 X:40514068-40514090 GGAGTGAAGGAGGGAGGGGATGG + Intergenic
1189717334 X:43880355-43880377 GAATTGAGGGAGGCTGTGTAGGG - Intronic
1189722977 X:43939702-43939724 GGAGTCAGGGGGGCAGGGTTGGG + Intergenic
1190013016 X:46801583-46801605 GGAGTGAGTGAGGGAGGGAAAGG - Intergenic
1190429942 X:50369539-50369561 GGAAGGAGGGAGGCAGGGAGGGG - Intronic
1190443769 X:50502408-50502430 GGAATAGGGGAGGCAAGGAACGG + Intergenic
1190594608 X:52040708-52040730 GGCATCAGGGAGGCAGGAGATGG + Intergenic
1190805378 X:53830998-53831020 GGAGGGAGGAAGGTAGGGTAGGG - Intergenic
1190981402 X:55459380-55459402 GGAAAGAGGGAGTCAGGAAAAGG + Intergenic
1190987296 X:55513800-55513822 GGAAAGAGGGAGTCAGGAAAAGG - Intergenic
1191707095 X:64104871-64104893 GGAAGGAGGGAGGGGGGGTGAGG + Intergenic
1191717265 X:64202338-64202360 GGAATGAGGGAGGTAAGATGAGG + Intronic
1191967358 X:66774517-66774539 GGAAGGAGGGAGGGAAGGAAGGG - Intergenic
1192211503 X:69130811-69130833 GGAGGGTGGGAGACAGGGTAGGG - Intergenic
1193037847 X:76972763-76972785 GGGCTGTGGGAGGCAGGGCAGGG + Intergenic
1193137074 X:77984102-77984124 GGAATGAGGAAGGTGGGGTAGGG + Intronic
1194360149 X:92940456-92940478 GAATTGAGGGAGGCAGTATAGGG - Intergenic
1194870850 X:99129119-99129141 GGATTGTGGGAAGCATGGTAAGG - Intergenic
1195125367 X:101803704-101803726 GGAAGGAGGGAAGGAGGGAAAGG + Intergenic
1195179377 X:102341978-102342000 GGAAGGAGGGAAGGAGGGAAAGG - Intergenic
1195245205 X:102989033-102989055 GGAATTAGGGAGGCGGATTATGG + Intergenic
1195329016 X:103781217-103781239 GAAAGGAGGGAGGGAGGGTTGGG + Intronic
1195369624 X:104159985-104160007 GGAGTGAGAGAAGCAGGATATGG - Intergenic
1195471473 X:105235089-105235111 TGAATGAGGGTGGCAGGAGAGGG - Intronic
1195694766 X:107658763-107658785 GGAGAGAGGGAGGGAGGGAAAGG + Intergenic
1195708572 X:107756602-107756624 GGAGGGAGGGAGGCAGGCTCAGG - Intronic
1195966659 X:110435144-110435166 GGAGTGAGGGAGGAAGGAAAGGG + Intronic
1196301036 X:114050238-114050260 GGCATGAGTGGGGCAGGATAGGG + Intergenic
1196619357 X:117804916-117804938 GGAAAGAGGGAGGGAGGGGAAGG + Intergenic
1196685060 X:118503829-118503851 GGGAAGTGGGAGGCAGGGTGTGG + Intronic
1196913216 X:120505502-120505524 GGAAGGAGGGAGGGAAGGAAAGG - Intergenic
1197398873 X:125964053-125964075 AGAAAGAGGGAGGGAGGGAAGGG + Intergenic
1197705521 X:129631892-129631914 GGCATGAGGCAGGCAGGGTTAGG + Intergenic
1197816109 X:130500313-130500335 GGAAGGAAGGAAGCAGGGGAGGG - Intergenic
1197923930 X:131626763-131626785 GGAGGCAGGGAGGCAGGGAAGGG + Intergenic
1198229149 X:134673201-134673223 GGAAAGAGGGAGGGAGGAGAAGG + Intronic
1198606222 X:138340950-138340972 GGAGAGAGGGAGGGAGGGGAAGG + Intergenic
1199249579 X:145644613-145644635 GGAGGGAGGGAGGGAGGGGAAGG + Intergenic
1199572872 X:149285860-149285882 GTAGTGAGGGAGGCAGGACAAGG + Intergenic
1199972929 X:152873772-152873794 GGAAGGAGGCAGTCAGGATATGG + Intergenic
1199997679 X:153036519-153036541 GTAAGAATGGAGGCAGGGTAGGG + Intergenic
1200051281 X:153433139-153433161 GGGATGAGGGTGGCAGGGCCAGG + Intergenic
1200668352 Y:6056278-6056300 GAATTGAGGGAGGCAGGATAGGG - Intergenic
1200983628 Y:9284652-9284674 GGAGTGAGGTATGCAGGATATGG - Intergenic
1201070465 Y:10143336-10143358 GGAAAGAGGGAGGGAAGGAAGGG + Intergenic
1201289738 Y:12411554-12411576 GGAGGGAGGGAGGGAGGGGAGGG + Intergenic
1201341115 Y:12935542-12935564 GGAAGGAGGGAGGGAGGAAAGGG - Intergenic
1201411673 Y:13704521-13704543 AGAATTCGGGAGGCAGGGGAGGG + Intronic
1201549947 Y:15209277-15209299 GAAAAGAGGAAGGGAGGGTAGGG + Intergenic
1201736262 Y:17265251-17265273 GGAGGGAGGGAGGGAGGGGAAGG + Intergenic
1201736287 Y:17265411-17265433 GGAGGGAGGGAGGGAGGGAAGGG + Intergenic
1201741261 Y:17326343-17326365 GGAATGAGGGAAGGAAGGGAGGG + Intergenic
1201741328 Y:17326725-17326747 GGAGGGAGGGAGGGAGGGGAGGG + Intergenic
1201762793 Y:17557982-17558004 GGAAAGAGGGAGGGAGGGGGAGG - Intergenic
1201838759 Y:18348007-18348029 GGAAAGAGGGAGGGAGGGGGAGG + Intergenic
1201851003 Y:18479759-18479781 GGAAAGAGGGAGCCAGTGTTAGG + Intergenic
1201882316 Y:18840619-18840641 GGAAAGAGGGAGCCAGTGTTAGG - Intergenic
1202126742 Y:21575036-21575058 GGAGTGAGGTATGCAGGATATGG + Intergenic
1202330535 Y:23748024-23748046 GGAAAGAGGGAGCCAGTGTTAGG - Intergenic
1202347829 Y:23953603-23953625 GGAAAGAGGGAGCCAGTGTTAGG - Intergenic
1202522944 Y:25716488-25716510 GGAAAGAGGGAGCCAGTGTTAGG + Intergenic
1202540234 Y:25922037-25922059 GGAAAGAGGGAGCCAGTGTTAGG + Intergenic