ID: 915079188

View in Genome Browser
Species Human (GRCh38)
Location 1:153339943-153339965
Sequence GCAGCACGGGTCTACCATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 43}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915079184_915079188 10 Left 915079184 1:153339910-153339932 CCAAGGAAGTTGGTGGTTTCTAG 0: 1
1: 0
2: 3
3: 14
4: 177
Right 915079188 1:153339943-153339965 GCAGCACGGGTCTACCATGAGGG 0: 1
1: 0
2: 0
3: 3
4: 43
915079182_915079188 15 Left 915079182 1:153339905-153339927 CCTTCCCAAGGAAGTTGGTGGTT 0: 1
1: 0
2: 0
3: 9
4: 141
Right 915079188 1:153339943-153339965 GCAGCACGGGTCTACCATGAGGG 0: 1
1: 0
2: 0
3: 3
4: 43
915079183_915079188 11 Left 915079183 1:153339909-153339931 CCCAAGGAAGTTGGTGGTTTCTA 0: 1
1: 0
2: 1
3: 18
4: 142
Right 915079188 1:153339943-153339965 GCAGCACGGGTCTACCATGAGGG 0: 1
1: 0
2: 0
3: 3
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915079188 Original CRISPR GCAGCACGGGTCTACCATGA GGG Intronic
906173235 1:43746178-43746200 GCAGCATGGGTGGACCTTGAAGG + Intronic
910363448 1:86438307-86438329 GCAGTACAGTTATACCATGAAGG - Intronic
913074759 1:115332608-115332630 GCAGCACAGGCCTGGCATGAGGG - Intronic
915079188 1:153339943-153339965 GCAGCACGGGTCTACCATGAGGG + Intronic
1065089298 10:22214362-22214384 GCAGCAGCGGTGAACCATGATGG - Intergenic
1066386636 10:34946971-34946993 GCAGCTCGTGTCTACCATCTTGG + Intergenic
1069664703 10:70146556-70146578 GCAGTGGGGGTCTGCCATGAGGG - Exonic
1081741395 11:45443432-45443454 GGAGTGAGGGTCTACCATGAAGG + Intergenic
1087457235 11:98402671-98402693 GCAGCTAGGGGCTACCCTGAGGG - Intergenic
1089948916 11:122507460-122507482 GCAGCATGTGCCAACCATGATGG - Intergenic
1091284353 11:134399748-134399770 GCAGCAAGGGTCTCTCGTGATGG + Intronic
1103866001 12:124052604-124052626 CCAGCCCGGCGCTACCATGATGG + Intronic
1120854111 14:89197876-89197898 GCAGCACTTGTCTTCCTTGATGG - Intronic
1122124451 14:99571515-99571537 GCAGCACTGGGCTACCCTGACGG + Intronic
1124596769 15:31097769-31097791 GTAGCCAGGGTCTACCATGCGGG - Intronic
1131767469 15:95695111-95695133 GCAGCGCCGGTGTACCTTGAGGG + Intergenic
1132608321 16:802699-802721 GCAGGCCGGGTCCACCATGCAGG - Intergenic
1136377862 16:29876240-29876262 CCAGCACGGGGCTTCAATGATGG + Intronic
1136407145 16:30054711-30054733 GGAACACGGGAATACCATGAGGG - Intronic
1148986579 17:51627821-51627843 GCAGGACGGGTCCACCCTGGGGG + Intergenic
1149368112 17:55965867-55965889 GCAGCACTGCTGTACCATGAAGG - Intergenic
1152427333 17:80225427-80225449 GCAGCAAGGGTCTACACTGCAGG + Intronic
1154039488 18:10839623-10839645 GCAGCAGGAGTCAACCCTGAAGG + Intronic
1160160432 18:76466394-76466416 GCAGCATGGGTGCACCATTATGG - Intronic
1160513778 18:79467273-79467295 GCAGCACAGGACTGCCGTGACGG - Intronic
1167175241 19:47860399-47860421 GCAGCCCGGGTCTACACTGGCGG - Intergenic
926457274 2:13082402-13082424 GCAACATGGGGCTACCAAGAAGG - Intergenic
934660035 2:96138430-96138452 GCAGCAGGGCTCTACCATGGAGG - Exonic
1173809729 20:45948518-45948540 GCAGCAAGGGTCTGCCCTGCTGG + Intergenic
1178605229 21:34030361-34030383 GCAGCATGGTACAACCATGAGGG + Intergenic
1184269359 22:43370028-43370050 GGAGCACGGGTCTCAGATGAGGG + Intergenic
1185061737 22:48610555-48610577 GCAGCTCGGGACCACCAGGAGGG + Intronic
950983453 3:17333692-17333714 GCAGCAAGGGCATAGCATGATGG + Intronic
961652455 3:128423529-128423551 GCAGCATGGATGGACCATGAAGG + Intergenic
981070994 4:140538594-140538616 GTAGCAAGGGCCTAACATGAAGG - Intronic
985484977 5:143390-143412 GCACCACTGCTCTGCCATGACGG - Exonic
1005093735 6:22087507-22087529 GCAGCAGGGATTTACCAGGAAGG + Intergenic
1017491041 6:154945322-154945344 CCAGCCCCGGTCTACCATGCAGG + Intronic
1018735386 6:166683961-166683983 GCAGCAAGGGGCTACCGTGCAGG + Intronic
1028773894 7:94657435-94657457 GCAGGACGGTTCTCGCATGATGG + Intronic
1040496259 8:47968172-47968194 GCAGCACGGTTCTTCATTGATGG + Intronic
1043085342 8:75825118-75825140 GCAGCAAGGGACAACCAAGATGG + Intergenic
1043863654 8:85351470-85351492 ACAGCACTGCTCTAGCATGATGG + Intronic
1046753685 8:117951535-117951557 GCAGCAGGTATCTTCCATGAAGG - Intronic
1049511881 8:143031562-143031584 GGAGCACGGGTCTCCCAAGCAGG + Intergenic
1050668007 9:7963356-7963378 GCAGCTGCGGTCTACCCTGAGGG - Intergenic
1190458641 X:50648736-50648758 GAAGCACAGGAATACCATGAAGG + Intronic