ID: 915095506

View in Genome Browser
Species Human (GRCh38)
Location 1:153459630-153459652
Sequence GTTCCCAAGGGAATACAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 148}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915095506_915095511 6 Left 915095506 1:153459630-153459652 CCTTCTTGTATTCCCTTGGGAAC 0: 1
1: 0
2: 0
3: 9
4: 148
Right 915095511 1:153459659-153459681 CAGGAATGGCCTCTGTTACAAGG 0: 1
1: 0
2: 2
3: 11
4: 186
915095506_915095510 -8 Left 915095506 1:153459630-153459652 CCTTCTTGTATTCCCTTGGGAAC 0: 1
1: 0
2: 0
3: 9
4: 148
Right 915095510 1:153459645-153459667 TTGGGAACGAGAAACAGGAATGG 0: 1
1: 0
2: 3
3: 32
4: 329
915095506_915095513 25 Left 915095506 1:153459630-153459652 CCTTCTTGTATTCCCTTGGGAAC 0: 1
1: 0
2: 0
3: 9
4: 148
Right 915095513 1:153459678-153459700 AAGGAACAGAAATAACTCTCTGG 0: 1
1: 2
2: 0
3: 45
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915095506 Original CRISPR GTTCCCAAGGGAATACAAGA AGG (reversed) Intronic
902578625 1:17394349-17394371 GTTCCCAATGGAATCCATGCTGG - Exonic
902922628 1:19675919-19675941 GTTAGCAAGGGAGTAAAAGAGGG - Intronic
910509884 1:87991833-87991855 TTTCCCAAAGCAAAACAAGATGG - Intergenic
912793006 1:112672046-112672068 GTTCCCAAAAGAAAACCAGAGGG + Intergenic
914967586 1:152274790-152274812 TTTCCCAAATGAAAACAAGAGGG - Intergenic
915089977 1:153417446-153417468 ATTCCCAAGGGAATGTAGGAAGG + Intronic
915095506 1:153459630-153459652 GTTCCCAAGGGAATACAAGAAGG - Intronic
916188698 1:162158159-162158181 GTTCCCAAGGGCTGGCAAGAGGG - Intronic
917014145 1:170510867-170510889 GAACCCAAGGGAACAGAAGATGG - Intergenic
1063259443 10:4369220-4369242 GTGTCAAATGGAATACAAGATGG - Intergenic
1063690431 10:8282005-8282027 GTGCTGAAGGCAATACAAGAGGG - Intergenic
1063733013 10:8721017-8721039 GTTCTCAAGAGAATACACAAAGG + Intergenic
1066557768 10:36634024-36634046 TTGTCCAAGGGAATAGAAGAAGG - Intergenic
1067320828 10:45219198-45219220 GTTCCCATGAGAGTACAATAAGG + Intergenic
1067856456 10:49797538-49797560 GTTCCCAAGGCAATTCAATGAGG + Intergenic
1068645370 10:59460669-59460691 ATTCCCAAAGGAATCCATGATGG - Intergenic
1068646127 10:59470335-59470357 CAACCCAAGGGAAGACAAGAGGG + Intergenic
1071803756 10:89093921-89093943 AATCCCAAGGAAATTCAAGATGG + Intergenic
1072388012 10:94952004-94952026 GTTGCCAAGGCAATTCAATAGGG - Intronic
1075623618 10:123946268-123946290 GGTCCCAAGGGACTACATGGAGG + Intergenic
1078096637 11:8301342-8301364 GTTCCTATGTGAAGACAAGATGG + Intergenic
1079564279 11:21862519-21862541 GTTCCCAAGGGAACAGTAGAAGG - Intergenic
1081059520 11:38456071-38456093 ATCCCAAAGTGAATACAAGAAGG + Intergenic
1082866769 11:57907213-57907235 GTTCCCAAGGACATAAAACAAGG + Intergenic
1085851936 11:80130880-80130902 GTTCCCAAGGGATTTGAAGGTGG - Intergenic
1086140321 11:83491861-83491883 GTTCAGAAGGGAAGAGAAGAAGG - Intronic
1092211339 12:6648247-6648269 GGTCCAAGGGGAAAACAAGAGGG + Intergenic
1096018669 12:48303286-48303308 GGGGCCAATGGAATACAAGAGGG + Intergenic
1098052805 12:66472313-66472335 GATCCCAAGGGGTTACTAGAAGG - Intronic
1102022248 12:109691780-109691802 GATCCAAAGGGCATATAAGATGG - Intergenic
1105806519 13:23954666-23954688 GTGCCAAAGGGAAAAGAAGATGG + Intergenic
1108951677 13:56101953-56101975 GATCACAAGGGAAGACAATAAGG - Intergenic
1109528445 13:63606703-63606725 GTTCCCATGGGATCACTAGATGG - Intergenic
1112931220 13:104740812-104740834 TCTCCCAAGGGAATTGAAGAGGG - Intergenic
1113552430 13:111203594-111203616 GTTCACAAGGAAATATCAGATGG - Intronic
1114151892 14:20050034-20050056 GTTCACAAGGGACTAAAATAAGG - Intergenic
1115149688 14:30270276-30270298 GTTTCCGAGGGAATCAAAGATGG + Intergenic
1117364068 14:55007839-55007861 CTGCCCAAGGCAATCCAAGATGG - Intronic
1120694582 14:87630500-87630522 CTTCCCAAGGGAATTCCAGATGG + Intergenic
1123507699 15:20961299-20961321 AGTCCCAAGGATATACAAGAAGG - Intergenic
1123564920 15:21535039-21535061 AGTCCCAAGGATATACAAGAAGG - Intergenic
1123601180 15:21972333-21972355 AGTCCCAAGGATATACAAGAAGG - Intergenic
1126796638 15:52265099-52265121 GCTCACAACAGAATACAAGAGGG - Intronic
1127517220 15:59707754-59707776 GTTCCAGAGGGAATAAAAAATGG - Intergenic
1128628767 15:69241137-69241159 GTTCACAAGGAAAGAAAAGATGG + Intronic
1131577097 15:93603117-93603139 GATCCCAGGGGAATAGCAGATGG - Intergenic
1202973288 15_KI270727v1_random:262152-262174 AGTCCCAAGGATATACAAGAAGG - Intergenic
1132610261 16:812402-812424 GTTCCCAAGGAGATAAATGAGGG + Intronic
1143054463 17:4152448-4152470 GGCCTCAAGGGAAAACAAGATGG + Intronic
1146030307 17:29360516-29360538 GTTCCCCAAGGAATACATGTTGG + Intergenic
1151746179 17:76013136-76013158 GTTCCCAGGTGAATAAAAGTGGG - Intronic
1156193197 18:34743790-34743812 GTTCCAAAGTCAGTACAAGAAGG - Intronic
1157791853 18:50539488-50539510 GGTCCCAAGGTAATTCAATAGGG - Intergenic
1158830462 18:61271971-61271993 GTTTCCAAGGAAACACAAAAAGG - Intergenic
1160308248 18:77761235-77761257 GATCCCAAGGGACTGGAAGAGGG + Intergenic
1162865851 19:13546401-13546423 GGTCCCAAGGAAATACAAAATGG + Intronic
1167222447 19:48210034-48210056 ATTCCAAAGGGAATAAAACAAGG + Exonic
926048369 2:9727013-9727035 GTTCCCAAGGGAAACCGAGCTGG + Intergenic
928923790 2:36555237-36555259 GTGCCAAAGGGAATACGAAAGGG - Intronic
931166398 2:59753910-59753932 GTTCCCAAGGGATAAGCAGAGGG + Intergenic
935517032 2:104052625-104052647 TTTCCCAAGGGAGAACAAAAGGG - Intergenic
935891959 2:107688518-107688540 GTGCCCAATGGAAGGCAAGAGGG + Intergenic
935949764 2:108317918-108317940 GTTCTCAAGGAAATTCATGATGG - Intergenic
943094646 2:183414265-183414287 GCTCCCAAGGAAATACAATTTGG + Intergenic
943354535 2:186835766-186835788 GTACTCAAGGGAATGGAAGATGG + Intronic
944052764 2:195490056-195490078 GTTCCCAAGGGCAAAACAGATGG - Intergenic
945631117 2:212277804-212277826 CTTGCCAAGTGAATAGAAGAAGG + Intronic
945735132 2:213589580-213589602 GTTCTCTAGGGAAGACATGATGG - Intronic
945799798 2:214414119-214414141 CCTTCCATGGGAATACAAGAGGG - Exonic
945818934 2:214639185-214639207 GTGCCCAAGAGAAGAAAAGATGG + Intergenic
945963565 2:216161905-216161927 GCACCCCAGGCAATACAAGATGG - Intronic
946531693 2:220577644-220577666 GTTCACAAGGGAAGACCTGAGGG - Intergenic
946822763 2:223647321-223647343 TTTCCCAAAGGAAGACAAGGGGG + Intergenic
947407770 2:229798602-229798624 GTTCCCCAAGGAATACAATGTGG + Intronic
1170714798 20:18822410-18822432 GTTCCCATAGGTATACAAGAGGG - Intronic
1171371467 20:24665081-24665103 GGCCCCAAGGGAATAAGAGAAGG - Intronic
1172219251 20:33261537-33261559 GAGCCCCAGAGAATACAAGAGGG + Intergenic
1174398629 20:50263657-50263679 GTCACCAAGGGAAAAAAAGAAGG + Intergenic
1182205851 22:28625526-28625548 GTTGCAAAGGTAATAAAAGAAGG + Intronic
1185173084 22:49304752-49304774 GCTCCCAAGGGACCCCAAGAAGG + Intergenic
949198114 3:1337763-1337785 CTTTCCAAGGGAATACATGTTGG + Intronic
950701397 3:14751812-14751834 CTTCTCAAGGAAATAAAAGAGGG + Intronic
951255228 3:20441046-20441068 TTTCCAAAAGGAATACAGGAAGG + Intergenic
955175177 3:56606505-56606527 CTACCCAAGGGAATCCATGAGGG - Intronic
955281543 3:57598923-57598945 GTTCACAAAAGGATACAAGAAGG - Intergenic
957500661 3:81053056-81053078 CTGCTCAAGGAAATACAAGAGGG - Intergenic
960075903 3:113484978-113485000 CTACCCAAGGGAATCCAGGAGGG + Intronic
960791300 3:121434135-121434157 GTAGCCAAGGGAAATCAAGAGGG - Intronic
962449674 3:135502548-135502570 CCTCCCATGGGAATAGAAGAAGG - Intergenic
964551164 3:157886287-157886309 GTCACCAAGGGAAAAAAAGATGG - Intergenic
966812898 3:183864203-183864225 GTGCCCATGGGAAAACAAGGAGG + Intronic
969188555 4:5498662-5498684 CATCACAAGGAAATACAAGATGG + Intronic
970634649 4:17994583-17994605 GTTCCAAAGGGAATAATACAGGG - Intronic
975770146 4:77711675-77711697 GTTGCCAAGGTAATAGAATAAGG - Intergenic
975970813 4:80034448-80034470 TTTACCAAGGGAATACAAGGGGG + Intronic
980608747 4:135127857-135127879 GTTTCCAAGGAAATGTAAGAAGG - Intergenic
980928107 4:139158765-139158787 GTTTCCAAGGGAGTCCAAGGGGG + Intronic
981169220 4:141602727-141602749 ATTGCTAAGGGAATGCAAGATGG - Intergenic
981841274 4:149115445-149115467 ACTCCCAAAGGAATACAAAATGG + Intergenic
985277881 4:188255904-188255926 TTTCCCAAGATAGTACAAGAGGG - Intergenic
985350805 4:189059032-189059054 GTCCGCAAGGAAATACAATAAGG + Intergenic
986610444 5:9561805-9561827 GTTTCCCAGGGGATACCAGATGG - Intergenic
987187325 5:15437731-15437753 GTTGCCAAGGCAATTCAATAAGG + Intergenic
987900418 5:24003695-24003717 GCTACCAGGAGAATACAAGAAGG + Intronic
987904147 5:24053544-24053566 TTTCTAAATGGAATACAAGAAGG + Intronic
988884462 5:35540286-35540308 CTTCCCAAAGGAATTCAAGTTGG - Intergenic
990520948 5:56580391-56580413 GTGGCCAAAGGAATGCAAGAAGG - Intronic
991963454 5:72068115-72068137 TGTTCCAAGGGAATACAGGAAGG + Intergenic
996112343 5:119580572-119580594 GCTCCCAGGTGAATACAATATGG + Intronic
998196361 5:140076010-140076032 ATTCCCAAGGGAATATCATAGGG - Intergenic
999231928 5:150066752-150066774 GTAGCCAAGGGGACACAAGATGG + Intronic
1000280610 5:159778646-159778668 GATGCCAGGGGAAGACAAGAGGG - Intergenic
1000484724 5:161826815-161826837 GCTCACAAGCGAATATAAGAAGG - Intergenic
1000909502 5:167005136-167005158 GTTTCCAAGGGAATATAGTATGG + Intergenic
1001752216 5:174140330-174140352 ATTCCCAAGGGAAAACGGGAGGG - Intronic
1002567845 5:180121969-180121991 GTGCGCATGGGAATACTAGACGG - Intronic
1002901214 6:1411022-1411044 GTTCCCAAAGGAACAGGAGAGGG + Intergenic
1005303886 6:24495460-24495482 GTTCCCCAGGGTATACAAAGTGG + Intronic
1005383914 6:25266737-25266759 GCTCTCAAGGGTATATAAGAGGG - Intergenic
1005397648 6:25399679-25399701 GTTCTCTAGGGATTACATGAAGG - Intronic
1007248026 6:40476371-40476393 GGTTCAAAGGGAATTCAAGACGG - Intronic
1008187679 6:48414159-48414181 GTTGGCATGGGAATCCAAGATGG - Intergenic
1011499973 6:87977201-87977223 GTTCCTAATGGAAGACCAGAGGG + Intergenic
1012850059 6:104435927-104435949 ATACCCAAAGGAATACAAGCAGG - Intergenic
1013276609 6:108591308-108591330 GTTTCCAAGGGAATACAACTTGG - Intronic
1013477251 6:110520540-110520562 GTTTCCAAGTAAATCCAAGAAGG - Intergenic
1014339660 6:120188082-120188104 GTTCCAGAGGGAATAGAACAGGG + Intergenic
1014593911 6:123308654-123308676 GTTGCAAAGGGAATTCAAGTGGG - Intronic
1015966072 6:138696177-138696199 AGTCTCAAGGGAATAGAAGAGGG - Intergenic
1017233842 6:152099448-152099470 ATTGCCATAGGAATACAAGAGGG - Exonic
1018082053 6:160267577-160267599 GCTGCCTAGGGAATACAAGGAGG + Intronic
1020839002 7:13191553-13191575 GTTTCCAAGGAAATTCAATAAGG + Intergenic
1023105899 7:36763086-36763108 TTTCCAAAGGCAATGCAAGAAGG + Intergenic
1023588643 7:41758117-41758139 GCTCCCAAGGACATAAAAGAAGG + Intergenic
1024457857 7:49629588-49629610 CTTCCCAAAGCAATACAAGTGGG + Intergenic
1026940449 7:74284841-74284863 TTTCCCAAGGGAAGATAACAAGG - Intergenic
1027514631 7:79126276-79126298 ATTCCCAAAGGAATACAACCAGG - Intronic
1030203818 7:106932650-106932672 GTTACCGAGTAAATACAAGAAGG + Intergenic
1030243471 7:107355761-107355783 GTTCAGAAGGGAATTCAAGTAGG + Intronic
1033409125 7:141100304-141100326 GTTCCAAAGGAACTAAAAGATGG - Intronic
1039201834 8:35103811-35103833 GTGCCCAAGGAAATCCAAAATGG - Intergenic
1040758933 8:50814222-50814244 TTACCCAGGGGAATACAAGACGG + Intergenic
1041878583 8:62719467-62719489 GTTCCCAAGAGAATATAACCAGG - Intronic
1046103276 8:109639020-109639042 GCTCCCATGGGAAAGCAAGAGGG + Intronic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1050289057 9:4134824-4134846 GTCCCCAAAGGAAAACAAGAAGG - Intronic
1056625247 9:88248066-88248088 GTTCCCCAGGGAATATCTGATGG - Intergenic
1056988608 9:91388722-91388744 GTTGCCAGGGGAATGCAAAACGG + Intergenic
1058066886 9:100558628-100558650 GTTCACTAAGGAATTCAAGATGG + Intronic
1058544653 9:106048033-106048055 ATTTCCAAAGGAATTCAAGATGG - Intergenic
1059085519 9:111298219-111298241 GTTCTTAAGTGAATACAAAAAGG + Intergenic
1060272077 9:122151250-122151272 GTTCCCAAAGGAAAATTAGAAGG - Intronic
1060664077 9:125422573-125422595 GTTTCCAAGGGAAGAAAAAATGG + Intergenic
1188927128 X:36057711-36057733 GTTGCCAAGAGAATAACAGAGGG - Intronic
1191070546 X:56395935-56395957 GCTCCCAAGGACATACAAGAGGG + Intergenic
1191853302 X:65602092-65602114 GATCTGAAGAGAATACAAGATGG - Intronic
1199546734 X:149014017-149014039 GTTCCCAAGTTACTACAAGGGGG + Intergenic
1201312762 Y:12611931-12611953 CTAGCCAAGGGAAGACAAGAGGG + Intergenic