ID: 915078859

View in Genome Browser
Species Human (GRCh38)
Location 1:153337488-153337510
Sequence GAGGGAGGCAGGGTAGGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3782
Summary {0: 1, 1: 2, 2: 44, 3: 483, 4: 3252}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915078846_915078859 17 Left 915078846 1:153337448-153337470 CCTTGCCAATGGAGTGCTGGTAA 0: 1
1: 0
2: 0
3: 8
4: 101
Right 915078859 1:153337488-153337510 GAGGGAGGCAGGGTAGGGAGAGG 0: 1
1: 2
2: 44
3: 483
4: 3252
915078847_915078859 12 Left 915078847 1:153337453-153337475 CCAATGGAGTGCTGGTAAACTAG 0: 1
1: 0
2: 1
3: 16
4: 92
Right 915078859 1:153337488-153337510 GAGGGAGGCAGGGTAGGGAGAGG 0: 1
1: 2
2: 44
3: 483
4: 3252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915078859 Original CRISPR GAGGGAGGCAGGGTAGGGAG AGG Intronic
Too many off-targets to display for this crispr