ID: 915088732

View in Genome Browser
Species Human (GRCh38)
Location 1:153406525-153406547
Sequence TTCTGGGTGTGCAGGTGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915088732_915088737 8 Left 915088732 1:153406525-153406547 CCCTGACACCTGCACACCCAGAA No data
Right 915088737 1:153406556-153406578 GCACTCACAGCATAAATGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915088732 Original CRISPR TTCTGGGTGTGCAGGTGTCA GGG (reversed) Intergenic
No off target data available for this crispr