ID: 915080161

View in Genome Browser
Species Human (GRCh38)
Location 1:153346390-153346412
Sequence CCCAGGGGATTTCCCAGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 184}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915080161_915080167 -7 Left 915080161 1:153346390-153346412 CCAACTCTGGGAAATCCCCTGGG 0: 1
1: 0
2: 0
3: 14
4: 184
Right 915080167 1:153346406-153346428 CCCTGGGATAGGCAAGGAGTTGG 0: 1
1: 0
2: 1
3: 15
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915080161 Original CRISPR CCCAGGGGATTTCCCAGAGT TGG (reversed) Intronic
900853335 1:5161519-5161541 CCCAGGGGATCTCCCAGGGAAGG - Intergenic
901202189 1:7473155-7473177 CCTAGGGTAGTTCCCAGAGAGGG + Intronic
901406021 1:9046281-9046303 GCCAGTGGCTTTCCCTGAGTTGG - Intronic
902159797 1:14520672-14520694 ACCAGGGAAATTCCCAGAGGTGG - Intergenic
903014156 1:20350984-20351006 CCCTGGGGTTTTCCCTGACTTGG + Intronic
903836059 1:26203916-26203938 CCCAGGGGGCTTTTCAGAGTTGG - Intergenic
906537358 1:46558899-46558921 CCCACCAGATTTCCCAGAGCTGG + Intronic
913495707 1:119426397-119426419 CACAGGGGACTCCCCACAGTGGG + Intergenic
913985089 1:143557734-143557756 CTCAGGGGATGTCCTGGAGTTGG + Intergenic
915080161 1:153346390-153346412 CCCAGGGGATTTCCCAGAGTTGG - Intronic
915273022 1:154768607-154768629 CCGAGGGGATTTGTCAGTGTGGG - Intronic
915720141 1:157978811-157978833 CCCAGTGGACTTCCCGGAGCAGG - Intergenic
917084435 1:171291820-171291842 CACAGGGGACTCCCCACAGTGGG + Intergenic
917789008 1:178487550-178487572 TCCAGGGGATTTCGCAGAGGAGG - Intergenic
921203085 1:212825312-212825334 CCCAGTGGAATTCAGAGAGTGGG + Intergenic
922237620 1:223733805-223733827 CCCAGTGGGTGTCCCAGAATGGG + Intronic
923091438 1:230744150-230744172 CTCAGGGCATTTCCCAGTGTGGG + Intergenic
923730723 1:236547180-236547202 CCCAGTGGCCTTCTCAGAGTGGG + Intronic
924116712 1:240754250-240754272 TCCAGGGGACATCCCAGAGGAGG - Intergenic
1064608269 10:17068066-17068088 TCCAAGGGATGTCTCAGAGTCGG + Exonic
1067288020 10:44921599-44921621 CCCAGGGCATTACCCTGAGCTGG - Intronic
1067787299 10:49259903-49259925 GCCAAGGGATTTCCCACAGCTGG - Intergenic
1069755972 10:70774624-70774646 CCCAGTAGACTTCCCAGCGTGGG - Intronic
1073877478 10:107941674-107941696 CCCAGGGGATTGCACATAGTAGG + Intergenic
1074786847 10:116849269-116849291 CCCTGGCGATTTTCCAGAGGGGG - Intergenic
1076259965 10:129057666-129057688 TCCAGGGATTTTCCCTGAGTAGG - Intergenic
1076898891 10:133327356-133327378 CCCAGGTGACTGCCCACAGTGGG + Intronic
1081502910 11:43684153-43684175 CACAGGGGATTCACCTGAGTGGG - Intronic
1081711802 11:45221605-45221627 CACAGGGGATTGCTCAGAGAAGG + Intronic
1082791178 11:57347656-57347678 CCCAGAGGAGTTCCCAGTCTAGG + Intronic
1083896478 11:65622391-65622413 TCCAGGGGCTTTCCAAGAATTGG - Intronic
1083994319 11:66264727-66264749 CAGAGGTGGTTTCCCAGAGTGGG - Intronic
1084575585 11:69986145-69986167 CCCAGGGAAGTCCCCACAGTCGG + Intergenic
1085032510 11:73281347-73281369 CCCACTGGCTTTCCCAGGGTGGG - Intronic
1085199942 11:74695882-74695904 CTCAGAGGATTTCCAAGACTGGG - Intergenic
1086441602 11:86834401-86834423 CCGAGGGGATTACCCAAACTAGG + Intronic
1088829414 11:113522593-113522615 CTCAGGTGATTTCCAAGAGGAGG - Intergenic
1088884171 11:113994231-113994253 CCCATAGGCTTTCCCAGAGCAGG - Intergenic
1090435623 11:126684234-126684256 CCCAGGGGCTTTCCCAGAACGGG - Intronic
1091220513 11:133927612-133927634 ACCAGGGGTTTCCCCACAGTGGG + Intronic
1091339676 11:134800639-134800661 CACAGAGGCTTTCCCAGAGGTGG - Intergenic
1096499285 12:52055408-52055430 CCCATGGGATTGCACAGAGCTGG + Intronic
1097177156 12:57149886-57149908 CCCAGGCGAGATCCCTGAGTAGG + Intronic
1097237212 12:57548781-57548803 CTCAGGGGGTTTCCCACATTGGG - Intergenic
1097712273 12:62930028-62930050 GCCAGGGGATTTCCGAGCTTTGG + Intronic
1102007366 12:109597133-109597155 CCCAGGGGCTGTCCCGGAGGCGG + Exonic
1103968420 12:124654693-124654715 CTCAGGGGATTTTCCAAGGTGGG - Intergenic
1109406558 13:61907918-61907940 CACACGGGATGTCCCAGAATGGG - Intergenic
1116608400 14:47032968-47032990 CCAAGGTGACTTCCCAGAGCAGG - Intronic
1116671245 14:47845950-47845972 CTCATGGGAATTCCCGGAGTCGG - Intergenic
1119092868 14:71801010-71801032 CCCAGGGGAATTGCCACAGGGGG + Intergenic
1119494850 14:75069706-75069728 CCCTGGGGTTTTCCCTGAGCAGG + Exonic
1119512133 14:75220035-75220057 GCCAGGGAAGTTCCCAGAGATGG + Intergenic
1119790078 14:77342063-77342085 CCCAGTGGCTTTCACAGAGCGGG + Intronic
1120384094 14:83821884-83821906 CCCAAGAGAGTTCCCACAGTTGG + Intergenic
1121690285 14:95873399-95873421 CGCAGGGGAAATCCCAGAGCTGG - Intergenic
1122345245 14:101054571-101054593 CACAGCTGATTCCCCAGAGTTGG - Intergenic
1122939530 14:104975041-104975063 CCCAGGGGACTTCCCAGAAGAGG + Intronic
1122956605 14:105074305-105074327 CCCTGGGGGCTTCCCAGAGCTGG + Intergenic
1123016303 14:105377236-105377258 CCCAGGGCATCCCCCAGAGACGG - Intronic
1123105046 14:105837362-105837384 TCCAGGGGACATGCCAGAGTTGG - Intergenic
1124265399 15:28228689-28228711 TCCAGGGGTTTCCACAGAGTGGG + Intronic
1125373135 15:38999958-38999980 CTCATGGGAGTTCCCAGAGCTGG - Intergenic
1127398167 15:58559776-58559798 CCCAGTGGATTCCCCAGGGTTGG - Intronic
1129787731 15:78320624-78320646 CCCAGGGCATGGCACAGAGTGGG - Intergenic
1130078621 15:80711453-80711475 CGCAGGTGATTTCCCATAGGAGG + Intronic
1130541388 15:84822901-84822923 CTCAGGGGATTTCCAGGAATGGG + Intronic
1130671103 15:85913498-85913520 CCCAGGGCATGGCCCAGAGTAGG + Intergenic
1133185973 16:4098784-4098806 ACTAAGGGATTTCCTAGAGTTGG + Intronic
1137687738 16:50398528-50398550 TCCAGGAAATGTCCCAGAGTTGG + Intergenic
1138385501 16:56633201-56633223 GACAGGGGCTTTCCCTGAGTGGG + Intronic
1139491784 16:67289825-67289847 CCCAGGGCATCTCACAGGGTGGG + Intronic
1140774469 16:78237518-78237540 CACTGGTGATTCCCCAGAGTGGG - Intronic
1141881803 16:86865252-86865274 CCCAGGCTATTTCCCTGAGGAGG + Intergenic
1142362473 16:89633942-89633964 CCCTGGGCATTCCCCAGGGTCGG + Intronic
1142864240 17:2780561-2780583 CCCAGGAGAGGTCACAGAGTGGG + Intronic
1143137177 17:4718419-4718441 CCCAGGCCATTTCCCAGTGCGGG + Intronic
1143672446 17:8405894-8405916 ACCAGGGGATTACCCTGGGTTGG + Intergenic
1146619540 17:34386705-34386727 GCCCTGGGATTTCCCAGAGATGG - Intergenic
1150426526 17:65081657-65081679 CCTGGGGGACTTCCCAGAGGAGG + Intergenic
1150647073 17:66985531-66985553 CCCGGGGGGCTTCCCAGAGGAGG + Intronic
1151457170 17:74233003-74233025 CACAGGGGATTTCAGAGAGTGGG - Intronic
1152363146 17:79841602-79841624 TCCAGGGGATTTTCAAGAGGGGG - Intergenic
1153999796 18:10473555-10473577 CCCAGAGGTTTTCCTAGAATGGG + Intronic
1157120321 18:44903703-44903725 CCCAGGGTATATCACAGACTAGG + Intronic
1161312643 19:3603472-3603494 CCCAGGGGAAATCCCAGTGCAGG - Intronic
1163864634 19:19762524-19762546 TGCAGGGCATTTACCAGAGTAGG + Intergenic
1166844567 19:45718704-45718726 CCCAGACGATGACCCAGAGTAGG - Intronic
1167096564 19:47377747-47377769 CCCTGGGGACTTCTCAGAGCTGG + Intronic
1167798485 19:51726105-51726127 CCCTGGGGTTTTCCCCGAGGAGG + Intergenic
925257614 2:2503561-2503583 GCCAGTGGTTTTCCCACAGTGGG - Intergenic
926225465 2:10964016-10964038 CACAGGGCACTTCCCAGAGGAGG + Intergenic
926307924 2:11652936-11652958 CCAAGGGTCTTTCCCAGGGTGGG + Intergenic
926690272 2:15728436-15728458 CCCAGGAGGTCTCCCAGGGTGGG - Intronic
927460351 2:23293261-23293283 CCCAGGGAATGTCCCAAAGCCGG + Intergenic
927626193 2:24721583-24721605 CCCAGGGAATCTCCCAAAGGGGG - Intronic
929789236 2:45011425-45011447 CACAGGGGCTGCCCCAGAGTTGG + Intergenic
930102763 2:47615992-47616014 CCAAGGGTAATTCCCAGAGAGGG - Intergenic
931746982 2:65299374-65299396 GACAGGGGAGTTCCCTGAGTCGG - Intergenic
936250415 2:110864212-110864234 CCCAGAGCATCTCCCATAGTGGG + Intronic
936286518 2:111185571-111185593 TTCAGGGGATTTCACAGAGGAGG + Intergenic
938830635 2:135047099-135047121 CCCAAAGGATGTCCCAGAGGAGG - Intronic
942088113 2:172462260-172462282 CCCAGGGGATTTGCAAGGGGCGG + Intronic
944140325 2:196449146-196449168 CCCAGCGAAATTCCCAGACTTGG - Intronic
944409820 2:199429044-199429066 ACCAAGGGATTTCTTAGAGTTGG - Intronic
944522834 2:200588885-200588907 CCCAGGTGATCTCCCTGACTCGG + Intronic
945714056 2:213336316-213336338 CTCATGGGAGTTCCCAGAGCTGG - Intronic
946255677 2:218440172-218440194 CCCATGGCTTTCCCCAGAGTTGG - Intronic
947740280 2:232481742-232481764 CCCAGGGGATGGCCCGGAGGGGG - Intronic
1170609252 20:17898783-17898805 ACCAGGAGATTCCCAAGAGTGGG + Intergenic
1171796154 20:29568012-29568034 CCCTGGGGAGTCCTCAGAGTGGG - Intergenic
1173295140 20:41749178-41749200 CCCGTGGCAATTCCCAGAGTAGG - Intergenic
1174515988 20:51092851-51092873 CCCAGGGGCTTTCCCATGGAAGG + Intergenic
1175971965 20:62691016-62691038 CCCAGGGGCCATCCCAGAGCTGG - Intergenic
1176255158 20:64147898-64147920 CCCAGGGGCTTCCCCTGAGGAGG + Intergenic
1176640855 21:9302421-9302443 CCCAGGGAGTTTCCCAAAATCGG - Intergenic
1176674129 21:9761437-9761459 TCCAGGGAATTTCCCAGAAGTGG + Intergenic
1178935656 21:36859460-36859482 CCCAGTGGAGTTTGCAGAGTGGG - Intronic
1180701388 22:17783244-17783266 CCCAGGGGACTTCCCTGGATGGG + Intergenic
1181082154 22:20423062-20423084 CCTAGGGGGCTTCCCAGAGAAGG + Intergenic
1183382984 22:37499757-37499779 CACAGGGGCTTGCCCAGAGCAGG + Intronic
1183749755 22:39713131-39713153 CCCAGGAGATTTCACAGAAGAGG + Intergenic
1184532731 22:45066689-45066711 CCCAGGGGAGTACCCTGTGTTGG + Intergenic
1185222721 22:49636975-49636997 CTCAGGGGATTCCTCAGAGCTGG + Intronic
950097356 3:10337890-10337912 CCAGGGGGATTTCCCTGAGAGGG - Intronic
953512663 3:43558468-43558490 CCCAGGGGATTACCATGGGTGGG + Intronic
954372806 3:50177516-50177538 CCCAGGGCCTTTCCCAGGCTTGG - Intronic
956750406 3:72340238-72340260 CCCAGGGCATTTCCCACACCCGG + Intergenic
960396137 3:117139679-117139701 CCCAGTGGGTTTCCCAGGTTTGG - Intergenic
962023212 3:131521759-131521781 CACAGTGGGTTTCCCAGAGATGG + Intergenic
968506128 4:972245-972267 GCCAGGGGCTTCCCCAGAGGTGG - Intronic
968661655 4:1801178-1801200 CCCCGGGGCTTTCTCAGAGCTGG - Intronic
970360269 4:15302301-15302323 CCCTGGGGATGTCCCAAAGCTGG + Intergenic
975908436 4:79243051-79243073 CCCAAGTGATTTTCCGGAGTTGG + Intronic
976620454 4:87121515-87121537 CACAGAGGCTTCCCCAGAGTAGG - Intronic
978411469 4:108430671-108430693 CCCAGAAGACTTCCCAGCGTGGG - Intergenic
980022171 4:127722947-127722969 CTCACGGGAGTTCCCAGAGCCGG + Exonic
982793299 4:159617002-159617024 CCAAGCAGATTTCCCAGACTAGG + Intergenic
984987355 4:185344265-185344287 CCCAGGGGATTTTAAAGAGAGGG + Intronic
986762518 5:10893258-10893280 CTCAGAGGATCTTCCAGAGTGGG + Intergenic
987716335 5:21577218-21577240 CTCAGGTGATCTGCCAGAGTCGG + Intergenic
990514282 5:56517476-56517498 CCCTTGGGTTTACCCAGAGTTGG - Intronic
997104276 5:131000744-131000766 TTCACGGGATTTCCCAGACTCGG - Intergenic
997648548 5:135498034-135498056 CCCAGGCTATTTTCCAGAATAGG + Intergenic
1002133170 5:177093525-177093547 CCCGGGGGAACTCCCATAGTGGG - Exonic
1002605787 5:180381962-180381984 CATAGAGAATTTCCCAGAGTAGG - Intergenic
1004549215 6:16630155-16630177 CCCAAGGGAATGCCCACAGTTGG - Intronic
1005175267 6:23037193-23037215 CCAAGGGTAAGTCCCAGAGTGGG + Intergenic
1006116466 6:31778448-31778470 CCCAGTGGATTCCCCAGGGTTGG + Intronic
1006829774 6:36961788-36961810 CCCAAGGGCATTTCCAGAGTAGG + Intronic
1007255208 6:40523612-40523634 CCCAGGGGCTGGCACAGAGTAGG - Intronic
1007464994 6:42045616-42045638 CCCAGGGGAATTCCAACAGATGG + Intronic
1008014980 6:46508481-46508503 CCCAGGGGATGACCCACCGTTGG + Intergenic
1008043892 6:46832213-46832235 CACAGGGTATTCCCTAGAGTTGG - Intronic
1012911159 6:105119484-105119506 CCCTGGGGAATTCCCACAGACGG + Intronic
1013459123 6:110358344-110358366 CGCGGGGGAGTTCCCACAGTTGG - Intergenic
1013767932 6:113595609-113595631 GCCAAGGGATGTCCCAGAGGTGG + Intergenic
1013952175 6:115796307-115796329 CCCAGGGCCTTTTCCACAGTAGG + Intergenic
1015029256 6:128574571-128574593 GCCAGGGGATTCCCCAGTGAAGG + Intergenic
1015218277 6:130775419-130775441 CCCAAGGCATTTCTCAGAGCTGG + Intergenic
1019605992 7:1910507-1910529 CCCAGGGCAGTGCCCAGCGTGGG - Intronic
1019736009 7:2650013-2650035 CCCAGCGGGTTCCCCAGGGTTGG + Intronic
1019747521 7:2709103-2709125 CTCAGGGGAATTCCCGAAGTCGG + Exonic
1020383204 7:7567819-7567841 CACATCGGATTTCCCAGAGTTGG + Intronic
1021178182 7:17474759-17474781 CCCAGGAGAAATCCCACAGTAGG - Intergenic
1029438745 7:100576120-100576142 CTCAGGGGAGGTGCCAGAGTGGG + Intronic
1039024156 8:33239491-33239513 CCTTGGGGTTTTCCCAGAGAGGG + Intergenic
1042668511 8:71233956-71233978 CTCAAGGGATTTCCCAGTGGGGG + Intronic
1043591750 8:81841765-81841787 CCCACGGGGTTGCTCAGAGTCGG - Intronic
1044951474 8:97439542-97439564 TCCAGGGGACTTCCCAAAGGAGG + Intergenic
1046337337 8:112807236-112807258 CCCAGCAGATTTCCCAGACAAGG - Intronic
1049476372 8:142798910-142798932 CCCGGGGGATTACTCAGAGACGG - Intergenic
1054283670 9:63144569-63144591 GCCAGGAGGTTTCCCAGAGGAGG + Intergenic
1054391149 9:64620369-64620391 GCCAGGAGGTTTCCCAGAGGAGG - Intergenic
1056123533 9:83512711-83512733 CCCAGGGGACTCCAGAGAGTAGG - Intronic
1056558543 9:87709962-87709984 CCCAGGGCATTTCCCAAGATGGG - Intergenic
1057352823 9:94315136-94315158 CACAGGGGATGTGCCAGGGTGGG + Intergenic
1057551476 9:96053940-96053962 CACAGGTGATTTTACAGAGTCGG + Intergenic
1057654924 9:96942455-96942477 CACAGGGGATGTGCCAGGGTGGG - Intronic
1057854931 9:98594602-98594624 CCGAGGGGCTTCCCCAGAGGCGG - Intronic
1060444644 9:123677075-123677097 GCCAGGGGACTTCTCAGAGATGG - Intronic
1060931557 9:127492377-127492399 CCCATGGGGTTTCCAAGAGCAGG + Intronic
1061747414 9:132750531-132750553 CAGAGGGGATGTCCCAGAGTTGG - Intronic
1061935967 9:133857838-133857860 CCCAGGAAAAGTCCCAGAGTGGG + Intronic
1187676449 X:21721066-21721088 CCCAGGTGATTCTCCAGGGTAGG + Intronic
1192631479 X:72781091-72781113 CCCACGGGTGCTCCCAGAGTGGG - Intronic
1192650230 X:72939710-72939732 CCCACGGGTGCTCCCAGAGTGGG + Intronic
1195017902 X:100796780-100796802 CACAGGGGACTCCCCACAGTGGG - Intergenic
1196761237 X:119202716-119202738 TCCAGGGGCTTTCCCAGGGTTGG + Intergenic
1198603946 X:138315749-138315771 CCCAGGGGGTTTTCCAAAGGCGG - Intergenic
1199035862 X:143050508-143050530 CTCACGGGATTTCCCAGAGCTGG + Intergenic
1199466685 X:148145884-148145906 CTTAGAGGATTTCCCAGAATGGG - Intergenic
1200182984 X:154162487-154162509 CCCGGGGGATTTCTCCGTGTGGG - Intergenic
1200188638 X:154199601-154199623 CCCGGGGGATTTCTCCGTGTGGG - Intergenic
1200194287 X:154236742-154236764 CCCGGGGGATTTCTCCGTGTGGG - Intergenic
1200200043 X:154274545-154274567 CCCGGGGGATTTCTCCGTGTGGG - Intronic
1200740656 Y:6850314-6850336 AACAGGGGATTTGGCAGAGTCGG - Intergenic
1201774498 Y:17648513-17648535 CCCAGGGGTTTCCCTGGAGTGGG - Intergenic
1201827058 Y:18257476-18257498 CCCAGGGGTTTCCCTGGAGTGGG + Intergenic