ID: 915089757

View in Genome Browser
Species Human (GRCh38)
Location 1:153416286-153416308
Sequence CTGGCTCAATCTTGATTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 1, 2: 0, 3: 9, 4: 134}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915089757_915089764 3 Left 915089757 1:153416286-153416308 CCCTCAAATCAAGATTGAGCCAG 0: 1
1: 1
2: 0
3: 9
4: 134
Right 915089764 1:153416312-153416334 AGGCCCCAGGTGAGGTCTCTGGG 0: 1
1: 0
2: 4
3: 29
4: 373
915089757_915089773 13 Left 915089757 1:153416286-153416308 CCCTCAAATCAAGATTGAGCCAG 0: 1
1: 1
2: 0
3: 9
4: 134
Right 915089773 1:153416322-153416344 TGAGGTCTCTGGGGTGGGGTGGG 0: 2
1: 0
2: 11
3: 85
4: 661
915089757_915089768 7 Left 915089757 1:153416286-153416308 CCCTCAAATCAAGATTGAGCCAG 0: 1
1: 1
2: 0
3: 9
4: 134
Right 915089768 1:153416316-153416338 CCCAGGTGAGGTCTCTGGGGTGG 0: 1
1: 1
2: 3
3: 43
4: 344
915089757_915089772 12 Left 915089757 1:153416286-153416308 CCCTCAAATCAAGATTGAGCCAG 0: 1
1: 1
2: 0
3: 9
4: 134
Right 915089772 1:153416321-153416343 GTGAGGTCTCTGGGGTGGGGTGG 0: 2
1: 1
2: 5
3: 83
4: 624
915089757_915089774 19 Left 915089757 1:153416286-153416308 CCCTCAAATCAAGATTGAGCCAG 0: 1
1: 1
2: 0
3: 9
4: 134
Right 915089774 1:153416328-153416350 CTCTGGGGTGGGGTGGGACCTGG 0: 2
1: 0
2: 9
3: 83
4: 752
915089757_915089765 4 Left 915089757 1:153416286-153416308 CCCTCAAATCAAGATTGAGCCAG 0: 1
1: 1
2: 0
3: 9
4: 134
Right 915089765 1:153416313-153416335 GGCCCCAGGTGAGGTCTCTGGGG 0: 1
1: 0
2: 4
3: 26
4: 323
915089757_915089763 2 Left 915089757 1:153416286-153416308 CCCTCAAATCAAGATTGAGCCAG 0: 1
1: 1
2: 0
3: 9
4: 134
Right 915089763 1:153416311-153416333 AAGGCCCCAGGTGAGGTCTCTGG 0: 1
1: 0
2: 2
3: 32
4: 279
915089757_915089761 -5 Left 915089757 1:153416286-153416308 CCCTCAAATCAAGATTGAGCCAG 0: 1
1: 1
2: 0
3: 9
4: 134
Right 915089761 1:153416304-153416326 GCCAGAGAAGGCCCCAGGTGAGG 0: 1
1: 1
2: 6
3: 40
4: 346
915089757_915089775 27 Left 915089757 1:153416286-153416308 CCCTCAAATCAAGATTGAGCCAG 0: 1
1: 1
2: 0
3: 9
4: 134
Right 915089775 1:153416336-153416358 TGGGGTGGGACCTGGTGACCTGG 0: 2
1: 0
2: 4
3: 44
4: 385
915089757_915089776 28 Left 915089757 1:153416286-153416308 CCCTCAAATCAAGATTGAGCCAG 0: 1
1: 1
2: 0
3: 9
4: 134
Right 915089776 1:153416337-153416359 GGGGTGGGACCTGGTGACCTGGG 0: 2
1: 0
2: 1
3: 45
4: 452
915089757_915089760 -10 Left 915089757 1:153416286-153416308 CCCTCAAATCAAGATTGAGCCAG 0: 1
1: 1
2: 0
3: 9
4: 134
Right 915089760 1:153416299-153416321 ATTGAGCCAGAGAAGGCCCCAGG 0: 1
1: 0
2: 1
3: 12
4: 167
915089757_915089771 9 Left 915089757 1:153416286-153416308 CCCTCAAATCAAGATTGAGCCAG 0: 1
1: 1
2: 0
3: 9
4: 134
Right 915089771 1:153416318-153416340 CAGGTGAGGTCTCTGGGGTGGGG 0: 2
1: 0
2: 2
3: 35
4: 431
915089757_915089770 8 Left 915089757 1:153416286-153416308 CCCTCAAATCAAGATTGAGCCAG 0: 1
1: 1
2: 0
3: 9
4: 134
Right 915089770 1:153416317-153416339 CCAGGTGAGGTCTCTGGGGTGGG 0: 2
1: 0
2: 2
3: 38
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915089757 Original CRISPR CTGGCTCAATCTTGATTTGA GGG (reversed) Intergenic
908618375 1:65948563-65948585 CTGACCCAATCTTAATTGGATGG - Intronic
908701321 1:66904531-66904553 TTGTCTCAATATTGCTTTGAAGG + Intronic
909437103 1:75655031-75655053 CTGGATTAATCTTTATTAGAGGG - Intergenic
912867953 1:113275853-113275875 CTGTCTCAATCCTCATTTCATGG + Intergenic
913500364 1:119467333-119467355 CTCCCTCAATCCTGATCTGAAGG - Intergenic
915089757 1:153416286-153416308 CTGGCTCAATCTTGATTTGAGGG - Intergenic
915095751 1:153460863-153460885 CTGGCTCAACCTTGATTTGAGGG + Intergenic
916484594 1:165247518-165247540 CTGGATTTATTTTGATTTGAGGG - Intronic
917042373 1:170820015-170820037 CTGCATCAAAATTGATTTGAGGG + Intergenic
923384571 1:233453759-233453781 CTGGCTGCAGCTTGATTTTAGGG - Intergenic
1063217134 10:3934783-3934805 CTGGAACAATCTTGATATTAGGG + Intergenic
1065502360 10:26394833-26394855 ATGTCTCAAGCTTGATTTTACGG - Intergenic
1070407531 10:76110479-76110501 CTGGCTTAGTCTTGCTTTTAGGG + Intronic
1078582910 11:12552806-12552828 TTGGCTCAGTCCAGATTTGAGGG + Intergenic
1081451660 11:43176664-43176686 ATTCCTCAATCTTGATTTTATGG + Intergenic
1084555826 11:69875295-69875317 CTGGCTCAAACTAGAATTAATGG + Intergenic
1087482805 11:98722434-98722456 CTGGCTCAAACTTGTTTAGAGGG - Intergenic
1092175207 12:6399793-6399815 CTGTCTCAATCCTGATTTTAAGG + Intergenic
1092285081 12:7124038-7124060 CTGGCACAATCTGGGCTTGAAGG + Exonic
1093280858 12:17194956-17194978 CTGTCTCTATCTAGATTTCAAGG + Intergenic
1102747632 12:115263523-115263545 CTGGCTCTATCTTCATTCCAAGG - Intergenic
1103104497 12:118211196-118211218 TTGATTCCATCTTGATTTGATGG - Intronic
1103847267 12:123910145-123910167 CTGTCTGAATCTTCATTGGATGG + Intronic
1104405926 12:128516613-128516635 CTGACTCAATCTTTTTTTTAAGG - Intronic
1104993249 12:132638628-132638650 CGGGATGAATCCTGATTTGATGG - Intronic
1110822871 13:79936669-79936691 CTGTCTCAGTCTTGTTTTCAGGG - Intergenic
1111775001 13:92650010-92650032 AAGACTCAATGTTGATTTGAGGG + Intronic
1112968254 13:105226075-105226097 CTTGCTTAATCTTGATTGTATGG - Intergenic
1114400508 14:22406003-22406025 TTGGCTTGATCTTGAATTGAAGG - Intergenic
1115356431 14:32453401-32453423 CTGGCTTAATTTTCATCTGAGGG - Intronic
1116411320 14:44626926-44626948 CTGGCTCTCTCTTGACTTCAGGG - Intergenic
1123456725 15:20433136-20433158 CTGTTTCAAGCTTGAGTTGAGGG - Intergenic
1123661337 15:22567220-22567242 CTGTTTCAAGCTTGAGTTGAGGG + Intergenic
1124262873 15:28208288-28208310 CTGTTTCAAGCTTGAATTGAGGG - Intronic
1124315137 15:28661456-28661478 CTGTTTCAAGCTTGAGTTGAGGG + Intergenic
1125640031 15:41222875-41222897 GTGGCTCAATCTTGATTCACTGG - Intronic
1127638215 15:60891194-60891216 CTGGCCCAAACTTTATCTGAAGG + Intronic
1129265413 15:74390695-74390717 CTTCCTCATTCTTGCTTTGAAGG - Intergenic
1133525678 16:6603182-6603204 CTGGGTCAATCTTGTTCTTAAGG - Intronic
1134632849 16:15769336-15769358 CTGGCTAATTTTTGATTTTAGGG - Intronic
1140562084 16:75995273-75995295 CTGGGTAAATCTTGATTGAAGGG + Intergenic
1140721662 16:77777529-77777551 CTGGCTCATTCTTTGTTTTAGGG + Intergenic
1141370109 16:83478903-83478925 CTGGCTTTATTTTCATTTGAGGG - Intronic
1148948866 17:51291027-51291049 CTCGCTCATCCTTGATTTAATGG - Intronic
1149292944 17:55234980-55235002 ATGCCTCAACCTTGAATTGATGG + Intergenic
1150013113 17:61524799-61524821 CAGGCTAAACCTTGATTTGGGGG + Intergenic
1157193178 18:45598159-45598181 CTGGCTCCATTTTGACTAGAAGG - Intronic
1160478257 18:79213564-79213586 CTGGTACCATCTTTATTTGAAGG + Intronic
930154315 2:48090338-48090360 CTGGCTCCACGTTGATTTGGAGG + Intergenic
932829358 2:74974004-74974026 CTGGCTAAATTTTGGTTTGGAGG + Intergenic
935574368 2:104693649-104693671 CTGGCTCATTCTTGTTGTAATGG - Intergenic
938256163 2:129861603-129861625 CTTGCTCATTCTTGAACTGAGGG - Intergenic
938685234 2:133731499-133731521 CTGCCTAAAACATGATTTGATGG - Intergenic
938847795 2:135229268-135229290 CTGTCTTAATTTTGATTTGAAGG - Intronic
941254024 2:163205429-163205451 CTGGCACAATATTTATTTGTGGG - Intergenic
943786585 2:191884160-191884182 CTGTGACAATATTGATTTGATGG + Intergenic
945471802 2:210235552-210235574 TTGGCTCCATCTAGATGTGAGGG + Intergenic
946083362 2:217146943-217146965 CTGGGACAATCCTGATTTAAAGG + Intergenic
948524448 2:238561971-238561993 CTTTCTAAATCTTGATTTGCTGG - Intergenic
1172819975 20:37723903-37723925 CTGGCTCAATCAATATTTGCAGG - Intronic
1175024885 20:55891338-55891360 CTGTGTCAATCCTGGTTTGAAGG - Intergenic
1178591318 21:33913351-33913373 CTGGCTCACTGTTGATTTGGTGG + Intronic
1179885221 21:44310985-44311007 CTGCCCCACTCTTGATTTCAGGG + Exonic
1181523778 22:23466535-23466557 CTGGATCATTCTTCATGTGATGG - Intergenic
1182081230 22:27530245-27530267 CTGGCTCAATGGTGATGTGAGGG - Intergenic
952657130 3:35800402-35800424 GAGGCTCAATCTGAATTTGATGG + Intergenic
952978184 3:38713965-38713987 CGGGCTCTTTCTCGATTTGAAGG - Exonic
955899831 3:63740691-63740713 CTGGATCAATTATGATTTGATGG - Intergenic
957764301 3:84601672-84601694 GTGGCTCAATTCTGATGTGAAGG + Intergenic
957884699 3:86271181-86271203 CGGGTTCAATTTTCATTTGAAGG + Intergenic
960350064 3:116581600-116581622 GTTGCTCAATCTTGTTTTAATGG + Intronic
965447128 3:168788648-168788670 CTGTCTTATTCTTGATTTTAGGG - Intergenic
968273502 3:197422832-197422854 TTGGCTCATTCTTGCTGTGATGG + Intergenic
968595771 4:1482372-1482394 CTGGCACAATGTTGAATAGAAGG + Intergenic
970050053 4:11904250-11904272 CTGGCACTAGCTTGAGTTGAAGG + Intergenic
970124032 4:12789456-12789478 CAGACTCAATCTTGATGGGATGG + Intergenic
974982842 4:68981850-68981872 CTGGCTCAGACTTGGTTAGAGGG - Intergenic
980621678 4:135314948-135314970 CTGGCTCAATTATGTTTTAAAGG + Intergenic
980893961 4:138843598-138843620 CTGGCACATTCTTGATATGGTGG - Intergenic
983344680 4:166512199-166512221 AGGGCTCAATCTTGTTTTGTTGG - Intergenic
983781249 4:171673316-171673338 ATGGCTCCATCTGGATCTGATGG - Intergenic
988183424 5:27828391-27828413 CTGCCTCACTCTTGCTTTAAAGG - Intergenic
993083071 5:83326500-83326522 ATGGCTCAAGCTTGGTTAGAAGG - Intronic
996479844 5:123962899-123962921 ATGGGTCCATCTTTATTTGATGG + Intergenic
1003605021 6:7551870-7551892 CTCCCTCTATCTTGTTTTGATGG + Intronic
1004967554 6:20871966-20871988 TTGGCCCAATCTTGAGTAGATGG + Intronic
1006004390 6:30990878-30990900 CTGGCTCATTCTAGCTATGAGGG + Intergenic
1006824973 6:36928236-36928258 ATGGCTCATTCTTGGATTGATGG - Intronic
1008935016 6:56981966-56981988 CTAGCTCAATCATAATTTCATGG + Intronic
1010521824 6:76847547-76847569 CTAGCTCAATTTTGATGTTAGGG + Intergenic
1011826190 6:91308481-91308503 CTGGCCCCATTTAGATTTGAGGG - Intergenic
1013696813 6:112712320-112712342 GTGGCACAATCTTCATTTTAAGG + Intergenic
1015188799 6:130450177-130450199 CTCTCTCAATCTTGATTTCCAGG + Intergenic
1016288252 6:142498386-142498408 ATGGCTTAATCTTTAGTTGATGG + Intergenic
1016397501 6:143641202-143641224 ATGGCTTAATCATGATTTAAAGG + Intronic
1021081071 7:16365752-16365774 GTGGCCAAATCTTGAGTTGAAGG - Intronic
1021664447 7:22962054-22962076 CTGGCTTTATCTTGTTTTTATGG - Intronic
1021809155 7:24386582-24386604 CTGGCTCACTCTTGAGGAGAAGG + Intergenic
1024960855 7:54974207-54974229 CTGGCACATTATTGATTTTAAGG - Intergenic
1025804053 7:64812503-64812525 CTGGTTCTATTTGGATTTGATGG + Intronic
1025959586 7:66208267-66208289 CTGTCACAGTCTTGATTTTACGG - Intronic
1026573595 7:71553813-71553835 CTGTCAAAATCTTGATTTAATGG - Intronic
1028811757 7:95095851-95095873 GTGCTTCAATCTTGTTTTGAAGG + Intronic
1028989849 7:97037061-97037083 CTGGCTAAACCTTGATTTTGTGG + Intergenic
1030899964 7:115111040-115111062 CTGGTACTGTCTTGATTTGAGGG + Intergenic
1038747402 8:30266544-30266566 CTGGCTAAAATTTGATTTGGGGG - Intergenic
1040650731 8:49446437-49446459 CTAACTCTATCTTGTTTTGAAGG - Intergenic
1043559163 8:81470245-81470267 CTGGCTCAATCATCTTTTAATGG + Intergenic
1044669196 8:94661601-94661623 ATAGCTCAAACTTGGTTTGAGGG - Intronic
1044711653 8:95064318-95064340 CTGTTTGAATCTTGCTTTGAGGG + Intronic
1046036173 8:108844023-108844045 TTGGCTCAATCTTTATTTCTGGG + Intergenic
1046211726 8:111085104-111085126 AAGGCTCAATCATGAATTGATGG - Intergenic
1046339787 8:112838422-112838444 CAGGGACAATCTGGATTTGAAGG + Intronic
1050120781 9:2305095-2305117 CAGGCTCAATCAAGATTTGGGGG - Intergenic
1052179065 9:25502479-25502501 CTAGCTCACTTTTGATTTTACGG + Intergenic
1052933227 9:34072728-34072750 TTGGCTCTATCTGTATTTGAAGG - Intergenic
1054940734 9:70738282-70738304 GTGGGTCCATCTTGATTTTATGG - Intronic
1056700019 9:88895424-88895446 ATGGCTACATCTTGATCTGAGGG + Intergenic
1058436986 9:104971981-104972003 CTGGCCCAAACTTGTTTTTAAGG - Intergenic
1060559364 9:124530124-124530146 CTGGCTGACTCTTGACCTGAGGG + Intronic
1187109784 X:16285009-16285031 CTGGCTCAGTCTTCAATTTAAGG + Intergenic
1194067348 X:89277569-89277591 CTGCCTCGAGCTTGTTTTGATGG + Intergenic
1194534991 X:95095051-95095073 CTGGCTCCAACTTCTTTTGACGG + Intergenic
1194567138 X:95504021-95504043 CTGACTCAATCTTGACTGGTTGG + Intergenic
1200063345 X:153493562-153493584 CTGGTTCTCTCTTGATTTCATGG - Intronic
1200696716 Y:6367466-6367488 CTGGCAAAATCCTGATTTGGGGG - Intergenic
1200721506 Y:6611783-6611805 CTGCCTCGAGCTTGTTTTGATGG + Intergenic
1200921432 Y:8616857-8616879 CTGGCAAACTCTTGATTTGAGGG + Intergenic
1200927299 Y:8665981-8666003 CTGGCAAGCTCTTGATTTGAGGG + Intergenic
1200935897 Y:8738128-8738150 CTGGCAAACTCCTGATTTGAGGG - Intergenic
1200939309 Y:8765669-8765691 CTGGCTAAATCCCAATTTGAGGG - Intergenic
1200963357 Y:9014868-9014890 CTGGTACACTCCTGATTTGAGGG - Intergenic
1200984476 Y:9291085-9291107 CTGGCAAACTCTTGATTTCAGGG - Intergenic
1200984814 Y:9293538-9293560 CTGGCAAACTCCTGATTTGAGGG - Intergenic
1201037397 Y:9797233-9797255 CTGGCAAAATCCTGATTTGGGGG + Intergenic
1202125625 Y:21566649-21566671 CTGGCAAACTCCTGATTTGAGGG + Intergenic
1202148815 Y:21826465-21826487 CTGGCAAACTCCTGATTTGAGGG + Intergenic
1202149740 Y:21833917-21833939 CTGGTACACTCCTGATTTGAGGG + Intergenic
1202153383 Y:21862743-21862765 CTGGCAAACTCCTGATTTGAGGG - Intergenic
1202180593 Y:22136569-22136591 CTGGCTAACTCCTGATTTGATGG - Intergenic
1202182238 Y:22149549-22149571 CTGGCAAACTCCTGATTTGAGGG - Intergenic
1202182567 Y:22152080-22152102 CTGGCAAACTCCTGATTTGAGGG - Intergenic
1202208793 Y:22434322-22434344 CTGGCAAACTCCTGATTTGAGGG + Intergenic
1202209122 Y:22436853-22436875 CTGGCAAACTCCTGATTTGAGGG + Intergenic
1202210767 Y:22449830-22449852 CTGGCTAACTCCTGATTTGATGG + Intergenic