ID: 915086314

View in Genome Browser
Species Human (GRCh38)
Location 1:153391242-153391264
Sequence TAGGAGAAGCGGAAAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 877
Summary {0: 1, 1: 0, 2: 3, 3: 73, 4: 800}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915086304_915086314 28 Left 915086304 1:153391191-153391213 CCAGGTGAATGTGGCAATCACTG 0: 1
1: 0
2: 1
3: 13
4: 146
Right 915086314 1:153391242-153391264 TAGGAGAAGCGGAAAGAGGAAGG 0: 1
1: 0
2: 3
3: 73
4: 800

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915086314 Original CRISPR TAGGAGAAGCGGAAAGAGGA AGG Intergenic
900552692 1:3264584-3264606 CAGGAGGAGCGGAAAGGGGAGGG + Intronic
900804296 1:4757208-4757230 CAGGGGAGGCGGAAAGGGGAGGG - Intronic
901082667 1:6592466-6592488 TAGAAGAAGTGGGAAGAAGAAGG - Exonic
901447913 1:9319418-9319440 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
901519065 1:9768922-9768944 AAGGAGAAAGGGAAAGAGGGAGG + Intronic
901651617 1:10746465-10746487 TAGGAGAAGCTCCCAGAGGAAGG + Intronic
902379120 1:16044463-16044485 CTGGAGAAGCGGATAGAGGGAGG - Intronic
902388306 1:16088556-16088578 TAGGAGAAGAGGAACGAGTTTGG + Intergenic
902850652 1:19153504-19153526 TAGGAGGAGAGGACAAAGGAGGG + Intronic
902944582 1:19825591-19825613 TAGGATAAGGGGAAAGAGAAGGG - Intergenic
902992977 1:20202583-20202605 TTGGAGAAGGGGAAGGAGAATGG - Intergenic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
903463553 1:23536067-23536089 TAGGAAAAGCACAAAGAAGATGG - Intergenic
904010052 1:27384075-27384097 TAGGAGAAGCAGATGGGGGAAGG - Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904713260 1:32447765-32447787 TAGGGGAAGGGGAAGGAGGGGGG - Intergenic
904801501 1:33096258-33096280 GAGGAGGAGCAGGAAGAGGAGGG + Intronic
904807272 1:33140861-33140883 AAGGAGAAGGGGAGAGAGGAGGG - Intergenic
904897585 1:33828528-33828550 TAGAGGAAGGGGAATGAGGAAGG + Intronic
905799942 1:40837041-40837063 GGGGAAAAGGGGAAAGAGGATGG - Intronic
906156358 1:43616447-43616469 TGGGACAAGAGGAAAGAGGCAGG + Intronic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906485811 1:46234007-46234029 GAGGAGAACTGGAAAGATGATGG - Intergenic
906945977 1:50294624-50294646 TGGCAGAAGGGGAAAGAGCATGG - Intergenic
907378793 1:54067545-54067567 AAGGAAAAGAGGAAAGGGGAAGG - Intronic
907835734 1:58106865-58106887 AAGGAGAAAGGGAAGGAGGAAGG - Intronic
908390591 1:63679951-63679973 GAGGAGAAGCAAAAAGAGAAGGG - Intergenic
908629684 1:66088762-66088784 TTGGAGATGGGGGAAGAGGAGGG - Intronic
908651478 1:66337570-66337592 AAGGACATGGGGAAAGAGGAGGG + Intronic
908843812 1:68304454-68304476 TAGGAAAAATGAAAAGAGGAGGG + Intergenic
909336405 1:74480110-74480132 CAAGAGAAGAGAAAAGAGGAGGG + Intronic
909629647 1:77758697-77758719 TAGGAAAAACGGAACTAGGACGG + Intronic
910278739 1:85475323-85475345 GAGGAGAAGGGGGAGGAGGAGGG + Intronic
910479350 1:87641462-87641484 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
910484787 1:87701244-87701266 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
910660892 1:89671309-89671331 AAGGAGAAAAGGAAAGAGGAAGG + Intronic
911262213 1:95700392-95700414 TAGAAGAAGCTGAAAAGGGATGG + Intergenic
911620905 1:100065670-100065692 AAGGAAAAGGGGAAAGGGGAAGG - Intronic
911991280 1:104699738-104699760 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
912069557 1:105792708-105792730 TAGGAGGAGGTGAAAAAGGAAGG - Intergenic
912363505 1:109113994-109114016 TAGGAGGAGAGGACAGAGGGAGG + Exonic
915086314 1:153391242-153391264 TAGGAGAAGCGGAAAGAGGAAGG + Intergenic
915426839 1:155834299-155834321 TAGTAAAAGTGAAAAGAGGAAGG - Intronic
915480455 1:156181021-156181043 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
915536096 1:156536475-156536497 TAGGAGAAGGGGAGAGAGGATGG + Intronic
915580653 1:156811081-156811103 AAGGAGATGCTGAGAGAGGAGGG - Intronic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
916160627 1:161909300-161909322 AAGGAGAAAGGGAAGGAGGAGGG + Intronic
916242913 1:162657796-162657818 GAGGAGAAGGGAAAAGAGGAAGG - Intronic
916764736 1:167849399-167849421 TAGGTGAGGTGGAAATAGGAAGG + Intronic
917307077 1:173638036-173638058 TAGGAAAAGCTGCAAGAGGGTGG + Intronic
917503220 1:175604633-175604655 AAGGAGAGGAGGAGAGAGGATGG - Intronic
917538803 1:175893979-175894001 TAGGGGAAGGGAGAAGAGGAAGG - Intergenic
918098853 1:181356426-181356448 TAGGGGAAGGGGAAATAGTATGG - Intergenic
918102143 1:181385743-181385765 GAGGAGAGGAGGAAAGAGGAAGG - Intergenic
918469966 1:184861726-184861748 AAGGAGAAGGGGAGGGAGGAAGG + Intronic
918833982 1:189435533-189435555 AAGGGGAAGGGGAAGGAGGAAGG + Intergenic
919112216 1:193235280-193235302 TTGGAGAAGAGAAAGGAGGAAGG - Intronic
919870837 1:201820054-201820076 GAGGAGGAGATGAAAGAGGAGGG + Exonic
920098731 1:203503322-203503344 GAAGAGAAGGGGAGAGAGGAAGG - Intronic
920189222 1:204181775-204181797 AAGGAGAAGAGAAAAGAGGAAGG - Intergenic
920682797 1:208085410-208085432 CAGGAGAAGGGGACAGAGAAAGG - Intronic
920697069 1:208189059-208189081 TACGAGAAGCGCAAAGAAAAGGG + Intronic
921841685 1:219835333-219835355 CAGGTCAAGCTGAAAGAGGATGG - Intronic
922486900 1:225980439-225980461 TACTAGAAGAGGAAGGAGGAAGG + Intergenic
922724386 1:227915656-227915678 AAGGAGACGAGGGAAGAGGAAGG - Intergenic
923072368 1:230577640-230577662 GAGGAGAAGAAGAAGGAGGAAGG - Intergenic
923355137 1:233147463-233147485 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
923375275 1:233355873-233355895 AAGGAGAAGGGGACAGATGAGGG - Intronic
923576314 1:235161904-235161926 TTGCAGAAGGGGAAAGAGGAGGG - Intronic
923736985 1:236619505-236619527 AAGGGCAAGCGGAGAGAGGAAGG + Intergenic
923754407 1:236777558-236777580 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
924447051 1:244142856-244142878 CAGGAGATAGGGAAAGAGGAAGG - Intergenic
924761397 1:246990132-246990154 AAGGAGAAGGGGAAGGAGGGAGG + Intronic
1062897144 10:1112380-1112402 TAGGAGAAGGTGAGAGACGAAGG - Intronic
1063408314 10:5816926-5816948 TAGGAGAAGAGGAAAAAGAGAGG - Intronic
1064040788 10:11961495-11961517 CAGCAGAAGAGGGAAGAGGAGGG + Intronic
1064395931 10:14981920-14981942 GAGGAAAAGCGCAAAGAGAATGG - Intronic
1064533026 10:16329545-16329567 AAGGAGAAGGGGAAAGGGAAGGG + Intergenic
1065480993 10:26193670-26193692 TAGAAGAAAAGGAAAGAAGAGGG + Intronic
1065722764 10:28642498-28642520 TAGTAGAAGAAGAAAGAGGTAGG - Intergenic
1065751874 10:28895184-28895206 TGTGAGAAGGGGAAAGAGCATGG + Intergenic
1065866561 10:29919860-29919882 AAAGAGAAGAGGAAAGAGAAGGG - Intergenic
1065905466 10:30247327-30247349 TAGGAGCAGTTGAAGGAGGAGGG - Intergenic
1065959758 10:30725116-30725138 TAGGTGAAGGGGAAAGAGTGGGG - Intergenic
1066259634 10:33716648-33716670 AAGGGGAAGAAGAAAGAGGAAGG - Intergenic
1066334650 10:34463259-34463281 AAGGGGAAGGGGGAAGAGGAAGG + Intronic
1066422083 10:35273114-35273136 TAGGAGAACGGGAAAGAGAATGG - Intronic
1066523341 10:36247812-36247834 GAGGAGAAGAGGGGAGAGGAGGG - Intergenic
1066547481 10:36516479-36516501 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1066704580 10:38164325-38164347 TAGGTGAAAGGGAGAGAGGATGG - Intergenic
1067799600 10:49349923-49349945 GAGGTGGAGCAGAAAGAGGAAGG + Intergenic
1068752305 10:60609050-60609072 TTGAAGAAAAGGAAAGAGGAAGG + Intronic
1068975298 10:63002544-63002566 TTGGATAAGCTGAAAGAAGAGGG - Intergenic
1069053722 10:63821795-63821817 TGTGAGAAGCAGAAAGAGGCAGG - Intergenic
1069369702 10:67734127-67734149 CAGGAAAAGAGAAAAGAGGAAGG - Intergenic
1069636257 10:69926707-69926729 TGGGAGAAGAGGAAAGAACAAGG + Intronic
1069718521 10:70535600-70535622 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1069755977 10:70774653-70774675 AAGGAGAAGGGGGAGGAGGAAGG - Intronic
1070453035 10:76581099-76581121 TGGAAGAGGCAGAAAGAGGAAGG + Intergenic
1070568008 10:77618594-77618616 CAGGAGAACAGGAAAGAGCATGG + Intronic
1070813423 10:79309663-79309685 TAGGAGAAACAGGAAGAGGAAGG + Intronic
1070921968 10:80193359-80193381 CTGGAGAAAGGGAAAGAGGAAGG + Intronic
1070988356 10:80708228-80708250 TGGGATAAGCGGAATGGGGAAGG + Intergenic
1071163755 10:82781153-82781175 TCTGAGATGTGGAAAGAGGAAGG - Intronic
1071390996 10:85175264-85175286 TAGGAGAAGGGGATGGAAGAGGG - Intergenic
1071663003 10:87524736-87524758 CTGGAGGAGAGGAAAGAGGATGG + Intronic
1071988396 10:91075567-91075589 TTGGACAAGAGGAAAGAGAAGGG + Intergenic
1072228634 10:93393786-93393808 GATGAGAAGCAGAAGGAGGAAGG - Intronic
1072783725 10:98266985-98267007 AAGGAGAAGGGGACAGAAGAGGG + Intronic
1073065943 10:100759247-100759269 AAGGAGAAAGGGGAAGAGGAAGG + Intronic
1073866498 10:107810371-107810393 TAAGAGAAGATGAGAGAGGAAGG - Intergenic
1075554313 10:123419161-123419183 GAGGAGAAGAGAAGAGAGGAGGG - Intergenic
1075942368 10:126402014-126402036 TAGGAGATGGGGAAATAGGTGGG + Intergenic
1076372582 10:129964762-129964784 AAGGAGAAGTGGGAAGAGGCAGG + Intergenic
1076732848 10:132446971-132446993 TGGGAGAAGCGGGAGGAGGAGGG + Intronic
1076732852 10:132446983-132447005 GAGGAGGAGGGGCAAGAGGAGGG + Intronic
1077398201 11:2336992-2337014 TAGGGGAAGGGGAAGGAGAAGGG + Intergenic
1077440074 11:2564244-2564266 TAGGAGAAGGGCAATGGGGATGG - Intronic
1077531305 11:3096925-3096947 GAGGAGGAGAGGAAAGAGGGAGG + Intronic
1078001410 11:7499680-7499702 TAGGAGAAGCAGAAGGAACATGG + Intronic
1078277494 11:9864060-9864082 TAGCAGGAGCAGAAAGAGAATGG + Intronic
1078340755 11:10496648-10496670 TGGGAGAGGAGGACAGAGGAGGG + Intronic
1079387319 11:19992084-19992106 TAGGAGAAGAGGAAAGGGGATGG - Intronic
1079660910 11:23035552-23035574 AAGGGGAGGTGGAAAGAGGATGG - Intergenic
1079689243 11:23401747-23401769 TAGGAGAAGCAAAACTAGGATGG - Intergenic
1079788739 11:24709477-24709499 AAGGAGAAGCTAAAAGAGAAAGG + Intronic
1079885021 11:25976731-25976753 GAGGAGAAGCAGAAAGAGAAGGG + Intergenic
1080381785 11:31779389-31779411 TGGGAGAAACGGAATTAGGAAGG + Intronic
1080683554 11:34497055-34497077 TTGAAGAATCAGAAAGAGGATGG + Intronic
1081206119 11:40277453-40277475 AAGAAGAGGGGGAAAGAGGAAGG + Intronic
1081397291 11:42601737-42601759 TAGGAGAAAAGGAAAGGGGAAGG - Intergenic
1081731717 11:45376443-45376465 GGGGAGCAGGGGAAAGAGGAGGG - Intergenic
1081747222 11:45481749-45481771 GAGGAAGAGAGGAAAGAGGAAGG - Intergenic
1082076426 11:47979614-47979636 CAGGAGAAGCCGCAAGAGAAAGG - Intergenic
1083291911 11:61695206-61695228 TGGGAGGAGGGGCAAGAGGAGGG + Intronic
1083630115 11:64091008-64091030 TAGGAGAAGGGGGAGGAGGGAGG + Intronic
1083727508 11:64636260-64636282 AAGGAGAAGGGGAGAGAGGGTGG - Intronic
1083815095 11:65128222-65128244 TAGGCCAAGTGGAAAGAGGCTGG - Exonic
1084297088 11:68219622-68219644 AAGAAGAAGAGGAGAGAGGAAGG - Intergenic
1084529275 11:69717501-69717523 GAGGAGAGGAGGGAAGAGGAGGG - Intergenic
1084949590 11:72657327-72657349 TGGGAGGAGGGGAAAGAGGAGGG + Intronic
1085401032 11:76235597-76235619 AAGGAGATGCGGAAAAAGGAAGG - Intergenic
1085409623 11:76283412-76283434 GAGGAGAAGGGGGAAGGGGAGGG + Intergenic
1086078880 11:82882122-82882144 CAGGAGGAGGAGAAAGAGGAGGG + Intronic
1086426058 11:86683323-86683345 CAGGATGAGGGGAAAGAGGAAGG + Intergenic
1087058144 11:93953264-93953286 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1087193251 11:95278774-95278796 TGAGAGAAGCAGAATGAGGAGGG + Intergenic
1087957367 11:104304946-104304968 GAGGAGAAGGGAAAAGAGAAAGG - Intergenic
1088326775 11:108608909-108608931 GAGGAAGAGAGGAAAGAGGAGGG + Intergenic
1088753577 11:112866323-112866345 TAGGAGAAGTGGAAGGAAGAGGG - Intergenic
1089097024 11:115927690-115927712 TTCGAGAAGCTGAAAGAAGATGG + Intergenic
1089231586 11:116982211-116982233 TAGGATTAGAGGAAAGTGGAGGG - Intronic
1089629142 11:119773035-119773057 CAGGGGAAGTGGAAAGAGGAGGG - Intergenic
1089710120 11:120308487-120308509 TAGGAGTAGGGGAAAGTGGCCGG + Intronic
1090029315 11:123194368-123194390 AAGGAAAAGGGGAAAGGGGAAGG - Intronic
1090055778 11:123423340-123423362 GAAGAGAAGAGGAGAGAGGAGGG - Intergenic
1090311978 11:125749064-125749086 AAGCAGCAGAGGAAAGAGGAAGG - Exonic
1090502949 11:127279675-127279697 GAGGAGGAGGGGGAAGAGGAGGG - Intergenic
1090537149 11:127655568-127655590 TAGGACAATAGGAAAGAGGTTGG + Intergenic
1090647937 11:128780924-128780946 TAGGAGAATCTCAAAGAGAATGG + Intronic
1091271849 11:134319779-134319801 TAGGAGTAGGGGAAAGGAGAGGG + Intergenic
1091283687 11:134396503-134396525 TAGCAGAGGCAGAAAGAGGCTGG - Intronic
1091337143 11:134780705-134780727 GAGAAGAAGGAGAAAGAGGAGGG - Intergenic
1091603082 12:1929782-1929804 TAGGAGAAGGAGGAAGAAGAGGG + Intergenic
1091985143 12:4904845-4904867 TAGGAGAATTGGAAAGTGAAAGG - Intergenic
1092545457 12:9448042-9448064 GAGGAGCAGCGGGACGAGGAAGG - Intergenic
1092906771 12:13107460-13107482 TATGAGAAGCTGAGGGAGGATGG + Intronic
1092944734 12:13442176-13442198 AGGGAGAAGTGGAAAGAGAAGGG - Intergenic
1093206822 12:16261223-16261245 AATGAGAAGGGGTAAGAGGAAGG - Intronic
1094507495 12:31074009-31074031 GAGGAGCAGCGGGACGAGGAAGG + Intronic
1094523699 12:31218390-31218412 AAGGACAAGGGGAAAGGGGAAGG + Intergenic
1094655265 12:32413521-32413543 TAAGAGAAGCGTTCAGAGGAAGG + Intronic
1094696833 12:32827990-32828012 TAGGAGAAGTAGAGTGAGGAAGG + Intronic
1094872318 12:34605264-34605286 CAGGAGAAGCGTAAAGCGGCAGG + Intergenic
1095085292 12:38053437-38053459 TAGGGGAAGGGGAGAGAAGACGG + Intergenic
1095154971 12:38841857-38841879 AGGGAGAAGCAGAAAGATGAAGG + Intronic
1095243362 12:39887620-39887642 TAGAAGAAGCTGTAAGAAGAAGG - Intronic
1095404180 12:41849481-41849503 TGGGAGAAGGGGAAAGATAAAGG - Intergenic
1096152424 12:49323056-49323078 TGGGAGGCGGGGAAAGAGGAAGG - Intergenic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1097587912 12:61536949-61536971 TAGGAGAAGATGGGAGAGGACGG - Intergenic
1097616641 12:61891682-61891704 TAGGAGGAGGAGAAGGAGGAGGG + Intronic
1098070413 12:66668538-66668560 GAGGAGGAGGGGAAGGAGGAAGG + Intronic
1098572498 12:72004714-72004736 TAGCAAAAGCAGAAAGAAGATGG + Intronic
1098603188 12:72358288-72358310 GAGGAGGAGAAGAAAGAGGAGGG - Intronic
1101909973 12:108854023-108854045 AAGGAGAAGTGGAAAGAGCAGGG + Intronic
1102268080 12:111506190-111506212 TGGGAGTAGGGGAAAGAGAAGGG + Intronic
1102509442 12:113404092-113404114 AAGGGGAAGTGGAAAGAGGGAGG - Intronic
1102681181 12:114691800-114691822 TAGAGGAAGGGGAATGAGGAAGG + Intergenic
1102852820 12:116266274-116266296 AAGGAGGAGAGGAAAGAGAAGGG + Intronic
1102974978 12:117200190-117200212 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
1103151046 12:118639055-118639077 TAGAAGTAGCGGTAAGAGGTTGG + Intergenic
1103163230 12:118748459-118748481 GAGGAGGAGAAGAAAGAGGAGGG + Intergenic
1103449478 12:121018381-121018403 TAGCAGAAGCGGGAAGAGAGCGG - Intergenic
1103793819 12:123490037-123490059 CAGGAGAAGGAGAAAGGGGATGG - Intronic
1104616356 12:130273306-130273328 GAGGAGGAGAGGAAGGAGGAGGG - Intergenic
1105309010 13:19189871-19189893 AATGAGAAGGGGAAAAAGGAAGG - Intergenic
1105528594 13:21198276-21198298 AATGAGAAGGGGAAAAAGGAAGG + Intergenic
1105711245 13:23011441-23011463 TAGAAGAAGCAGGAAAAGGAGGG + Intergenic
1105967724 13:25399723-25399745 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1105967745 13:25399850-25399872 AAGAAGAAGATGAAAGAGGAGGG - Intronic
1105984359 13:25550645-25550667 AAGGAGAAACGGAAGGAGAATGG - Intronic
1106151398 13:27106757-27106779 TAGGAGAAGAGGAAAAATAATGG + Intronic
1106243061 13:27925387-27925409 GAGGAGGAGGAGAAAGAGGAGGG - Exonic
1106358477 13:29007614-29007636 GAGGAGGAGGAGAAAGAGGAGGG - Intronic
1106576963 13:30983664-30983686 TAAGCGCAGGGGAAAGAGGAGGG - Intergenic
1107253925 13:38400093-38400115 TAGGTGTAGCGGAAACTGGAAGG - Intergenic
1107576149 13:41724896-41724918 TAGGAGAACAGGAAAGTGAAAGG + Intronic
1107889425 13:44901339-44901361 GAGGAGAAGGGGAAAGAGAATGG + Intergenic
1108100928 13:46954165-46954187 TAGAAAAAGTGGAAAGAGCATGG - Intergenic
1108952391 13:56111537-56111559 TAGCAGAGGCTGAAAGAGGTAGG - Intergenic
1108996678 13:56743193-56743215 TGTGAGAAGTGGAAAGAGGATGG - Intergenic
1109344245 13:61095766-61095788 CAGAAGAAGCTGAAAGAGGCTGG - Intergenic
1109636462 13:65124452-65124474 AAGGGGAAGAGGAAACAGGAGGG - Intergenic
1109757119 13:66775529-66775551 GAGGAGGAGAAGAAAGAGGAGGG - Intronic
1110328745 13:74247469-74247491 TAGGTGAAGAAGAAAGATGAAGG + Intergenic
1110356327 13:74571952-74571974 TAAGAGAAGCAGAAAGATGCAGG + Intergenic
1112118059 13:96379069-96379091 GTGGAGAAATGGAAAGAGGATGG - Intronic
1112164729 13:96906148-96906170 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1112204039 13:97306424-97306446 TTGAAGAAGAGGAAAGAAGATGG - Intronic
1112500774 13:99941353-99941375 TAAGTGAAGCTGGAAGAGGAGGG - Intergenic
1112542282 13:100326671-100326693 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
1112622633 13:101067272-101067294 GAGGAGGAGGGGGAAGAGGAGGG + Intronic
1112765482 13:102737525-102737547 CAGGAGCAAGGGAAAGAGGACGG - Exonic
1112884510 13:104152082-104152104 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1113163936 13:107416428-107416450 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
1113166272 13:107447149-107447171 AAGGAGAAGAGGAAGGAGGAAGG - Intronic
1113930258 13:113964618-113964640 GATGAGAAGGGGGAAGAGGAGGG - Intergenic
1114042384 14:18691141-18691163 TAGGAGAAGCTGTAGGAAGACGG - Intergenic
1114353515 14:21881427-21881449 AAGGAAAAAAGGAAAGAGGAGGG - Intergenic
1114483579 14:23049575-23049597 GAGGAGAAGGGGACAGAGGCAGG + Intronic
1114928677 14:27438608-27438630 TAGGAGGAGCTGAAAGAGACAGG + Intergenic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115815567 14:37160957-37160979 GAGGAGGAGGAGAAAGAGGAAGG + Intronic
1116023795 14:39491937-39491959 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1116073437 14:40080018-40080040 TAGGAGAGTGAGAAAGAGGAGGG - Intergenic
1116255843 14:42554258-42554280 GAGGAGAAGAAGAAAGAGGAAGG + Intergenic
1116675367 14:47899981-47900003 ATGGAGAAGCGGAAAAAGGCGGG + Intergenic
1117069442 14:52043474-52043496 GGGGAGAAGGGGACAGAGGAGGG + Intronic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1118117940 14:62802603-62802625 TAAGTGAAAAGGAAAGAGGAAGG + Intronic
1118394082 14:65321006-65321028 GAGGAGGAGCGGGAGGAGGATGG + Intergenic
1118680034 14:68231431-68231453 TAGGGGAAAAGGAAAAAGGAGGG - Intronic
1119745083 14:77038303-77038325 TAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1119977071 14:79037085-79037107 TCTGAGAAGAGGAAAGAGGAAGG + Intronic
1120448972 14:84641590-84641612 TGGGAGAAGGGGGAAAAGGAAGG - Intergenic
1121166883 14:91810352-91810374 AAGGAGAAAGGGAAGGAGGAAGG + Intronic
1121455289 14:94034913-94034935 TAGGAAAATGGGAAAGAGGTAGG + Intronic
1121488159 14:94336347-94336369 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
1121546688 14:94768519-94768541 CCGGAGAAGAGGGAAGAGGAAGG - Exonic
1121734944 14:96211666-96211688 AAGGAGGAGCGGGAGGAGGAGGG - Intronic
1121777056 14:96598081-96598103 AGGGAGAAGGGGGAAGAGGAGGG - Intergenic
1122038161 14:98963298-98963320 AAGGAGAAGGAGAAAGAAGAAGG + Intergenic
1122610923 14:102983022-102983044 GAGGAAAAGAGGAAACAGGATGG + Intronic
1123188995 14:106549998-106550020 CAGGAGAACAGCAAAGAGGAAGG - Intergenic
1124359113 15:29021787-29021809 TAGGGGAAGTGGAAAGATGCTGG - Intronic
1125492104 15:40155898-40155920 TAGGGGAACTTGAAAGAGGATGG - Intergenic
1126047874 15:44660776-44660798 AAAGGGAAGCGGGAAGAGGAGGG - Intronic
1126129302 15:45325021-45325043 TAGGAGAAGGAGAAGGAGAAAGG - Intergenic
1126193443 15:45903541-45903563 AAGGAGAAGAGGAGAAAGGAAGG - Intergenic
1126932644 15:53671966-53671988 GGGGAGAAGGGGAAAGAGGGAGG + Intronic
1126966703 15:54062345-54062367 TAGGAGAATCACACAGAGGATGG - Intronic
1127142698 15:55993623-55993645 GAGGAGAAGCGGGAGGAGGCGGG + Intronic
1127391942 15:58512764-58512786 TAGGAGGCGGGGAAAGGGGATGG + Intronic
1127392954 15:58521662-58521684 TAGGAGGGGAAGAAAGAGGAAGG + Intronic
1128095659 15:64952737-64952759 GAGGAGAAGAGGAAAGAAGGAGG - Intronic
1128095748 15:64953691-64953713 AAGGAGAAGAAGAAAGAAGAAGG - Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128678798 15:69631327-69631349 TGGGAGCAGAGCAAAGAGGAGGG + Intergenic
1128713276 15:69887897-69887919 CAGGAGAAAAGGAAGGAGGAAGG + Intergenic
1128815093 15:70602409-70602431 TGGGAGAAGGGGACAGAGGGTGG - Intergenic
1129255065 15:74329796-74329818 TAGAAGATGGGGAAGGAGGAGGG + Intronic
1130321853 15:82848526-82848548 TAGGAGAAACTGAAAAAGGCAGG + Intronic
1130655868 15:85791902-85791924 CAGGAGCAGTGGAAAGAGCATGG - Intronic
1130794422 15:87193794-87193816 AATGAGAAGAGGAAACAGGAAGG - Intergenic
1130959867 15:88652484-88652506 AAGGAGGAGGGGAAGGAGGAGGG - Intronic
1130959872 15:88652496-88652518 AAGGAGGAGGGGAAGGAGGAGGG - Intronic
1131059490 15:89395862-89395884 TAGGAGGGGGAGAAAGAGGAGGG - Intergenic
1131106673 15:89739449-89739471 TAGGGAGAGTGGAAAGAGGAAGG - Intronic
1132406290 15:101543381-101543403 CAAGGGAAGCGGAAGGAGGAAGG - Intergenic
1132491538 16:234579-234601 GAGAAGGAGGGGAAAGAGGACGG + Exonic
1132872284 16:2121068-2121090 AAGGAGAAGGGGAAAGAGCCGGG + Intronic
1133030535 16:3008735-3008757 TAGGAGAGGCTGGAAGAGGGTGG - Intergenic
1133194424 16:4158832-4158854 AAGGAGGAGAAGAAAGAGGAAGG + Intergenic
1133520221 16:6549363-6549385 GAGGAGGAGGGGAAAAAGGAGGG + Intronic
1133802041 16:9092045-9092067 ATGGAGGAGCGGAAGGAGGAGGG + Exonic
1133928957 16:10216653-10216675 TAGAAGAAGGGGAAGGGGGAGGG + Intergenic
1134295235 16:12939686-12939708 CAGGTGATGGGGAAAGAGGAAGG - Intronic
1134297570 16:12960772-12960794 TTGGAGAGGAGGGAAGAGGACGG - Intronic
1134551333 16:15140147-15140169 AAGGAGAAGGGGAAAGAGCCGGG + Intergenic
1134770602 16:16806044-16806066 AAGGAGAAGGGGGAAGGGGAAGG - Intergenic
1134850928 16:17478295-17478317 TAGGACAAGGGGAAACAGGCTGG + Intergenic
1134904840 16:17971506-17971528 AAGGGGAAGAGGAAAGAAGATGG + Intergenic
1135186103 16:20317050-20317072 AAGGGGAAGGGGAAAGAGAACGG - Intronic
1135295730 16:21278009-21278031 AAGGAGGAGCAGGAAGAGGAGGG - Intronic
1135414188 16:22256676-22256698 TCTGAGAAGCGGCAAGGGGAGGG - Intronic
1135959643 16:26985013-26985035 TAGGGGAAGGGGGAAGAGGGAGG - Intergenic
1136567504 16:31079064-31079086 GAGGAGGAGGGGGAAGAGGAAGG + Exonic
1136598422 16:31267397-31267419 TAAGAGAAGGGGAAAGTGGAGGG - Intronic
1136670168 16:31849456-31849478 TAGGGGAAGGGGAAAGAGAGGGG + Intergenic
1137483408 16:48871332-48871354 CTGGAGAAGAGGAAAGAGGAAGG + Intergenic
1137557035 16:49477251-49477273 GAGGAGGAGGGGAAGGAGGAGGG + Intergenic
1137557046 16:49477275-49477297 GAGGAGGAGGGGAAGGAGGAGGG + Intergenic
1139060948 16:63250702-63250724 GAGGGGAAGGGGAAGGAGGAGGG + Intergenic
1139597476 16:67966808-67966830 TAAGAGGAGGAGAAAGAGGAAGG + Intronic
1139640817 16:68290280-68290302 AAGGAGAATAGGAAAGAGGAAGG - Intronic
1140026391 16:71293982-71294004 GAGCAGAAGAGGAAAGGGGAGGG + Intergenic
1140199781 16:72885751-72885773 GAGGAGAAGAGGAAAGGAGAAGG + Intronic
1140213698 16:72990590-72990612 GAGGAGAACTGGAAAGAAGAGGG - Intronic
1140896032 16:79325022-79325044 TAAGAGAAGGGGAGAGAAGAAGG - Intergenic
1140973203 16:80033349-80033371 GAGAAAAAGGGGAAAGAGGAAGG + Intergenic
1141007136 16:80363136-80363158 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
1141514594 16:84535193-84535215 AAGGAGAAGGAGGAAGAGGAGGG - Intronic
1141535267 16:84674942-84674964 GAGGAGAAGAAGGAAGAGGAGGG - Intergenic
1141621313 16:85238042-85238064 TAGGGGCAGTGGAGAGAGGAGGG + Intergenic
1141738367 16:85871540-85871562 GAGGAGGGGAGGAAAGAGGAGGG - Intergenic
1141738372 16:85871555-85871577 GAGGAGGGGAGGAAAGAGGAGGG - Intergenic
1141847578 16:86621501-86621523 TAGGAGAAAGGGAAAGAGGAAGG - Intergenic
1141908304 16:87041853-87041875 AAGGAGAAGTGGAATTAGGAGGG - Intergenic
1142755753 17:2015490-2015512 TTGGAGAGGTGGCAAGAGGAGGG + Intronic
1143174138 17:4947175-4947197 AAGCAGAAGCGGAGAGGGGAAGG + Intronic
1143391349 17:6561031-6561053 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143391364 17:6561092-6561114 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143391375 17:6561128-6561150 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1143391467 17:6561436-6561458 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143727522 17:8859632-8859654 TAGGAGAAGAGGGAGGAGGAAGG + Intronic
1143740004 17:8945493-8945515 TAGCAGCAGTGGGAAGAGGAAGG + Intronic
1144050002 17:11490340-11490362 TAAGAGAAGAGGAAAAATGAAGG + Intronic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144178934 17:12734066-12734088 TAAGAGAAGGGGAGAGAGGGTGG - Intronic
1144499727 17:15775539-15775561 AAGGAGAAAGGGAAGGAGGAAGG - Intergenic
1144580453 17:16456128-16456150 TAGGAGGAGGAGGAAGAGGAGGG + Intronic
1145247858 17:21281399-21281421 TAGAGGAAGAAGAAAGAGGAAGG + Intergenic
1145262360 17:21361970-21361992 TGGTAGAAGAAGAAAGAGGAGGG - Intergenic
1146502113 17:33373040-33373062 TAGGATAAGCAGAAAGGGAATGG + Intronic
1146637284 17:34515733-34515755 AAAGAGAAGCTGAAAGAGAAAGG - Intergenic
1147260749 17:39208708-39208730 AGGGAGATGCAGAAAGAGGAGGG - Intergenic
1147343946 17:39774375-39774397 GAGGAGAGGAGGGAAGAGGAGGG + Intronic
1147754180 17:42757355-42757377 AAGGGGAAGGGGAAAAAGGAAGG - Intergenic
1147856488 17:43484224-43484246 TGAGGGAAGCGGAAGGAGGAAGG + Intronic
1147943550 17:44066857-44066879 AATGAAAAGGGGAAAGAGGAGGG + Intronic
1148052758 17:44777186-44777208 TACGAGAAGCTGAATGTGGAGGG + Exonic
1148462197 17:47845285-47845307 GTGGAGAGGGGGAAAGAGGAAGG - Exonic
1148785798 17:50145680-50145702 GAGGAGGAGGGGAGAGAGGATGG + Intronic
1148787448 17:50152225-50152247 TAGGAAAAGGAGGAAGAGGATGG - Intergenic
1148901899 17:50884788-50884810 GGGGAGAGGTGGAAAGAGGAAGG - Intergenic
1149028472 17:52057311-52057333 GAGGAGGAGGGAAAAGAGGAAGG - Intronic
1149114164 17:53071726-53071748 AAGGAGAAGAAGAAAAAGGAGGG + Intergenic
1149470962 17:56914570-56914592 TCCGGGAAGAGGAAAGAGGAAGG - Intergenic
1150054982 17:62006308-62006330 AAGGAGAAGGGGAGACAGGAAGG + Intronic
1150606402 17:66694999-66695021 TAGGGGAAGGGGAAAGGTGAGGG + Intronic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1151153138 17:72105034-72105056 CAGGAGAAGCGGATGGCGGATGG - Intergenic
1151999859 17:77638462-77638484 TAGGAGAGACGGAAAGAAGTGGG + Intergenic
1152293999 17:79456236-79456258 TAGGAGAAGAGGACAGAGCAAGG - Intronic
1152396648 17:80036929-80036951 TTGGAGTAGGGGAAAGAGGGAGG - Intronic
1152424766 17:80212892-80212914 TATAAGAAGCGGAAACAGGCCGG + Intronic
1153919878 18:9779033-9779055 GAGGAGGAGCAGGAAGAGGAGGG + Intronic
1154299277 18:13178795-13178817 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1154496907 18:14968098-14968120 TAGGAGAAACAGGAAGATGATGG - Intergenic
1155106589 18:22672825-22672847 GAGGAGGAGGGGAAAGAGTAGGG - Intergenic
1155403166 18:25460525-25460547 TTGCAGAAGCAGAAAGAGAATGG + Intergenic
1155506711 18:26540581-26540603 TAGGAGGTGGGGGAAGAGGAGGG - Intronic
1155759054 18:29541369-29541391 GAGGAGAGGGAGAAAGAGGAAGG - Intergenic
1155789358 18:29946165-29946187 TAGGCTGAGGGGAAAGAGGAAGG + Intergenic
1155844307 18:30686355-30686377 GAGGAAAAGAAGAAAGAGGAGGG + Intergenic
1156060906 18:33075009-33075031 TGTGAGAAGGTGAAAGAGGATGG + Intronic
1156063713 18:33114802-33114824 TAGGAGAAGTGAGAAGTGGAGGG + Intronic
1156419494 18:36935306-36935328 AAGGAGAAGAGGAAAAAGGGAGG - Intronic
1156491374 18:37498403-37498425 GGGGAGAAGAGGGAAGAGGAGGG - Intronic
1156659341 18:39328221-39328243 TAAGAGGAGATGAAAGAGGAAGG - Intergenic
1157277359 18:46320994-46321016 TAGGAGAAGGGGAGAGAGCTGGG + Intergenic
1157686893 18:49650143-49650165 TAGGGGAAGAGGGAAGGGGAAGG + Intergenic
1158125513 18:54095860-54095882 GAGGAGAAGGGGAAAGGAGAGGG + Intergenic
1158349324 18:56549125-56549147 TAGGAGAAGCGGGTGGAGGATGG + Intergenic
1158672873 18:59492527-59492549 AAGGAGAAGGGGAAGGAGGGAGG - Intronic
1159637177 18:70819450-70819472 TGGGAAAAAAGGAAAGAGGAAGG + Intergenic
1159933083 18:74334305-74334327 AAGCAGAAGGGGAAAGAGGAAGG + Intronic
1160174569 18:76582189-76582211 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1160224660 18:77002816-77002838 TAGGAGAAAGGGAAAAGGGAAGG + Intronic
1160597017 18:79982758-79982780 TAGGAGAGGCTGAAAGAGGCAGG + Intronic
1160611204 18:80086793-80086815 TAGGAGAAGCAGGATGGGGAGGG - Intronic
1161659088 19:5535034-5535056 GAGGAGGAGAGGAGAGAGGATGG - Intergenic
1161756658 19:6138743-6138765 TAGGAGAATGGGAAAAAGGAAGG + Intronic
1161803532 19:6429462-6429484 GAGGAGGAGAGGAAAGAGGAGGG + Intronic
1161918737 19:7250346-7250368 AGGGAGAAAGGGAAAGAGGAAGG + Intronic
1162319220 19:9960883-9960905 TAGGAGAACTGGTGAGAGGAGGG + Exonic
1162746721 19:12802660-12802682 AAGGAGAAATGGAAAGAGGTCGG + Intronic
1162888301 19:13712944-13712966 TTTGAGAAGCTGAAAGAGGAGGG + Intergenic
1163105766 19:15122369-15122391 GAGGAGAAGAGGAAGGAAGAGGG + Intronic
1163124154 19:15235458-15235480 TGGGAGAAGCGGGGAGATGAGGG - Intergenic
1163453993 19:17395241-17395263 AAGGAGAAACAGGAAGAGGAGGG - Intergenic
1163884648 19:19955107-19955129 AAGGAGAAGGGGAAAGAAGAAGG + Intergenic
1164292689 19:23881819-23881841 TAAGAGAAGGAGGAAGAGGAGGG + Intergenic
1164324522 19:24180078-24180100 TAGGAGGAGGGAAAAGAAGAAGG + Intergenic
1164535601 19:29084558-29084580 AAGAAGTAGCTGAAAGAGGAAGG + Intergenic
1164581719 19:29439028-29439050 AAGGAGAAGGGGAAGGAGGGAGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166297608 19:41896692-41896714 AAGGAGCAGAGGAAAAAGGAAGG - Intronic
1166332954 19:42089241-42089263 AAGGAGGAGAGGAGAGAGGAAGG + Intronic
1166652136 19:44582660-44582682 AAGGAGAAGGGGAAAGGGAAGGG + Intergenic
1166886632 19:45965223-45965245 TTGAAGAAGCAGAGAGAGGACGG - Intronic
1166932171 19:46308141-46308163 TTGGAGCAGGGGAATGAGGATGG + Intronic
1167112815 19:47471937-47471959 GAGGAGAAGAGGAGAGGGGAGGG + Exonic
1167409487 19:49336663-49336685 GAGGAGGAGCTGAAGGAGGAAGG + Intronic
1167509437 19:49888387-49888409 TGAGAGAAGCGAAAAGCGGAAGG - Intronic
1167622887 19:50568705-50568727 GAGGAGCAGGGGAGAGAGGAGGG + Intergenic
1168454579 19:56496453-56496475 TTGGAGAAACTGAAAGGGGAAGG + Intergenic
1168509263 19:56961527-56961549 GAGGGGAGGGGGAAAGAGGAGGG - Intergenic
925852963 2:8101040-8101062 TTGAAGAAGCAGAAAGAGCAAGG - Intergenic
925940436 2:8811949-8811971 TAAGAGAAGGGGAAAAAGGAAGG + Intronic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926702000 2:15810065-15810087 GAGGGCAAGAGGAAAGAGGAGGG - Intergenic
927107678 2:19841953-19841975 GAGAAGAAGAGGAAAAAGGAGGG + Intergenic
927242535 2:20931318-20931340 TATGAGATGAGGAAAGAGGAGGG - Intergenic
928180324 2:29064115-29064137 AAGGAGGAGAGGACAGAGGACGG + Exonic
928199242 2:29236675-29236697 TAGGAGAGGATGCAAGAGGATGG - Intronic
928202483 2:29257181-29257203 TGAGAGAAGAGGAAAGAGGCAGG - Intronic
929175001 2:38967300-38967322 CTGGAGAAGGGGGAAGAGGAAGG + Intronic
929385702 2:41403699-41403721 GAGAGGAAGGGGAAAGAGGATGG + Intergenic
929681681 2:43998247-43998269 TAGGAGTAGAGGAAGGAGCAGGG + Intergenic
930349094 2:50226509-50226531 GAGGAGAAGCACAAGGAGGAGGG + Intronic
931332300 2:61300301-61300323 AAGGAGAATGGGGAAGAGGATGG - Intronic
931543873 2:63359078-63359100 GAGGGAAAGTGGAAAGAGGAAGG - Intronic
932147806 2:69339127-69339149 TTTGAGAAGTGGAAAGAGCATGG + Intronic
932402223 2:71488958-71488980 GAGGAGCAGCTGAAGGAGGAAGG - Intronic
932752031 2:74377371-74377393 GAGGGGAAGGAGAAAGAGGAGGG - Intronic
932918925 2:75887571-75887593 TGGCAGCAGAGGAAAGAGGAGGG - Intergenic
933292337 2:80451923-80451945 TAAGATAAGCATAAAGAGGAGGG + Intronic
933335595 2:80954609-80954631 TAGGAGGTGGGGAAAGAGGCAGG + Intergenic
933769673 2:85735041-85735063 AAGGAGAAGAGGGAACAGGAAGG + Intergenic
934652360 2:96099861-96099883 TAGGAGGAAGGGGAAGAGGAAGG + Intergenic
934977745 2:98816708-98816730 GAGGAGCAGAGGAAAGAGGCAGG + Intronic
935082113 2:99808164-99808186 TAGGAAAGGTGGAAAGAGGGAGG - Intronic
935089213 2:99878144-99878166 AACAAGAAGCGGAAAGAGGAAGG + Intronic
935684760 2:105673480-105673502 AAAGTGAAGCGGAAAGTGGATGG - Intergenic
936563142 2:113559534-113559556 TGGCAGGAGCGGAAAGAGGAGGG - Intergenic
936916393 2:117643153-117643175 AAGGAGAATCGGAAAGATAATGG + Intergenic
936977236 2:118232376-118232398 AAGGAGAAGAGGAAGGAAGAGGG - Intergenic
937057493 2:118952028-118952050 TAGGGGAAGGGGAAGGAGAAGGG - Intronic
937169583 2:119852196-119852218 AAGGAGAAGCGGAAAAAAGAAGG - Intronic
937284468 2:120741483-120741505 AAGGAGAAGGGGAGAGAGAACGG - Intronic
937436426 2:121885547-121885569 TTGGAGAGGAGGAAAGAGAAAGG - Intergenic
937528390 2:122798986-122799008 GAGGGGAAGGAGAAAGAGGAGGG - Intergenic
937573936 2:123396241-123396263 TGGGAGGAGTGGGAAGAGGAGGG - Intergenic
938162958 2:129002917-129002939 TCTCACAAGCGGAAAGAGGATGG - Intergenic
939097345 2:137849045-137849067 TAGGAAAAAGGAAAAGAGGAAGG + Intergenic
939773940 2:146360976-146360998 GAGGAGAAGAGGAAAAAGGAGGG + Intergenic
939794908 2:146630780-146630802 TAGGGGAAGGGGAAAGAGTTGGG + Intergenic
941038216 2:160590564-160590586 AAGGGGAAGGGGGAAGAGGAAGG - Intergenic
941038226 2:160590594-160590616 GAGGAGAAGGGGAAGGGGGAGGG - Intergenic
941503272 2:166308453-166308475 CAGGAGAGGGAGAAAGAGGAGGG - Intronic
941591148 2:167422123-167422145 GAGGAGAAGGGGGAGGAGGAGGG + Intergenic
941695590 2:168547848-168547870 TAGTAGAAGCGGAATGAAGATGG + Intronic
941947763 2:171118958-171118980 TAGAAGAAGTAGACAGAGGAAGG - Intronic
941959733 2:171241746-171241768 TAGTAGAAGAGAAAAAAGGAGGG - Intergenic
942746610 2:179241359-179241381 TGAATGAAGCGGAAAGAGGAGGG + Intronic
943291314 2:186075562-186075584 AAGGAGAAGGAGGAAGAGGAGGG - Intergenic
943532666 2:189103884-189103906 TAGGAGGAAGGGAAGGAGGAAGG - Intronic
943696531 2:190941717-190941739 TTTGAGAAGGGGAAAGAAGAAGG + Intronic
944119257 2:196223449-196223471 GAGGAGAAGGGGAAAGAGAAAGG + Intronic
944253332 2:197599499-197599521 TGTGAGAAGGAGAAAGAGGAAGG + Intronic
944943929 2:204661193-204661215 TTTGAGATGGGGAAAGAGGAAGG - Intronic
945335657 2:208589826-208589848 TTGGATAAGAGAAAAGAGGACGG + Intronic
945590918 2:211730456-211730478 GAGGAGATAGGGAAAGAGGAAGG - Intronic
945834510 2:214822774-214822796 GAGGAAGAGAGGAAAGAGGATGG + Intergenic
945988768 2:216375650-216375672 TAGGAGAGGTGGGAAGAGGGGGG + Intergenic
946528533 2:220546585-220546607 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
947275999 2:228393015-228393037 TACTAGAAGGGGAGAGAGGAAGG - Intergenic
947536485 2:230943037-230943059 GACGAGAAGAGGAGAGAGGAGGG + Intronic
948344339 2:237282679-237282701 AAGGAGAAGGGGAAGGGGGAGGG + Intergenic
948577573 2:238964639-238964661 GAGGAGAAACGCAGAGAGGAAGG + Intergenic
948721868 2:239905783-239905805 AAGAAGAAGCGGGGAGAGGAGGG + Intronic
948805820 2:240453188-240453210 CAGGAGGGGCGGAAAGGGGATGG - Intronic
1169213433 20:3779891-3779913 GTGGAGATGCGGAAAGGGGAAGG + Intronic
1169419580 20:5449145-5449167 AAGGAGAAGGGGAAACAGGGAGG - Intergenic
1170041580 20:12045216-12045238 TAGGAGGGGAGGGAAGAGGAGGG - Intergenic
1170598539 20:17823420-17823442 TAGGAGGAGAGGAAAGAGTTGGG + Intergenic
1171030076 20:21669185-21669207 CAGGAGAAGCAGAGAAAGGAGGG - Intergenic
1172217673 20:33247904-33247926 TATGAGAAGAGGGTAGAGGATGG - Intergenic
1172228935 20:33323965-33323987 TAGAAGAAGGGGAAAGGGGCGGG + Intergenic
1172971280 20:38874678-38874700 TGGCAGAAGAGGAAACAGGAAGG + Intronic
1173437184 20:43043918-43043940 TGGGATAAGCAGACAGAGGAAGG - Intronic
1174727969 20:52884371-52884393 TAGGAAAAGAGAAAAAAGGAAGG - Intergenic
1175211084 20:57355771-57355793 TAGGAGAACAGGAGGGAGGATGG + Intronic
1175452084 20:59077886-59077908 AAGGAGAAGGAGAAAAAGGAGGG + Intergenic
1175494460 20:59404066-59404088 TACGAGAAGAGGAGAAAGGAAGG - Intergenic
1175657827 20:60787099-60787121 GAGGAGGAGGGGGAAGAGGAAGG - Intergenic
1176275597 20:64265707-64265729 AAGGAGAAGGGGAAGGAAGAGGG - Intronic
1176998817 21:15587104-15587126 GAGGAGAAGGGGCAAGGGGAAGG - Intergenic
1177303357 21:19280335-19280357 TAGGAGAAAGGGATAGAGGAAGG + Intergenic
1178005962 21:28219804-28219826 TTGGGGAAGAGGAATGAGGATGG - Intergenic
1178225363 21:30710904-30710926 GAGGAGGAGAGGAAAGAGGAGGG + Intergenic
1178906700 21:36642614-36642636 CAGGGGAAGGGGAAAGAGTATGG + Intergenic
1179024846 21:37671392-37671414 TGGGAGAAGAGGCAAGAAGAGGG - Intronic
1179084849 21:38207579-38207601 GAGGAGAGGAGAAAAGAGGAGGG - Intronic
1179340521 21:40504160-40504182 GAAGAGAAGAGGAAAGAAGAGGG + Intronic
1179582718 21:42353595-42353617 AAGGATAAACAGAAAGAGGAGGG - Intergenic
1179893176 21:44347918-44347940 TAGGAGAAGGGGGAGGAGGAGGG + Intergenic
1180304719 22:11065345-11065367 TGGGAGAAGGGTAAAGAGGGTGG - Intergenic
1180626870 22:17199425-17199447 GAGGGGAAGAGGATAGAGGAGGG - Intronic
1180981334 22:19879508-19879530 TGGAAGAAGCTGGAAGAGGATGG + Intronic
1181893074 22:26081816-26081838 CAGGATAAGCGTGAAGAGGAAGG + Intergenic
1182048511 22:27295766-27295788 TAGGAGAGAGGGAAGGAGGAAGG + Intergenic
1183138481 22:35913842-35913864 TAAGAAAAGGGGAATGAGGAAGG + Intronic
1183266199 22:36827339-36827361 GAGGAGGAGAGGAAGGAGGAAGG - Intergenic
1183286574 22:36968744-36968766 TAGGAGGAGGGGAAGAAGGAAGG - Intergenic
1184085010 22:42256097-42256119 TTGGAGAAGCCGGTAGAGGAGGG - Intronic
1184295925 22:43525541-43525563 AAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1184949929 22:47834051-47834073 TTGGAAAAGTGGCAAGAGGAAGG + Intergenic
1185243955 22:49763410-49763432 TGGGGGAAGAGGAAGGAGGAGGG + Intergenic
949233950 3:1786186-1786208 TAGGAGAAAAAGTAAGAGGATGG + Intergenic
949392741 3:3580514-3580536 TGGGGGAAGTCGAAAGAGGAAGG + Intergenic
951438519 3:22693951-22693973 TTGGAGACTCGGAAAGGGGATGG - Intergenic
951640668 3:24830741-24830763 TGAGAGAAGAGGAAAGAGGTAGG + Intergenic
951670891 3:25180754-25180776 TAGGGGAGAAGGAAAGAGGAAGG + Intronic
952330159 3:32357339-32357361 TAGAAGCAGTGGAGAGAGGAGGG - Intronic
952721886 3:36542086-36542108 GAGGAGAAGAGGAAAGGGAAGGG + Intronic
952773710 3:37024671-37024693 TAAGAGAAGGAGAAAGAGAAGGG - Intronic
953163821 3:40446325-40446347 TAGGAGATGAGGAAAGAGAAAGG + Intergenic
953527570 3:43706342-43706364 TGGGGGGAGCGGTAAGAGGAGGG + Intronic
953998322 3:47537123-47537145 TGGGAGAAGAGGAAGGAGGTGGG + Intergenic
954699781 3:52445199-52445221 AAGGAGAAGCGGCAGGTGGACGG - Intergenic
954940174 3:54364774-54364796 GCAAAGAAGCGGAAAGAGGAAGG + Intronic
956465047 3:69511731-69511753 AAGGAGAAGGGGAAGGAAGAAGG - Intronic
956788000 3:72658500-72658522 TAGGAGAAGAGGAAGGTGAATGG - Intergenic
957347856 3:78984926-78984948 TAGGAGGAGGAGAAAGAGGAGGG - Intronic
957652922 3:83032545-83032567 GATGAGAAGAGGGAAGAGGAGGG - Intergenic
957805892 3:85148871-85148893 GAGGAGGAGGAGAAAGAGGAGGG + Intronic
958075835 3:88677033-88677055 GAGGAGGAGCAGAAAAAGGAAGG - Intergenic
958997967 3:100927619-100927641 TAGGAGGAAGAGAAAGAGGAAGG + Intronic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959369061 3:105500275-105500297 AAGGAGATGAGAAAAGAGGAAGG - Intronic
959768705 3:110066902-110066924 AAGGAGCAGGAGAAAGAGGAAGG - Intergenic
959840542 3:110969478-110969500 TAGGAAAAGCCGCAAGAGGGGGG - Intergenic
959927619 3:111941504-111941526 TAGGTTAAGAGGAAAGGGGAAGG + Intronic
960096820 3:113696963-113696985 TAGGTGAATGGGAAAGAGGTGGG + Intergenic
960431879 3:117579553-117579575 AAGGAGAAGAAGAAAGAGGTCGG + Intergenic
961449815 3:126997623-126997645 CAGGAGAGGCGGAAAGGGGGCGG - Intronic
961635803 3:128331538-128331560 GAGGAGAAGGGGAGAAAGGAAGG - Intronic
961973206 3:130991962-130991984 TAGGAGAATAGGAAAGAGAATGG + Intronic
962120664 3:132556958-132556980 AAGGAGCAGAGGAAAGGGGAGGG - Intergenic
962959147 3:140293878-140293900 TAGGAAAGGTGGAAGGAGGATGG - Intronic
963179204 3:142336418-142336440 AAAGAGAAGAGGAAAAAGGAAGG + Intronic
963646996 3:147927397-147927419 TAAGGGAAGTGGAAAAAGGATGG - Intergenic
963966967 3:151382801-151382823 TAGGAGAAGTGGAAAGCTGGAGG - Intronic
964158549 3:153617309-153617331 AAGGAGAAGAGGAAGGAGGCAGG - Intergenic
964185733 3:153940507-153940529 TAGGAAAAAAGGAAACAGGAGGG - Intergenic
964833332 3:160910251-160910273 AAGGGGAAGGGGAAAGGGGAAGG - Intronic
965134570 3:164745389-164745411 TAGGAGAATGGGAGAGAGAAAGG + Intergenic
965186283 3:165468495-165468517 TTGGACAAGCAGGAAGAGGAAGG - Intergenic
965598218 3:170428610-170428632 GAGGAGAAGGGGGAAGAGAAGGG - Intronic
966370944 3:179250150-179250172 GAGGAGGAGGAGAAAGAGGAGGG + Intronic
967832563 3:193933014-193933036 GAGGAGAAGAGGGGAGAGGAGGG + Intergenic
968132413 3:196199255-196199277 TGGGCGAAGGGGAGAGAGGAGGG - Intronic
968529968 4:1086564-1086586 GAGGGGTAGGGGAAAGAGGATGG + Intronic
968994149 4:3935213-3935235 TTGGAGAAGCCGGGAGAGGAGGG + Intergenic
969323668 4:6428117-6428139 TAGGACATGCATAAAGAGGAAGG - Intronic
969621030 4:8278985-8279007 GAGGAGGGGCGGAGAGAGGAGGG - Intronic
970203771 4:13635192-13635214 TAGGAAAAGCAGAAATTGGAGGG + Intergenic
970302519 4:14696419-14696441 AAGGAGAAAGGGAAGGAGGAAGG + Intergenic
970401780 4:15724203-15724225 TAAGAGAAACACAAAGAGGAAGG - Intronic
970973791 4:22019223-22019245 AAGGAGAAGAGGAAAGAAAATGG - Intergenic
971577401 4:28293226-28293248 TTGAAGAAGCAGAAAGATGAAGG + Intergenic
971636645 4:29068717-29068739 AGGGAGAAGGGGAAAGGGGAGGG - Intergenic
972770534 4:42193209-42193231 CAGGAGAGGAGGAAAGTGGAAGG - Intergenic
973865850 4:55112244-55112266 GAGGAAAAGGGGGAAGAGGAGGG - Intronic
973919186 4:55667354-55667376 GAGGAGACAAGGAAAGAGGAAGG + Intergenic
974682897 4:65186661-65186683 GAGGAGAAGAAGGAAGAGGAAGG + Intergenic
975328580 4:73087974-73087996 AAGGAAAAGGGGAGAGAGGAAGG + Intronic
975538012 4:75472325-75472347 TAGGAGGTGGGGAGAGAGGATGG + Intergenic
975887838 4:78986246-78986268 TAGGAGAAGTGAGAAGTGGAGGG - Intergenic
976615273 4:87069631-87069653 AAGGAGAAGAGAAAAAAGGAAGG - Intronic
976957680 4:90922299-90922321 AAGGAGAAGAGGGAAGGGGAAGG + Intronic
977116026 4:93030236-93030258 CGGGAGAAAAGGAAAGAGGAAGG - Intronic
977221643 4:94344632-94344654 TGGGAGAAGAGACAAGAGGATGG - Intergenic
977884815 4:102243031-102243053 TAGGCAAAGCGGAAATAGGAAGG - Intergenic
978311119 4:107385973-107385995 TCTGAGCAGTGGAAAGAGGACGG + Intergenic
978816092 4:112907484-112907506 GAGGAGGAGGGGAAAGAAGAGGG - Intronic
979596603 4:122541661-122541683 TAGGAGAAGCCGCTAGCGGAGGG + Intergenic
979931388 4:126636026-126636048 CATGAGAAGCTGAAAGAGGAAGG - Intergenic
980017216 4:127663817-127663839 TAGGAAAAGAAAAAAGAGGAAGG + Intronic
980470808 4:133249278-133249300 TAGGTGAAGTGGAAAGAACATGG + Intergenic
981188154 4:141829931-141829953 TAGCAGAAGGAGGAAGAGGAAGG - Intergenic
981430235 4:144648759-144648781 GAGGAGAAGGGGAAGGGGGATGG + Intronic
982172822 4:152678427-152678449 TAGAAGAGGTGGAAGGAGGATGG + Intronic
982554688 4:156843972-156843994 TAGAAGAAGCAGAAATAGCAAGG - Intronic
983379832 4:166978676-166978698 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
983655966 4:170084974-170084996 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
984057798 4:174950503-174950525 TAGGAGAATGGAAAAGAGAAAGG - Intronic
984189552 4:176589019-176589041 TAGTAGAAGGAGAAAGAGGAAGG + Intergenic
984261868 4:177452323-177452345 AAGGAGAGGCGGGGAGAGGAGGG - Intergenic
984617537 4:181915644-181915666 GAGGAGAAGCAGAGAGGGGAGGG + Intergenic
984989387 4:185364239-185364261 ATGGGGGAGCGGAAAGAGGAGGG + Exonic
986482652 5:8204350-8204372 TAGCAGAAGGTGAAGGAGGAAGG - Intergenic
987032852 5:13991503-13991525 AAGGAGAAGGAGGAAGAGGAGGG + Intergenic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
987734064 5:21816170-21816192 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
987938444 5:24500901-24500923 GAGAAGAAGTGGAGAGAGGAGGG + Intronic
988106075 5:26750156-26750178 AAGGAGAAGAAAAAAGAGGAGGG - Intergenic
988169896 5:27639871-27639893 TAGGAGAAGAAGAAAGAAAAGGG - Intergenic
988841355 5:35086948-35086970 GAGAAGATGGGGAAAGAGGAAGG - Intronic
989003623 5:36786315-36786337 TATGAGAAGAGGAAAGAAGTAGG + Intergenic
989483726 5:41963725-41963747 AAGGAGGAGCAGGAAGAGGAAGG + Intergenic
989552983 5:42757284-42757306 GAGGTGAGGAGGAAAGAGGAGGG + Intronic
989563756 5:42880372-42880394 TAGGAGGAGGGGAAGGAAGATGG - Intronic
989954296 5:50338587-50338609 AAAGAGAAAAGGAAAGAGGATGG + Intergenic
990186703 5:53217963-53217985 GAGGAGAAGGGGGAAGAGGAGGG + Intergenic
990570999 5:57078773-57078795 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
991173445 5:63656302-63656324 TAGGAGACAAGCAAAGAGGAGGG - Intergenic
991288109 5:65003389-65003411 TAGGAGAAGAAGAAAGGGAAGGG - Intronic
991557668 5:67913946-67913968 TAAGAGAACAGGAAGGAGGAAGG + Intergenic
992341189 5:75825078-75825100 TAGAGTAGGCGGAAAGAGGAGGG + Intergenic
992403615 5:76434347-76434369 TTGGAGACTCAGAAAGAGGAGGG - Intronic
992466078 5:77006357-77006379 TAGGTGAAAGGGAATGAGGAGGG - Intergenic
992518495 5:77522343-77522365 TAAAAGAAACGGAAAGAGGCCGG + Intronic
992969951 5:82046169-82046191 TTGGAGAAGCAGGAAGAGGTAGG - Intronic
993033373 5:82729877-82729899 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
993065619 5:83094381-83094403 GAGGAGAAGAGGGGAGAGGAGGG - Intronic
993168465 5:84385036-84385058 CAGAAGGAGCTGAAAGAGGAGGG - Intergenic
993361508 5:86982168-86982190 CAGCAAAAGGGGAAAGAGGAAGG - Intergenic
993373362 5:87119168-87119190 AGGGAGAAGAGGAAAGCGGAGGG + Intergenic
993694751 5:91048064-91048086 TAGCAGAAGTGTAAAGAGGCAGG - Intronic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994064200 5:95517487-95517509 AAGGAGAAAGGGAAGGAGGAAGG + Intronic
994279658 5:97886186-97886208 GAGGCGAAGCGGAAAGTGAAGGG - Intergenic
994804234 5:104422531-104422553 TAGGCTAAGGAGAAAGAGGAGGG + Intergenic
995035147 5:107525709-107525731 GAGGAGAAGGAGAAAGAAGAGGG + Intronic
995118227 5:108505964-108505986 GAGGAGAGGAGGAGAGAGGAGGG - Intergenic
995288872 5:110426117-110426139 TAGAAGAAGGAGAAAGAGAAAGG - Intronic
995865563 5:116686573-116686595 TAGGAGGAGGGGATGGAGGAGGG + Intergenic
996387529 5:122925075-122925097 AAGGAGGAGAGGGAAGAGGAGGG - Intronic
996418317 5:123234001-123234023 AAGGGGAAGGGGAAAGAGAAAGG - Intergenic
996651913 5:125888473-125888495 GAGGAGAAGGGGAAAGAAGGAGG + Intergenic
997441123 5:133909223-133909245 TGGGAGAAGCGGTAAGAAGGTGG + Intergenic
997506534 5:134421993-134422015 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
998042597 5:138961898-138961920 TTGGAGAAGCTAAAAGGGGAAGG - Intronic
998535234 5:142924212-142924234 AAGGAGAGTTGGAAAGAGGAGGG - Intronic
998537806 5:142950982-142951004 AAAGAGAAAGGGAAAGAGGAAGG - Intronic
998732502 5:145096524-145096546 TGGGAGTAGGGGAAAGAGGTGGG - Intergenic
998821819 5:146064135-146064157 GAGGAGAAGGAGAAAGAGGAGGG + Intronic
999860494 5:155640510-155640532 AAGGGGAAGAGAAAAGAGGAAGG - Intergenic
1000018512 5:157299425-157299447 GAAAAGAAGCTGAAAGAGGAGGG - Intronic
1000187074 5:158869491-158869513 TTGGAGAAGAGGAAATAGGAGGG - Intronic
1000895723 5:166853282-166853304 GAGGAGAAGAGGAAAAACGATGG + Intergenic
1001040728 5:168333244-168333266 GAGGAGAAAGGGAAAGAGGCGGG - Intronic
1001594807 5:172891341-172891363 ATGGAGAAGAGGGAAGAGGATGG - Intronic
1001685303 5:173590238-173590260 AAGGAAAAGAGAAAAGAGGAAGG + Intergenic
1001791028 5:174458408-174458430 AAGGAGATGGGGAAAGAGGTGGG - Intergenic
1001791040 5:174458444-174458466 AAGGAGATGGGGAAAGAGGTGGG - Intergenic
1001887227 5:175303958-175303980 AATGAGTAGCGGAAGGAGGAAGG - Intergenic
1002663251 5:180804830-180804852 CAGGTGAAGGGGAAACAGGATGG + Intronic
1002969140 6:1996162-1996184 TAGAAGAATGAGAAAGAGGAAGG - Intronic
1003138625 6:3453811-3453833 AAGTAGAAGCAGAAAGTGGAAGG - Intronic
1003265035 6:4558195-4558217 TAGGAGAACCAGAGATAGGATGG + Intergenic
1003330983 6:5128632-5128654 TATGAGGAGGGAAAAGAGGAGGG - Intronic
1003337330 6:5186164-5186186 GAGGAGAAGGGGAAAGAGCTGGG + Intronic
1003403361 6:5809088-5809110 AAGGAGAAGGGGAAAAAGGAAGG - Intergenic
1003551306 6:7104494-7104516 GGGGAGAGGTGGAAAGAGGAGGG + Intergenic
1004266431 6:14152007-14152029 GAGGAGAAGGGGGAGGAGGAGGG - Intergenic
1004368474 6:15031865-15031887 GAGAAGAAGAAGAAAGAGGAGGG + Intergenic
1004421016 6:15469880-15469902 TAAGAAAAGAGGAAAGAGGCTGG + Intronic
1004581500 6:16958623-16958645 TAGGAGAAAGAGAAAGAAGAGGG + Intergenic
1005509224 6:26497398-26497420 TAAGAGAAGTGAAATGAGGAAGG + Intergenic
1006020652 6:31115830-31115852 TTTGAGAAGAGGAAGGAGGAAGG + Exonic
1006166929 6:32070673-32070695 TGTGAGAGGCGGAAAGAGGCTGG - Intronic
1006204692 6:32330088-32330110 TAGGACATGAGGAAAGAGAAAGG + Intronic
1006474283 6:34244828-34244850 CAGGAGAAGGAGGAAGAGGAGGG + Exonic
1006510180 6:34517231-34517253 TAGAAGGAGCGGGAAGAGGCTGG - Intronic
1007291497 6:40790750-40790772 AAGGAGAAAGGGAGAGAGGATGG + Intergenic
1007362992 6:41371984-41372006 TAGGAGATGGGGGAGGAGGATGG + Intergenic
1007626751 6:43251039-43251061 AAGGAGACAGGGAAAGAGGAAGG - Intronic
1007694910 6:43725769-43725791 TGGGAGAAGCAGAACGGGGAAGG + Intergenic
1008047984 6:46871391-46871413 TGGGAGAGGAGGAATGAGGAAGG + Intronic
1008828319 6:55726785-55726807 TGGCAGAAGGTGAAAGAGGAAGG + Intergenic
1009627082 6:66147629-66147651 TAGGGGAAGAGGAAAGAGGGAGG - Intergenic
1009635555 6:66259982-66260004 TAGGAGAAGGGGAAGGAGAGGGG + Intergenic
1010613919 6:77990493-77990515 CAGGAGAGCCGGAAAGGGGAGGG - Intergenic
1011745748 6:90406418-90406440 TAAGATCAGTGGAAAGAGGAAGG + Intergenic
1011854299 6:91669601-91669623 CAGGAGGAGCAGAAAGAAGAGGG - Intergenic
1012055068 6:94395752-94395774 AAGGAGAGGAGGAAGGAGGAGGG + Intergenic
1012680102 6:102169312-102169334 TAGGGTTAGGGGAAAGAGGAGGG + Intergenic
1013313980 6:108923914-108923936 AAGGAGGAGGGGAATGAGGAGGG - Intronic
1013313984 6:108923926-108923948 AATGAGAAGGGGAAGGAGGAGGG - Intronic
1014110872 6:117617398-117617420 TAGGGGAAGGGGAAAGAGAGGGG + Intergenic
1014841605 6:126226187-126226209 TAGGACAAGAGGAAAAAGAATGG + Intergenic
1015445577 6:133300211-133300233 GAGGAGGAGGAGAAAGAGGAGGG + Intronic
1015487401 6:133788494-133788516 TAGGAGTGGTGGAAAGAGGGAGG - Intergenic
1015857104 6:137636511-137636533 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
1016291580 6:142534066-142534088 TTGGAGAAGTGGCAAGGGGAAGG - Intergenic
1016852016 6:148630010-148630032 TGCGAGAAGGGGGAAGAGGAGGG + Intergenic
1017032498 6:150236575-150236597 GAGGAGGAGCTGAAAGCGGAGGG + Intronic
1017056516 6:150441492-150441514 TAGGAGAAGGTGGATGAGGAGGG - Intergenic
1017339633 6:153305435-153305457 TAGGGGAAGGGGAAGGAGAAGGG - Intergenic
1017551988 6:155518793-155518815 AAGGAGAAGTGGTAAGAGGAAGG - Intergenic
1019013341 6:168860923-168860945 GAGGAGAGGGAGAAAGAGGAAGG + Intergenic
1019494936 7:1333395-1333417 GAGGAGAAGGGGGAGGAGGAGGG - Intergenic
1020026813 7:4905350-4905372 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1020286212 7:6683084-6683106 TAGCAGAAAGGGAGAGAGGATGG + Intergenic
1020342795 7:7130977-7130999 AAGGGGAAGAGGAAAGAGAAGGG - Intergenic
1020800922 7:12731201-12731223 GAGGAGACGAGGAATGAGGAGGG - Intergenic
1020828136 7:13058019-13058041 GAGGAGAAGCAGAAAGAAGGAGG - Intergenic
1021414105 7:20362129-20362151 TAGGAGAAGAGTAGAGAGGGAGG - Intronic
1021432672 7:20578723-20578745 TGGGAGAAGCTGAATGAGAAAGG - Intergenic
1021456427 7:20833983-20834005 TGAGAGAAGGGGGAAGAGGAGGG + Intergenic
1021482919 7:21137354-21137376 CAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1021488012 7:21188054-21188076 TAAGAGAGGTGGAAAGACGAAGG - Intergenic
1021570607 7:22061162-22061184 TATGAGGAACGGGAAGAGGAAGG + Intergenic
1021951914 7:25783280-25783302 TAGGAGAAGCAGCAACTGGAAGG - Intergenic
1022858498 7:34340823-34340845 TAGCAGAAGGGGAAGAAGGAAGG - Intergenic
1024203888 7:47135455-47135477 GAGAAGAAAAGGAAAGAGGAAGG - Intergenic
1024431624 7:49294945-49294967 AAGGAGAATCTGAAAGAAGAAGG + Intergenic
1024630771 7:51244998-51245020 AAGGAGGTGTGGAAAGAGGAAGG - Intronic
1025860296 7:65320709-65320731 AAGGAAATGCGGAAAGAGGATGG - Intergenic
1026183828 7:68065524-68065546 CAAGAGAAGAGGAAAGAAGAAGG + Intergenic
1026205727 7:68255617-68255639 GAGGAGAAGGGGAAGGAGAAGGG - Intergenic
1026284147 7:68948375-68948397 AAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1026800617 7:73397785-73397807 AAGGAGAAGGGGGAGGAGGAGGG + Intergenic
1026800639 7:73397843-73397865 GAGGAGTAGGGGAAAGGGGAGGG + Intergenic
1026834829 7:73631738-73631760 AGGGAGAAGGGGAGAGAGGAAGG - Intergenic
1027268190 7:76505342-76505364 GAGGAGGAGGGGGAAGAGGAAGG - Intronic
1027748310 7:82107427-82107449 AGGGAGAAGCAGAGAGAGGAAGG - Intronic
1029354377 7:100040647-100040669 AAGGAGAAGGGGGAAGAGGACGG + Exonic
1029578307 7:101418845-101418867 GTGGAGAGGAGGAAAGAGGAAGG - Intronic
1029709692 7:102292952-102292974 CAGGAGCACCGGGAAGAGGAGGG - Intronic
1029835143 7:103301514-103301536 AAGGAGAAACAGAAAAAGGAAGG + Intronic
1030099336 7:105931347-105931369 GAGAGGAAGGGGAAAGAGGAGGG - Intronic
1030296111 7:107929411-107929433 TAGAAGAAGCTAAAAGAGCAAGG - Exonic
1030897696 7:115082250-115082272 TAGGAGAAACAAAAAGAGAATGG + Intergenic
1030925003 7:115441006-115441028 AAGGAGAAAGGGAAGGAGGAAGG + Intergenic
1031083759 7:117282447-117282469 GAGGAGGAGAGGAAGGAGGAGGG + Intronic
1031310884 7:120195621-120195643 TAGGAAAAGAGTAAAGAGGGAGG - Intergenic
1031380622 7:121081486-121081508 TAGGAGAAGTGGAAAGAAAATGG - Intronic
1031595108 7:123640723-123640745 GAGGAGAAGGGGAAGGGGGAAGG + Intergenic
1031696178 7:124857682-124857704 AAGGGGAAGTGAAAAGAGGATGG - Intronic
1031866902 7:127047485-127047507 AAGGAGAAGGGGAAAAAGAAAGG - Intronic
1032204115 7:129846828-129846850 TAGTAGAAGGAGAAAGGGGATGG - Intronic
1032523275 7:132561942-132561964 GAGGAGGAGGAGAAAGAGGAGGG - Intronic
1033148039 7:138887958-138887980 AAGGAGAACAGGGAAGAGGACGG + Intronic
1033189001 7:139259303-139259325 AAGCGGAAGCGGAAAGAGGAAGG + Exonic
1033798404 7:144874098-144874120 TATGAGAACAGGAGAGAGGAAGG - Intergenic
1033804387 7:144937580-144937602 AAGGGGAAGCGGAAAGAGAAGGG - Intergenic
1033804392 7:144937599-144937621 AAGGGGAAGCAGAAAGGGGAAGG - Intergenic
1033890469 7:146006537-146006559 TAGAAGAAGAAGAAGGAGGAGGG - Intergenic
1034491732 7:151396487-151396509 CAGGAGCAGCGGGAAGGGGATGG + Intronic
1034720758 7:153290146-153290168 GAGGAGGAGTGGGAAGAGGAGGG + Intergenic
1034858570 7:154577056-154577078 TAGGAGAAGTGAAAATATGAAGG + Intronic
1034918836 7:155062283-155062305 CAGGAGAAGGGGAGGGAGGAGGG + Intergenic
1034944920 7:155255652-155255674 AAGAAGAAGGGGAAAGGGGAAGG + Intergenic
1035144401 7:156799555-156799577 TAGGAGAAGGAGAGAGATGAAGG - Intronic
1035156671 7:156920113-156920135 TCTGAAAAGTGGAAAGAGGAAGG + Intergenic
1035419682 7:158717224-158717246 TAGGAGAAGAAGGAAGAAGAAGG - Intergenic
1035477498 7:159153634-159153656 GAGGAGGAGGGGAAAGGGGAGGG - Intergenic
1035570170 8:667410-667432 GTGGAGGAGCGGGAAGAGGAGGG - Intronic
1035910986 8:3566205-3566227 GAGGAGGAGAGGGAAGAGGAAGG + Intronic
1036658135 8:10690823-10690845 GAGGAGGAGAGGAATGAGGAGGG - Intronic
1037071541 8:14656392-14656414 GAGGAGAGGAGGAAAGAGAAAGG - Intronic
1037485479 8:19342848-19342870 ATGGAGAAAGGGAAAGAGGAGGG + Intronic
1037591214 8:20313535-20313557 CAGGAGAACCTCAAAGAGGAAGG - Intergenic
1037739855 8:21599812-21599834 CAGGAGAAGGGGTAGGAGGAAGG + Intergenic
1037752545 8:21692334-21692356 TAGGAAATGAGGAAAGAGAAAGG + Exonic
1037753238 8:21696095-21696117 AAGGAGGAGGGGACAGAGGAGGG - Intronic
1037879469 8:22565878-22565900 TGGGAGACGCGGGAGGAGGAAGG + Intronic
1038540884 8:28389314-28389336 TAGGGGAAGGGGGAAGAAGAGGG - Intronic
1038792630 8:30681872-30681894 TGGGGGCAGGGGAAAGAGGAAGG + Intronic
1038794749 8:30699951-30699973 AAAGAGAAGCTGTAAGAGGAGGG + Intronic
1038812695 8:30866353-30866375 AAGGAGAAAGGGGAAGAGGAAGG + Intronic
1038825186 8:30991600-30991622 GAAGAGAGGAGGAAAGAGGAGGG - Intergenic
1039340112 8:36638741-36638763 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1039564831 8:38543855-38543877 AGGGAGAATAGGAAAGAGGAGGG + Intergenic
1040564274 8:48552149-48552171 AAGGAGGAGCGAAAGGAGGAGGG - Intergenic
1041141200 8:54820948-54820970 TAGGCGAAGCAGCAAGATGAGGG + Intergenic
1041311109 8:56517503-56517525 GAGGAGGAGGGGAAAGAGGAGGG - Intergenic
1041330488 8:56719134-56719156 GAAGAGAATGGGAAAGAGGAGGG - Intergenic
1041433561 8:57811632-57811654 CTGGAGAAGGGCAAAGAGGAAGG + Intergenic
1042076670 8:65003246-65003268 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1042876482 8:73444937-73444959 TAGGAGAAGCCTTCAGAGGAAGG + Intronic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043082708 8:75785374-75785396 TAAGAGGAGGAGAAAGAGGAGGG - Intergenic
1043506086 8:80904519-80904541 TGGGAGAAGTGGGAAGAGAAGGG - Intergenic
1045845504 8:106630649-106630671 TAGCAGATGAGCAAAGAGGAAGG + Intronic
1046607020 8:116382568-116382590 GAGGAGAGAGGGAAAGAGGATGG - Intergenic
1046784609 8:118252655-118252677 TGGGAGAAAGAGAAAGAGGAAGG - Intronic
1046838794 8:118833379-118833401 GAGGAGAAGAAGGAAGAGGAGGG + Intergenic
1047261313 8:123263010-123263032 GAAGAGAAGCGGGAAGGGGAGGG + Intronic
1047702565 8:127464240-127464262 TAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1049469240 8:142768140-142768162 GGGGAGAAGAGGAGAGAGGAAGG + Intronic
1049674039 8:143881873-143881895 GAGGAGAAGGGGGAGGAGGAGGG + Intergenic
1050010425 9:1180316-1180338 AAGGAGAAGAGGAAGCAGGAAGG - Intergenic
1050302206 9:4271034-4271056 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1050500619 9:6294298-6294320 TTGGAGATTCAGAAAGAGGAAGG - Intergenic
1050690750 9:8223835-8223857 CAGGAGAAGAGGAAGGGGGAAGG + Intergenic
1052918200 9:33939994-33940016 GAGGAGGAGGGGAAAGAGGAGGG + Intronic
1053169123 9:35865981-35866003 TAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1053296476 9:36918031-36918053 TAGGAGAAGAAGAGAGATGAGGG - Intronic
1053453742 9:38214719-38214741 AAGGAGAAGGGGAAAGGGGTTGG + Intergenic
1053504048 9:38625560-38625582 AAGAAGAGGCAGAAAGAGGATGG - Intergenic
1053684853 9:40511611-40511633 CAGGAGCATCGGAGAGAGGAGGG - Intergenic
1053934816 9:43139894-43139916 CAGGAGCATCGGAGAGAGGAGGG - Intergenic
1054278874 9:63113345-63113367 CAGGAGCATCGGAGAGAGGAGGG + Intergenic
1054297945 9:63347074-63347096 CAGGAGCATCGGAGAGAGGAAGG - Intergenic
1054337406 9:63818456-63818478 TAGGTGAACCCGATAGAGGAGGG + Intergenic
1054395962 9:64651592-64651614 CAGGAGCATCGGAGAGAGGAGGG - Intergenic
1054430606 9:65156787-65156809 CAGGAGCATCGGAGAGAGGAGGG - Intergenic
1054499774 9:65864734-65864756 CAGGAGCATCGGAGAGAGGAGGG + Intergenic
1054723161 9:68623788-68623810 GTGGAGAAGGGGGAAGAGGAAGG + Intergenic
1055166329 9:73199736-73199758 AAGGAGATGGGGAAAGAGGGAGG + Intergenic
1055280496 9:74668744-74668766 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
1055581479 9:77711145-77711167 GAGGGGAAGGGGAAGGAGGAGGG - Intergenic
1055706900 9:79015472-79015494 TAGCAGATGCGGGGAGAGGAGGG + Intergenic
1055770405 9:79710746-79710768 TAGTAGAAGAGGAAAGAATAGGG - Intronic
1056789915 9:89618593-89618615 CAGGAGAAGCGGTGTGAGGAGGG - Intergenic
1056983861 9:91342879-91342901 TAGGTTAAGGAGAAAGAGGAGGG - Intronic
1057036929 9:91817839-91817861 GAGGAGGAGGGGAAAGAGGGAGG + Intronic
1057247006 9:93465044-93465066 TAGGAGAAGGGAAAACAGGAAGG + Intronic
1057745233 9:97745855-97745877 TGGGTGAAGAGGAAAGAGGGAGG - Intergenic
1058102226 9:100929424-100929446 AAGGAGAATTGGAAAGAGTAAGG - Intergenic
1058304395 9:103419111-103419133 GAGGAGAAGAGGAAAAAGTAGGG + Intergenic
1058314868 9:103553593-103553615 TAGATGAAGGGGAAAGAAGATGG + Intergenic
1058472939 9:105299719-105299741 TAGGACAGGCAGAAGGAGGAAGG - Intronic
1059226118 9:112674768-112674790 AAGGAGGAGAGGAAAGAGGGGGG - Intergenic
1059323853 9:113490316-113490338 CTGGAGAAGGGGAAAGTGGATGG - Intronic
1059663096 9:116420812-116420834 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
1059823204 9:117997116-117997138 GAGGAAAAGAGGAAGGAGGAAGG - Intergenic
1060552743 9:124493200-124493222 GAGGAGAAGGGGTGAGAGGAAGG - Intronic
1060656046 9:125373542-125373564 TAGGAGAAGGGGTGAGAGGGAGG - Intergenic
1060816724 9:126639029-126639051 GAGGAGAGGAGGAAAGGGGAGGG + Intronic
1060816742 9:126639098-126639120 TAGGAGAAGAGGGGAGGGGAGGG + Intronic
1061587619 9:131578954-131578976 AAGGGGAAGCGGAAAGTGAAAGG + Exonic
1061668082 9:132172064-132172086 TAGGAGCTGGGGAAGGAGGAGGG + Intronic
1062000433 9:134213214-134213236 TAGGAAAACCAGAAAGTGGAAGG + Intergenic
1062031247 9:134363033-134363055 TGGGAGAAGGGGCAAGAGAAAGG - Intronic
1062050506 9:134444402-134444424 AAGGAGGAGGGGAAGGAGGAGGG - Intergenic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062160140 9:135075437-135075459 TAGGAGGCGAGGAGAGAGGAGGG + Intronic
1062265189 9:135683663-135683685 TAGCAGAAGAGGAGAGAGGCAGG - Intergenic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1062638429 9:137503655-137503677 AAGGAGAAGGGGAAGGAAGAAGG + Intronic
1062703966 9:137924360-137924382 AAGGAGGAGGGGAAAGAGGGAGG - Intronic
1185499105 X:584181-584203 GAGGAGGAGGGGAAGGAGGAGGG + Intergenic
1185948692 X:4406311-4406333 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
1186072904 X:5842106-5842128 AAGCAGAAGCAGAAACAGGAGGG + Intronic
1186145760 X:6622031-6622053 AAGGAGAAAGGGAAGGAGGAGGG + Intergenic
1186264634 X:7818805-7818827 AAGGAGAAGGGGAAGGAGTAGGG + Intergenic
1186318590 X:8398964-8398986 TATAAGAAGCAAAAAGAGGACGG - Intergenic
1186639197 X:11437090-11437112 AGGGAGAAAGGGAAAGAGGAAGG + Intronic
1187973275 X:24679949-24679971 ATGGAGAAGAGGAAAGGGGAAGG - Intergenic
1189420464 X:40852735-40852757 AAGTAGAAGCTGAAAGAGGAAGG + Intergenic
1189709704 X:43796555-43796577 AAGGAGGAGGAGAAAGAGGAGGG + Intronic
1190774776 X:53543970-53543992 TGGGAGAAAGAGAAAGAGGAAGG + Intronic
1191645105 X:63471600-63471622 TCTGAGAAGTGTAAAGAGGAAGG + Intergenic
1192039503 X:67603478-67603500 TAGGAGAAGGTGAAGAAGGAAGG + Intronic
1192153620 X:68727004-68727026 TAGGAGATGGATAAAGAGGAGGG + Intergenic
1192204149 X:69085183-69085205 GAGGAGGAGAAGAAAGAGGAGGG - Intergenic
1192434620 X:71135508-71135530 GTGGAGCAGAGGAAAGAGGAGGG - Intronic
1192547620 X:72027025-72027047 GAGGAGAAGAGGAAAGTGGTTGG + Intergenic
1195002184 X:100652514-100652536 TAGGAGAAGAGGAACCAGCAAGG + Intronic
1195112827 X:101664657-101664679 TAGGGGGAGGGGAAGGAGGAAGG - Intergenic
1195457564 X:105085988-105086010 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
1196065446 X:111459144-111459166 GAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1196101722 X:111853858-111853880 CAGGAGAAGCATAAAGAGGAAGG + Exonic
1196489361 X:116248712-116248734 TAGGCAAAGAGGAAATAGGAAGG - Intergenic
1196586612 X:117436473-117436495 TAGGAGAAGCAAAGAGTGGAGGG + Intergenic
1196761084 X:119201530-119201552 TAGCAGAAGAACAAAGAGGAAGG - Intergenic
1196964184 X:121037817-121037839 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1197329975 X:125141639-125141661 TAACAGAAGAGGAATGAGGAAGG + Intergenic
1197798384 X:130322424-130322446 TAAGGGCAGGGGAAAGAGGAAGG - Intergenic
1197997395 X:132392739-132392761 ATGGTGAAGAGGAAAGAGGAAGG - Intronic
1199394492 X:147318818-147318840 TAGGAGAATGGGATTGAGGAAGG - Intergenic
1199701887 X:150385632-150385654 GAGGAGAAGGAGGAAGAGGAAGG + Intronic
1199860428 X:151796432-151796454 GTGAAGAAGAGGAAAGAGGAAGG - Intergenic
1199896900 X:152135454-152135476 GAGGAGGAGGGAAAAGAGGATGG + Exonic
1201075618 Y:10185180-10185202 TGGGAGAAGGGGAGAGAAGAGGG - Intergenic
1201949810 Y:19550958-19550980 TAGGAGAAGTGGGAAGAAAAGGG + Intergenic