ID: 915088446

View in Genome Browser
Species Human (GRCh38)
Location 1:153404897-153404919
Sequence ACCAGGGCGAGGTGGGTGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915088438_915088446 2 Left 915088438 1:153404872-153404894 CCACGTGGTACTGCCTCCGGCGA No data
Right 915088446 1:153404897-153404919 ACCAGGGCGAGGTGGGTGCTCGG No data
915088436_915088446 6 Left 915088436 1:153404868-153404890 CCAGCCACGTGGTACTGCCTCCG No data
Right 915088446 1:153404897-153404919 ACCAGGGCGAGGTGGGTGCTCGG No data
915088433_915088446 17 Left 915088433 1:153404857-153404879 CCACGAAGGACCCAGCCACGTGG No data
Right 915088446 1:153404897-153404919 ACCAGGGCGAGGTGGGTGCTCGG No data
915088435_915088446 7 Left 915088435 1:153404867-153404889 CCCAGCCACGTGGTACTGCCTCC No data
Right 915088446 1:153404897-153404919 ACCAGGGCGAGGTGGGTGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915088446 Original CRISPR ACCAGGGCGAGGTGGGTGCT CGG Intergenic
No off target data available for this crispr