ID: 915092770

View in Genome Browser
Species Human (GRCh38)
Location 1:153438150-153438172
Sequence AAGCTCTCCCAGCCAAGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 233}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915092762_915092770 14 Left 915092762 1:153438113-153438135 CCAAGAATCACTACTCCATTGCC 0: 1
1: 0
2: 1
3: 8
4: 140
Right 915092770 1:153438150-153438172 AAGCTCTCCCAGCCAAGGGCGGG 0: 1
1: 0
2: 2
3: 11
4: 233
915092766_915092770 -9 Left 915092766 1:153438136-153438158 CCGCACAAATATAAAAGCTCTCC 0: 1
1: 0
2: 2
3: 23
4: 306
Right 915092770 1:153438150-153438172 AAGCTCTCCCAGCCAAGGGCGGG 0: 1
1: 0
2: 2
3: 11
4: 233
915092761_915092770 19 Left 915092761 1:153438108-153438130 CCTGTCCAAGAATCACTACTCCA 0: 1
1: 0
2: 2
3: 10
4: 101
Right 915092770 1:153438150-153438172 AAGCTCTCCCAGCCAAGGGCGGG 0: 1
1: 0
2: 2
3: 11
4: 233
915092764_915092770 -7 Left 915092764 1:153438134-153438156 CCCCGCACAAATATAAAAGCTCT 0: 1
1: 0
2: 0
3: 13
4: 117
Right 915092770 1:153438150-153438172 AAGCTCTCCCAGCCAAGGGCGGG 0: 1
1: 0
2: 2
3: 11
4: 233
915092765_915092770 -8 Left 915092765 1:153438135-153438157 CCCGCACAAATATAAAAGCTCTC 0: 1
1: 0
2: 2
3: 14
4: 179
Right 915092770 1:153438150-153438172 AAGCTCTCCCAGCCAAGGGCGGG 0: 1
1: 0
2: 2
3: 11
4: 233
915092763_915092770 -1 Left 915092763 1:153438128-153438150 CCATTGCCCCGCACAAATATAAA 0: 1
1: 0
2: 0
3: 15
4: 132
Right 915092770 1:153438150-153438172 AAGCTCTCCCAGCCAAGGGCGGG 0: 1
1: 0
2: 2
3: 11
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915092770 Original CRISPR AAGCTCTCCCAGCCAAGGGC GGG Intronic
900004617 1:36523-36545 AGCCTCTCCCACCCAAGTGCTGG + Intergenic
900024340 1:207042-207064 AACCTCTACCACCCAAGTGCTGG + Intergenic
900404045 1:2484724-2484746 AAGCTATCCCAGGCCAGGGATGG + Intronic
900674054 1:3872892-3872914 AACCTCTGACAGCCAAGGGCTGG - Intronic
901229411 1:7633600-7633622 CAGCTCCCCCAGCCAAGGCCAGG + Intronic
901230999 1:7641673-7641695 CAGCCCTGCCCGCCAAGGGCAGG + Intronic
901663409 1:10813083-10813105 CAGCACTGGCAGCCAAGGGCTGG + Intergenic
902175611 1:14647984-14648006 CAACTATCCCAGCCAAGGTCAGG + Intronic
902779320 1:18694084-18694106 AATCTCTCCCAGGGCAGGGCTGG + Intronic
903023627 1:20411572-20411594 AAGCTCCCCCAGCCCCAGGCAGG - Intergenic
905629216 1:39509640-39509662 AACCTGGTCCAGCCAAGGGCAGG - Intronic
906475558 1:46167162-46167184 AGGCACTTCCAGCCAAGCGCTGG + Intronic
907489440 1:54799740-54799762 AAGCTCTCCCAGCCGGGGAGAGG + Intronic
907507269 1:54928888-54928910 AAGCTCTACATGCCAAGGACAGG - Intergenic
912456556 1:109802231-109802253 CAGCTCTCCAGGGCAAGGGCAGG - Intergenic
912566836 1:110593385-110593407 CAGGGCTCCCAGTCAAGGGCAGG + Intergenic
914253850 1:145944737-145944759 CACCTCGCCCAGCCAGGGGCAGG - Intronic
915092770 1:153438150-153438172 AAGCTCTCCCAGCCAAGGGCGGG + Intronic
915361297 1:155287807-155287829 AAGCGCTCCGAGCCAAGTCCAGG + Exonic
916558023 1:165909840-165909862 AGGCTCTCCCAGACACGGGTGGG - Intronic
918527223 1:185478420-185478442 AAGGTCTCCCAGGCAGGGCCTGG - Intergenic
921080288 1:211733561-211733583 TAGCTTTCCCACCCCAGGGCTGG + Intergenic
1063654614 10:7975444-7975466 CAGCTAACCCAGCTAAGGGCAGG - Intronic
1064722712 10:18246167-18246189 AAGCTCTCAGAGCCAGGGGAAGG - Intronic
1066371985 10:34825130-34825152 AAGGTGTCCCAGCCTGGGGCAGG - Intergenic
1067063417 10:43089786-43089808 AAGCCGTCCCTGCCAAGAGCAGG + Intronic
1067294870 10:44969837-44969859 AGGCTGTCCCTGCCAAGGGAAGG + Intronic
1069530193 10:69212506-69212528 AACCTCTGCCACCCAAGGCCAGG + Intergenic
1074007393 10:109441648-109441670 AATGTCTCCCAGCCACGGGTTGG + Intergenic
1075021120 10:118953135-118953157 CAGCTGTTCCATCCAAGGGCTGG + Intergenic
1075066014 10:119289379-119289401 AAGCACTTCCTGCCAAGGGAGGG - Intronic
1075436566 10:122448528-122448550 AATCTCTCCAAGCTCAGGGCAGG + Intergenic
1076462787 10:130657716-130657738 ACGCTCTCCGAGGGAAGGGCAGG + Intergenic
1076608127 10:131702583-131702605 ACCACCTCCCAGCCAAGGGCAGG + Intergenic
1077192147 11:1260101-1260123 AAGGACTCCCAGGCAGGGGCAGG - Intronic
1078106027 11:8358426-8358448 GATCTGTGCCAGCCAAGGGCAGG + Intergenic
1078794533 11:14578824-14578846 AAGCTCTCCCAGGAGAAGGCCGG - Intronic
1079622611 11:22572406-22572428 CAGCTGTCCCAACCAAGGTCTGG - Intergenic
1083614244 11:64018536-64018558 CAGCCCGCCCAGCCCAGGGCAGG + Intronic
1083714380 11:64567397-64567419 AGGCTCTTCCAGGAAAGGGCAGG - Intronic
1083741049 11:64712031-64712053 AAGGTCCGCGAGCCAAGGGCGGG - Intronic
1083741949 11:64715941-64715963 AAGCATCCCCAGCCCAGGGCAGG + Intronic
1084161255 11:67351627-67351649 ATGCTCTCCCACCTAAGGCCAGG - Exonic
1084231146 11:67754172-67754194 CAGCTCTCCCTGCCAGGGGTGGG + Intergenic
1088575425 11:111266901-111266923 AAGCTCACCCATCCTTGGGCTGG - Intronic
1090006490 11:123007360-123007382 AAGCTGACACAGCCAAGTGCAGG - Intergenic
1091378037 12:38577-38599 AACCTCTACCACCCAAGTGCTGG + Intergenic
1091447414 12:551930-551952 CTTCTCTCCCTGCCAAGGGCGGG + Intronic
1091587648 12:1825308-1825330 AAGCCCTCCCACCCAAGCTCAGG - Intronic
1091876066 12:3933924-3933946 ATTCTGTCCCACCCAAGGGCAGG + Intergenic
1093082002 12:14822802-14822824 TAACTCCCCCTGCCAAGGGCAGG - Intronic
1094219061 12:27974217-27974239 AAACTTGGCCAGCCAAGGGCAGG - Intergenic
1096241158 12:49961235-49961257 AAGCTCGCCCGGCCCAGGCCGGG + Intergenic
1096511683 12:52133487-52133509 AAGGTGTCCTAGCCAAGGTCTGG + Intergenic
1096533522 12:52256683-52256705 ATGTTCACCAAGCCAAGGGCTGG - Intronic
1097166224 12:57087914-57087936 CAGCCCTCCCAGCCGTGGGCGGG + Intronic
1101552318 12:105774220-105774242 ATGCCCTCACAGCCAAGTGCAGG - Intergenic
1104390568 12:128387970-128387992 AAGCTCTGCCACCAGAGGGCGGG - Intronic
1107011963 13:35678758-35678780 AAGCTCTGCCTCCCAGGGGCAGG + Intergenic
1107116729 13:36755249-36755271 GAGATCTCCAAGCCAAGGCCTGG + Intergenic
1107436168 13:40382485-40382507 AAGGCCTCCCAGCCCAGGGCGGG - Intergenic
1108872859 13:55007919-55007941 TAGCTCTCCCAGCCACGACCAGG - Intergenic
1108884025 13:55157061-55157083 GAGCTCTCAAAGCCATGGGCAGG - Intergenic
1113438807 13:110312733-110312755 AAGCTCTATCAGCCAAGGCTGGG - Intronic
1115794080 14:36913021-36913043 AAATTCTCTCAGCCAATGGCAGG - Intronic
1117713284 14:58554863-58554885 AAGCTGTCCCAATCAGGGGCTGG - Intergenic
1118388795 14:65279682-65279704 CAGCTCTCCCAACCAGGCGCGGG + Intergenic
1118438126 14:65789796-65789818 AAGGTCACCCAGCCAATGGGAGG - Intergenic
1119744783 14:77036357-77036379 AAGCACTTCTAGCCAAGGGTAGG + Intergenic
1120674301 14:87402759-87402781 AAGCTCTTCAATCCAAGGTCAGG - Intergenic
1121127319 14:91416900-91416922 AAGCTCTCCCAGGCAGAGACTGG + Intronic
1121815478 14:96925200-96925222 AAGCTCTCCCACCCAAGCAGTGG - Intronic
1121819814 14:96957306-96957328 GAGGGCTCCCAGCCAAGGGGTGG + Intergenic
1122134551 14:99625308-99625330 AAGGTCCCACAGCCAAGGGGTGG + Intergenic
1122624003 14:103075087-103075109 GAACTCTGCCAGCCCAGGGCGGG + Intergenic
1122834794 14:104425373-104425395 AAGTTCACCCTGCCCAGGGCAGG + Intergenic
1124039134 15:26084031-26084053 ATTTTCTCCCAGCCTAGGGCTGG - Intergenic
1128511448 15:68316244-68316266 AAGCGCTGCCAGACAAGGGGCGG - Intronic
1128725272 15:69983361-69983383 GAGCTCTGCTAGGCAAGGGCAGG - Intergenic
1129160260 15:73743416-73743438 AAGGTCTCTCAGCCAAGAGGTGG - Intronic
1130204250 15:81861451-81861473 CAGCTCCCCCAGCCCAGGGCTGG + Intergenic
1132236868 15:100228747-100228769 ATGCTCTGCCTGGCAAGGGCAGG + Intronic
1132448891 15:101954420-101954442 AGCCTCTCCCACCCAAGTGCTGG - Intergenic
1132889137 16:2195748-2195770 AAGGTCGCCCAGCCCAGGGCAGG - Intronic
1135616406 16:23914543-23914565 AAGATCACCCAACCAAGGGGTGG - Intronic
1136034678 16:27530202-27530224 ATGTTCTGCCACCCAAGGGCTGG - Intronic
1138200453 16:55084423-55084445 GAGCTGTCCCAGTCAGGGGCAGG - Intergenic
1139283235 16:65787570-65787592 AAACTTCCCCAGCCCAGGGCTGG + Intergenic
1139371439 16:66471811-66471833 AAGCACTCCCAGGCCAGGACGGG + Intronic
1139418121 16:66830816-66830838 AGGCTCACCGAGCCGAGGGCGGG - Intronic
1140660838 16:77190451-77190473 GAACTCTGCCAGCCCAGGGCAGG - Intergenic
1141148825 16:81550477-81550499 AAGGTTTCCCAGCCAAGAGTGGG - Intronic
1141635889 16:85313555-85313577 AACCTCTCACAGCAAAGGGCAGG - Intergenic
1141998298 16:87648653-87648675 CCCCTCTCCCAGCCCAGGGCCGG - Intronic
1142425740 16:90001372-90001394 AAGCACCTCCAGCCAAGGACAGG - Intergenic
1143103897 17:4519060-4519082 AGGCTCTGCCATCCAAGGGACGG - Intronic
1143413779 17:6729637-6729659 AAGTTCTCCCAGCCCTGGGGAGG - Intergenic
1144660203 17:17063168-17063190 AGGCCCTCCCAGCCAAGACCTGG - Intronic
1147192564 17:38746659-38746681 AAGATCTCTCAGGCAAGGCCAGG + Intronic
1147454323 17:40526838-40526860 AAGTCCTCCCAAGCAAGGGCTGG - Intergenic
1147596391 17:41720756-41720778 CAGCTCCCCCACCCAAGGGGTGG + Intronic
1148550718 17:48549435-48549457 AAACTGTCCCAGGCAGGGGCTGG - Exonic
1151869005 17:76823958-76823980 AAGCTCAACCATCCAAGAGCAGG - Intergenic
1203165147 17_GL000205v2_random:87008-87030 AAGCTCTGCGACCAAAGGGCTGG + Intergenic
1154170347 18:12046776-12046798 CAGCCCTCCCACCCAAGTGCTGG + Intergenic
1156686071 18:39648334-39648356 AAACTCTCCCAGCAACGTGCAGG + Intergenic
1157933031 18:51844088-51844110 AAGCTCACCCAGTCAGTGGCAGG + Intergenic
1160636369 19:78132-78154 AGCCTCTCCCACCCAAGTGCTGG + Intergenic
1162675466 19:12295007-12295029 AAGCCCGCCCTGCCAGGGGCCGG - Intergenic
1163030984 19:14544054-14544076 AAAATCTCCCAGCCAGGGGTGGG + Intronic
1163127846 19:15253914-15253936 ATGCTCTCCCTGCCAGGGTCTGG - Intronic
1164116363 19:22223086-22223108 AAGCTCTCCCAGGCTGTGGCTGG + Intergenic
1165763409 19:38335896-38335918 AAGCTGTGCCATCCAGGGGCGGG + Intronic
1165824856 19:38699892-38699914 AAGCCCTCCCAGGAAAGGCCAGG - Intronic
1166860816 19:45810018-45810040 CACCACTCCCAGCCAAGAGCTGG - Intronic
1167755609 19:51411472-51411494 AAGCTCAGCAAGGCAAGGGCAGG - Intronic
924960804 2:32851-32873 GAGCTCTGACATCCAAGGGCAGG - Intergenic
925916949 2:8613806-8613828 AAGCTCACACAGCCAAGTGGTGG - Intergenic
926149169 2:10415213-10415235 AGGCACACCCAGCCCAGGGCCGG - Intronic
928183372 2:29086886-29086908 AAACTGTCACAGCCAAGGGGAGG - Intergenic
928863663 2:35891816-35891838 AAGTTCTCCCAGCAAAGACCAGG - Intergenic
929037304 2:37706487-37706509 AAGCCAGCCCAGCCAAGGGGTGG + Intronic
929889431 2:45906887-45906909 ACACTGTCCCAGCCAAGCGCAGG - Intronic
933741646 2:85538797-85538819 AAGCTATCCCGGCCAACGGTCGG + Intergenic
933814619 2:86055647-86055669 AAACACACCCATCCAAGGGCAGG + Intronic
934612799 2:95753370-95753392 GAGCTCTCCCAGGCAAGGAGAGG + Intergenic
934648109 2:96071052-96071074 GAGCTCTCCCAGGCAAGGGCAGG - Intergenic
934841489 2:97626883-97626905 GAGCTCTCCCAGGCACGGGAAGG - Intergenic
935583829 2:104783292-104783314 AAGCTCTCCCAGCAGTGAGCAGG - Intergenic
936114535 2:109691494-109691516 AAGCTGCCCTAGCCAAGTGCAGG - Intergenic
936565111 2:113576917-113576939 AACCTCTACCACCCAAGTGCTGG - Intergenic
937010620 2:118559827-118559849 AGCTTCTCCCAGCCAATGGCTGG + Intergenic
938451940 2:131428741-131428763 CTGCTCTACCAGCCAAGGTCTGG - Intergenic
942876695 2:180808356-180808378 GAGCTCTGTCTGCCAAGGGCTGG + Intergenic
945068424 2:205966816-205966838 GAGCTTTCCCAGCTGAGGGCAGG + Intergenic
946032630 2:216717306-216717328 AGGCTCCCCCAGACAAGTGCAGG - Intergenic
948735422 2:240001051-240001073 CAGCTCTCCCACCAAGGGGCAGG + Intronic
1169130408 20:3163896-3163918 TAGCCCTCTCAGCCAAAGGCAGG + Exonic
1170470308 20:16661976-16661998 CCACTCTCCCAGCCAAGGGGGGG - Intergenic
1170755801 20:19206038-19206060 AAGCTGAACCAGTCAAGGGCAGG + Intergenic
1172367757 20:34363160-34363182 CAGCTCTTCAAGCCAGGGGCGGG + Intergenic
1173135267 20:40433610-40433632 AAGCTTCCCCAGGCCAGGGCTGG - Intergenic
1173205576 20:40990774-40990796 AACCTATCCCAGCTCAGGGCCGG - Intergenic
1173942233 20:46921201-46921223 AAGCTCTCTGAGGCGAGGGCCGG - Intronic
1174394178 20:50235956-50235978 AAGGGCTCACAGCCAAGGGGAGG - Intergenic
1175830628 20:61963448-61963470 AAGCCCACCCAGCCAAGCACAGG + Intronic
1176115807 20:63431515-63431537 GACCTCTCTCAGCCCAGGGCAGG - Intronic
1176406603 21:6372083-6372105 AAGCTCTGCGACCAAAGGGCTGG - Intergenic
1177525669 21:22287468-22287490 AAGCCCTCCCACCAAAGGCCTGG + Intergenic
1178518235 21:33266399-33266421 AAGCTCTCCCGGGCGCGGGCGGG + Exonic
1179644351 21:42766623-42766645 GAGCTCCCGCAGGCAAGGGCTGG + Intronic
1179937347 21:44613885-44613907 AATCTCTCCCAGGCCAGGCCTGG + Intronic
1179970103 21:44831836-44831858 ATGCTTTCCTAGCCAAAGGCTGG + Intergenic
1181027402 22:20133955-20133977 AAGCACTCCATGCCTAGGGCTGG - Intronic
1181051058 22:20238528-20238550 AGGCGCTCCCATCCAAGGACAGG + Intergenic
1181792738 22:25280866-25280888 AAGATCACCCAGCCCAGAGCAGG + Intergenic
1182771573 22:32800703-32800725 GAGCTCTGTCAGCCATGGGCAGG + Intronic
1183334011 22:37236465-37236487 AAGATCTCCCAGCCAGTGGGTGG + Intronic
1184357187 22:43990187-43990209 CAGCTCTCCCAGACAAGCCCTGG - Intronic
1184552826 22:45213719-45213741 CACCACACCCAGCCAAGGGCTGG - Intronic
950547657 3:13648194-13648216 GAGCTTTTCCCGCCAAGGGCTGG + Intergenic
950573291 3:13815329-13815351 AGGCTTTTCCACCCAAGGGCAGG - Intergenic
950744268 3:15074305-15074327 AAGCGCTCCTGGCCAACGGCTGG + Exonic
951722227 3:25712430-25712452 CAGCCCTCCCACCCAAGGGAAGG + Intergenic
952931139 3:38361833-38361855 AAGCCCTCCCAGCAAAGGCTGGG + Intronic
953434856 3:42870462-42870484 CAGCTCTCACAGCCCAGGCCAGG + Intronic
954521311 3:51229113-51229135 AGACTCTCCCAGTCAAGGACAGG - Intronic
955936888 3:64110640-64110662 GAGCCCACCCAGCCAAGGGCAGG + Intronic
956791771 3:72685564-72685586 AAGAACTCCCAGCCAGGTGCAGG + Intergenic
961879768 3:130053183-130053205 CAGCTCTCCCTGCCAGGGGTGGG + Intergenic
962815322 3:138992369-138992391 AAGCTGTCCTATGCAAGGGCAGG - Intergenic
966914747 3:184578493-184578515 AAGCTCTCCCAGCCCCCTGCAGG + Intronic
968185753 3:196632719-196632741 AAGCGCTAACAGCGAAGGGCGGG - Intergenic
968991976 4:3920292-3920314 CAGCTCTCCCTGCCAGGGGTGGG + Intergenic
971418950 4:26458080-26458102 AAGCTCACTCTGCCAGGGGCAGG - Intergenic
976260062 4:83136875-83136897 CAGCTCTCCTACCCAAGGACAGG + Intronic
984636728 4:182119092-182119114 ATTCTCTCCCACCCAAGGGAGGG - Intergenic
985677925 5:1242004-1242026 AAGCACAGACAGCCAAGGGCGGG - Intronic
987049413 5:14136719-14136741 CTGCTCTCCCAGCCCTGGGCAGG + Intergenic
990438704 5:55821957-55821979 ACGCTCTCCCAGCCAGCGGCGGG + Intergenic
995289858 5:110439481-110439503 AAGAACTGCCAGTCAAGGGCAGG + Intronic
996421848 5:123271058-123271080 AAGGTCTCCTAGCCATGAGCAGG - Intergenic
998378677 5:141708550-141708572 AACCTGTCCCAGCCAAGAGGAGG + Intergenic
999904316 5:156122759-156122781 AGGCTCTCTCAGACTAGGGCTGG - Intronic
1000164898 5:158638990-158639012 AAGCTCTTCCATCAAATGGCTGG + Intergenic
1001868219 5:175124456-175124478 AAGACCTCTCAGCCAAGGTCAGG + Intergenic
1002163830 5:177332650-177332672 AGGCTCTCCCAGCCCACAGCTGG + Intronic
1002196786 5:177505388-177505410 AAGCTGGCCCAGCCAAGCCCAGG - Intronic
1002197341 5:177508623-177508645 AAACGCTCCCAGCCAGGAGCGGG + Intronic
1003991398 6:11490191-11490213 AAGTTATCCCAGCCAAGGTCAGG + Intergenic
1006983304 6:38162412-38162434 GAGCTCTCCCAGCCTAGGAGAGG - Intergenic
1009612170 6:65960009-65960031 AAATTCTCACTGCCAAGGGCAGG + Intergenic
1011627669 6:89296606-89296628 AAGCTTACCCAGGCAGGGGCAGG + Intronic
1016347614 6:143131116-143131138 AAGCTCTCCAATGCAAAGGCAGG - Intronic
1017258793 6:152363839-152363861 CAGTTATCCCATCCAAGGGCAGG - Intronic
1018669876 6:166169005-166169027 AAGCTCCCCCTTCCAAGGCCTGG + Intergenic
1018804033 6:167244933-167244955 GAGATCTCCGAGCCCAGGGCAGG + Intergenic
1018831454 6:167446703-167446725 AAGCTTGCTCAGCCAAGGGAAGG + Intergenic
1019267538 7:126916-126938 AAGCTCTCCCAGGCAGAGCCCGG - Intergenic
1019538859 7:1542513-1542535 AAGCACTGCAGGCCAAGGGCAGG - Exonic
1019664782 7:2246386-2246408 ACACTCTCCCAGCCAACGTCAGG - Intronic
1020314795 7:6897862-6897884 CAGCTCTCCCTGCCAGGGGTAGG + Intergenic
1024529456 7:50379311-50379333 AAGCTGACTCAGCCATGGGCAGG - Intronic
1025189635 7:56886872-56886894 GAGCTCCACCAGCCATGGGCAGG - Intergenic
1025682303 7:63690045-63690067 GAGCTCCACCAGCCATGGGCAGG + Intergenic
1026454310 7:70557374-70557396 CACCTCTGCCAGCCAAGGGCTGG - Intronic
1032176695 7:129635326-129635348 AAGCTCTCCCAGAGAAAGGTAGG - Intronic
1032526179 7:132579686-132579708 AAGCTGGACCAGCCACGGGCAGG + Intronic
1033589430 7:142797363-142797385 CAGGTCTCCCAGCACAGGGCCGG - Intergenic
1034997231 7:155585422-155585444 AAGCACACCCAGACCAGGGCGGG + Intergenic
1035354721 7:158270236-158270258 AGGCTCCACCGGCCAAGGGCAGG + Intronic
1035362525 7:158322837-158322859 CAGATCTCCCTGGCAAGGGCTGG + Intronic
1035743562 8:1946029-1946051 CAGCCCTCCCAGCCAAAGGGAGG - Intronic
1036710674 8:11076635-11076657 AAGCGCCCCCAGCACAGGGCAGG + Intronic
1038197285 8:25379959-25379981 AAGCTCTGCCAGCCCAGGTTCGG - Intronic
1043185657 8:77145656-77145678 AAGCTTTGCCAGCCAAGAGGAGG + Intergenic
1043428473 8:80171599-80171621 AAGCGCTCCAGGCCGAGGGCGGG - Intronic
1043827450 8:84946520-84946542 AAGCTCACTCAGCAAAGGGAGGG + Intergenic
1043976909 8:86594242-86594264 AAGCTCACCCAGGCAAGGACTGG - Intronic
1047411540 8:124628423-124628445 ATGCTTGCCCAGCCCAGGGCTGG + Intronic
1047713005 8:127570502-127570524 AAGCTCTCCCAGCACATTGCTGG + Intergenic
1048293503 8:133197877-133197899 ATCCCCTCCCAGCCATGGGCAGG - Intronic
1048305279 8:133279709-133279731 GGGCTCTCTCAGCCGAGGGCTGG - Intronic
1049060573 8:140273229-140273251 AGGCTGTGCCAGCCCAGGGCAGG + Intronic
1049665319 8:143840392-143840414 AAGGGCTCCTATCCAAGGGCTGG + Intronic
1049887312 9:36306-36328 AGCCTCTCCCACCCAAGTGCTGG + Intergenic
1050114035 9:2244543-2244565 AAACTGTCCCAGACATGGGCAGG - Intergenic
1051273715 9:15379390-15379412 CACCTCTCCCAGCCAGGGGAAGG + Intergenic
1056768877 9:89462653-89462675 AAGCTGTCCCAGCCAGATGCAGG + Intronic
1056780214 9:89543607-89543629 AAAATCACCCAGCCAAGGTCTGG + Intergenic
1056795413 9:89655574-89655596 AGGCACTGGCAGCCAAGGGCAGG - Intergenic
1057138759 9:92714166-92714188 AAGCTTTCCCAGCACCGGGCTGG + Exonic
1057245764 9:93452504-93452526 AGGCTATCCCGGGCAAGGGCTGG - Exonic
1060529578 9:124340356-124340378 AAGCTCTTGCAGCCACCGGCAGG + Intronic
1060813651 9:126623822-126623844 AAGCTCTCCCGCCCAGGGGAAGG - Intronic
1061012445 9:127963627-127963649 GAGCTCTCCCAGCCCTGGGAAGG + Intronic
1061395485 9:130341400-130341422 CAGCTCTCCCAGCCACAGCCTGG + Intronic
1061426248 9:130500186-130500208 AAGCACACTCAGCCCAGGGCCGG + Intronic
1061878555 9:133557060-133557082 CAGCACTCCCAGCCCAGGCCGGG - Intronic
1062313961 9:135956273-135956295 AAGATCTCACAGCCAACTGCTGG + Intronic
1062388910 9:136326465-136326487 CAGCTCTCCCAGGGAGGGGCTGG + Intergenic
1062391012 9:136333888-136333910 AAGCTCTCCCAGCCAGGGCCTGG - Intronic
1062656468 9:137606406-137606428 CGGCACTCACAGCCAAGGGCCGG - Intronic
1185670752 X:1807499-1807521 AAGCTCCCCCGGACAAGGACGGG - Intergenic
1187590698 X:20714054-20714076 AAGGGCTGCCAGCCAAAGGCTGG + Intergenic
1187868186 X:23742934-23742956 AGGTTCTCCCAACCAAAGGCCGG + Intronic
1193839184 X:86387973-86387995 ATGTGCTCCCAGCCAATGGCTGG + Intronic