ID: 915085955

View in Genome Browser
Species Human (GRCh38)
Location 1:153389055-153389077
Sequence GAACCCTGGTTTAGTGATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 110}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915085952_915085955 11 Left 915085952 1:153389021-153389043 CCCAATTTCAGAGATGTATAGAC 0: 1
1: 0
2: 0
3: 17
4: 279
Right 915085955 1:153389055-153389077 GAACCCTGGTTTAGTGATTCTGG 0: 1
1: 0
2: 0
3: 9
4: 110
915085953_915085955 10 Left 915085953 1:153389022-153389044 CCAATTTCAGAGATGTATAGACA 0: 1
1: 0
2: 2
3: 36
4: 359
Right 915085955 1:153389055-153389077 GAACCCTGGTTTAGTGATTCTGG 0: 1
1: 0
2: 0
3: 9
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915085955 Original CRISPR GAACCCTGGTTTAGTGATTC TGG Intergenic
905714513 1:40136887-40136909 GCACACTGTTTTAGTGACTCTGG - Intergenic
913035185 1:114957813-114957835 GAACCCTTGTTTACTGTTGCTGG + Intronic
915085955 1:153389055-153389077 GAACCCTGGTTTAGTGATTCTGG + Intergenic
916812439 1:168317321-168317343 GACCCCCAGTTTTGTGATTCTGG - Intergenic
917452070 1:175155652-175155674 GCACCCTGGAGTAGTGATGCAGG - Intergenic
920253963 1:204641809-204641831 GACCCCTGCTTTAGTTGTTCTGG - Intronic
924768565 1:247057367-247057389 GAACCCTGGTATAGTGGTTGTGG + Intronic
1064099975 10:12455089-12455111 GAACCCTGGTTTTGGAATACTGG - Intronic
1064217638 10:13413845-13413867 AGACCCTGGTTTAGTGATGATGG + Intergenic
1064438740 10:15333965-15333987 AAAGCCTGGCCTAGTGATTCTGG - Intronic
1068808077 10:61223251-61223273 AAAGCCTGGTTTATTCATTCTGG - Intergenic
1071080910 10:81809666-81809688 GAACCCTGGATTGTTGATTTTGG - Intergenic
1072552229 10:96487762-96487784 GAACCCTGGCTTGGGGGTTCTGG - Intronic
1072764386 10:98083821-98083843 CAACCCTGCTTTAGTCACTCAGG + Intergenic
1084386658 11:68847177-68847199 GAACCCAGGCTGAGTGGTTCTGG - Intergenic
1085726479 11:78959483-78959505 GATCCCTGGTTTTGGGTTTCAGG + Intronic
1086865163 11:91971611-91971633 GAACCATGGTTCAGTGGTTAAGG - Intergenic
1087177897 11:95111794-95111816 GACCCCTGCTTTAGAGCTTCAGG + Intronic
1094412650 12:30183235-30183257 GAAGCCTGGATGAGTGCTTCTGG - Intergenic
1098937500 12:76497382-76497404 GATTCCTGGTGTAGTGTTTCAGG + Intronic
1104547956 12:129729503-129729525 AAACCCTGGTCTAGTCATACTGG + Intronic
1104719436 12:131036852-131036874 GAAACCTGGTGTAGTGAGTGAGG - Intronic
1105828090 13:24140471-24140493 GAACCTGGGTTAAGCGATTCTGG + Intronic
1110188870 13:72706560-72706582 GAACCCTGGTAAATTGAGTCTGG - Intergenic
1110374548 13:74777363-74777385 GGACCCTGGTTTATTGCTTTTGG + Intergenic
1110682658 13:78334658-78334680 GGACACTGGTTTAGTGAGACTGG + Intergenic
1118120022 14:62829652-62829674 GAAAACTGGTTTAGTGGTCCAGG - Intronic
1119628055 14:76199690-76199712 GAACCCTTGTGTAGTGCTTGTGG + Intronic
1120000838 14:79301635-79301657 GAACCCTGCCTTAGAGAATCAGG - Intronic
1121241380 14:92432415-92432437 AAACCCTGGTTTGGAGAATCAGG + Intronic
1121803408 14:96794326-96794348 GGACCCTGGTTTAATGCTTAAGG - Intergenic
1122844022 14:104480959-104480981 GACCCCTGCCATAGTGATTCAGG + Intronic
1124324256 15:28743717-28743739 GAACCCTCATTTACTGCTTCTGG - Intergenic
1126987452 15:54329041-54329063 AATCCCTGGTCTAGTTATTCTGG + Intronic
1131170415 15:90174389-90174411 GAACCCAGGTTTCCTGATTCTGG + Intronic
1131764131 15:95657162-95657184 GAACTGTGGTTTAGTCATCCAGG + Intergenic
1135063000 16:19286600-19286622 GAAGGCTGGGTTACTGATTCTGG + Intronic
1137287656 16:47029786-47029808 GAACCCTGAGTTTGGGATTCAGG + Intergenic
1143809813 17:9462137-9462159 GACCCCTGGGTTAGAGAATCAGG + Intronic
1145396143 17:22496569-22496591 AATCCCTGATTTAGTGATTTTGG - Intergenic
1145916657 17:28577880-28577902 GAAGCCTGCAATAGTGATTCAGG + Intronic
1148547042 17:48527009-48527031 GGGCCCTGGTTTATTGATTCCGG - Intergenic
1149067180 17:52494594-52494616 GAATTCTGGTTTAATTATTCTGG + Intergenic
1150017218 17:61570278-61570300 GAACCCTTGTGTATTGCTTCTGG - Intergenic
1158322167 18:56275557-56275579 GGACCCTGGTTTTGTGCTTCTGG + Intergenic
1161278709 19:3433700-3433722 GAACCTTGGCTTAGTGACACAGG - Intronic
1167206880 19:48108508-48108530 GACCCCTGGTTACGTGACTCTGG + Intronic
1168644406 19:58050922-58050944 GGACCCAGGTTTATTGTTTCAGG - Intronic
925634079 2:5925668-5925690 TAACCCTGCTTTAGTGATGATGG + Intergenic
928998881 2:37325436-37325458 AAGCCCAGGTTTGGTGATTCTGG - Intergenic
933422875 2:82074099-82074121 TTACCCTGATTTAGTTATTCCGG - Intergenic
934936135 2:98466835-98466857 GAAGCCTGGTGTAGTTATTCAGG - Intronic
941699535 2:168589154-168589176 GAACCCTTGTTTACTGTTGCTGG - Intronic
945629901 2:212261015-212261037 GAACCCAGGTTTTCTCATTCTGG - Intronic
948771171 2:240251879-240251901 AAGCCCTGGTTTAGAGATTGGGG + Intergenic
1172784470 20:37458006-37458028 GCAGCCTGGTTGAGTGTTTCTGG + Intergenic
1173519470 20:43688489-43688511 GAACCCTGTTTTAAAGAGTCTGG - Intronic
1175977686 20:62720016-62720038 GAAACCAGGTGTAGTGGTTCAGG + Intronic
1177131106 21:17256695-17256717 GAATCCTGGTTTAGTGACTGGGG + Intergenic
1179822630 21:43945534-43945556 GAACCCTGTTTCTGTGGTTCAGG + Intronic
1182875650 22:33689023-33689045 AAGCCCTGGTTTAGCGCTTCAGG + Intronic
1183169784 22:36179234-36179256 GAACCCTGTTTCTGTGAATCAGG + Intergenic
1184586376 22:45450854-45450876 AAATTCTGTTTTAGTGATTCTGG - Intergenic
1185402165 22:50624865-50624887 GAACCCTGGTGTCGTGGCTCTGG - Intronic
951837278 3:26997149-26997171 GAATCCTGGTATAGTCAATCAGG - Intergenic
952420848 3:33130209-33130231 GCAGCATGGCTTAGTGATTCAGG + Intronic
953689287 3:45104199-45104221 GAAGCCCAGTTTATTGATTCTGG + Intronic
956445728 3:69323966-69323988 CAACTCTGGTTTGGTGAGTCTGG - Intronic
960925635 3:122793189-122793211 GAACCCTGGTTTAGCAAGTGGGG - Intronic
967138509 3:186532816-186532838 GGACCCTGGTTGAGTGGTTCTGG - Intergenic
967166877 3:186788218-186788240 GAACCCTGGTTTAGTTATAGTGG + Intronic
967494191 3:190124328-190124350 CACCCCAGGTTTAGTGAATCCGG - Intergenic
969161852 4:5267060-5267082 CCACCCTGGTTTTATGATTCAGG - Intronic
969547927 4:7844108-7844130 GCACCCAGCTTTGGTGATTCAGG - Intronic
975980699 4:80155531-80155553 GTACCAGTGTTTAGTGATTCTGG - Intergenic
976240342 4:82949126-82949148 GAACCCTTGTATATTGATTGTGG - Intronic
978532902 4:109732001-109732023 CAAGCCTGGTTTAAGGATTCAGG - Intergenic
981764784 4:148236151-148236173 CAGCCCTGCTTTAGGGATTCAGG - Intronic
983837737 4:172413149-172413171 GAACCCTGTTTAAGTCAATCAGG - Intronic
993995284 5:94715192-94715214 GAATCCGGGTTTGGTAATTCTGG - Intronic
996667633 5:126079324-126079346 GAACCCTCCTTTAGTTATTTTGG - Intergenic
996889722 5:128404336-128404358 TAACACTGGTTTTGTAATTCTGG + Intronic
1000042814 5:157497895-157497917 AAACCCTGGTTGTGTGATTTGGG - Intronic
1007116233 6:39345216-39345238 GGACTCTGCTTTAGTGCTTCCGG - Intronic
1012491629 6:99788670-99788692 AAACCCTGTTTTAGAGATACGGG + Intergenic
1012580758 6:100867277-100867299 GACCCCTGCTTTAGTAATTATGG - Intronic
1013487792 6:110614630-110614652 GAACGCTGCTTTGGTAATTCAGG + Exonic
1013821954 6:114165210-114165232 AATCCTTGGTTTAGTGATTATGG + Intronic
1015006659 6:128290579-128290601 AAACCCTGGTGTAGAGATTAGGG + Intronic
1016632990 6:146253551-146253573 GAACTCTGGTTTATTGGTTAGGG + Intronic
1017013786 6:150083762-150083784 GAAGCCTGGTCTAGTGGTCCAGG + Intergenic
1021774677 7:24040987-24041009 TAACCATGGTTTGGTGTTTCTGG - Intergenic
1023777309 7:43620140-43620162 GATCCATGGTTGAGTGCTTCTGG + Intronic
1024340044 7:48248141-48248163 GACCCCTTGTTTAGTGATACAGG + Intronic
1028531690 7:91845457-91845479 GGACCATGGTGTAGTTATTCTGG - Intronic
1030585570 7:111414287-111414309 GCACCCTAGTTTGTTGATTCAGG - Intronic
1032318607 7:130864315-130864337 GAACCCTGGTATAGTGTTGGTGG + Intergenic
1032828278 7:135594588-135594610 GACCCCTGTTGTGGTGATTCTGG + Exonic
1038422335 8:27441393-27441415 GAACCCTACTTTAGGGAGTCTGG + Intronic
1039629434 8:39093065-39093087 CAAGATTGGTTTAGTGATTCTGG + Intronic
1040429659 8:47326904-47326926 GAACCCTGGTTTACACATTTCGG + Intronic
1042851816 8:73224522-73224544 GAAACTTGGATTTGTGATTCAGG + Intergenic
1043729031 8:83651209-83651231 GAACCCTGGCTTACCGATTGAGG - Intergenic
1046433163 8:114154043-114154065 GAAAAATGGTTTAGTGAGTCTGG - Intergenic
1047000386 8:120567251-120567273 GAACCCTGCCTTAGATATTCTGG - Intronic
1050215573 9:3319153-3319175 AAAGCCTGTTTTAGTGATTACGG - Intronic
1052008458 9:23378388-23378410 CAAGCCTGGTTTAGTGTTTATGG + Intergenic
1057695820 9:97322334-97322356 CAACTCTGGTTTAGTGCTGCTGG - Intronic
1057872260 9:98727216-98727238 AAACCCAGGTTTCATGATTCCGG + Intergenic
1057947375 9:99341319-99341341 CAAGCTTGGTTTAGAGATTCAGG + Intergenic
1060861173 9:126956164-126956186 GCACCCTGGTCTAGTCAGTCTGG + Intronic
1061988989 9:134147614-134147636 AAGCCGTGGTTTAATGATTCGGG - Intronic
1062091541 9:134681054-134681076 GCTCCCTGGTTTAGTCATTGAGG + Intronic
1186516929 X:10173393-10173415 GGACCCCGGTTTAATGACTCTGG + Intronic
1187247018 X:17561961-17561983 GAACCAAGGTTTGGTGTTTCTGG + Intronic
1193725117 X:85029145-85029167 GAACCCTTGTATATTGTTTCTGG - Intronic
1194081264 X:89467876-89467898 AATCACTGCTTTAGTGATTCTGG + Intergenic
1195533839 X:105987853-105987875 CAACCCGGGTTTGGTGATTTTGG + Intergenic
1195966988 X:110437858-110437880 GAGCCCTTGTTCAGTGACTCAGG + Intronic
1200433937 Y:3124073-3124095 AATCACTGCTTTAGTGATTCTGG + Intergenic