ID: 915093768

View in Genome Browser
Species Human (GRCh38)
Location 1:153444775-153444797
Sequence TCTCACCTTCCCTGAAGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915093765_915093768 2 Left 915093765 1:153444750-153444772 CCTTCTGCTCCATCTCAGGGCTG No data
Right 915093768 1:153444775-153444797 TCTCACCTTCCCTGAAGCCCCGG No data
915093766_915093768 -7 Left 915093766 1:153444759-153444781 CCATCTCAGGGCTGCCTCTCACC No data
Right 915093768 1:153444775-153444797 TCTCACCTTCCCTGAAGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915093768 Original CRISPR TCTCACCTTCCCTGAAGCCC CGG Intergenic
No off target data available for this crispr