ID: 915078860

View in Genome Browser
Species Human (GRCh38)
Location 1:153337489-153337511
Sequence AGGGAGGCAGGGTAGGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3788
Summary {0: 1, 1: 3, 2: 30, 3: 320, 4: 3434}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915078846_915078860 18 Left 915078846 1:153337448-153337470 CCTTGCCAATGGAGTGCTGGTAA 0: 1
1: 0
2: 0
3: 8
4: 101
Right 915078860 1:153337489-153337511 AGGGAGGCAGGGTAGGGAGAGGG 0: 1
1: 3
2: 30
3: 320
4: 3434
915078847_915078860 13 Left 915078847 1:153337453-153337475 CCAATGGAGTGCTGGTAAACTAG 0: 1
1: 0
2: 1
3: 16
4: 92
Right 915078860 1:153337489-153337511 AGGGAGGCAGGGTAGGGAGAGGG 0: 1
1: 3
2: 30
3: 320
4: 3434

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915078860 Original CRISPR AGGGAGGCAGGGTAGGGAGA GGG Intronic
Too many off-targets to display for this crispr