ID: 915095801

View in Genome Browser
Species Human (GRCh38)
Location 1:153461259-153461281
Sequence GACCCAAGACCTATAGCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 1, 2: 0, 3: 9, 4: 76}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915095801_915095806 -1 Left 915095801 1:153461259-153461281 CCCTGTGCTATAGGTCTTGGGTC 0: 1
1: 1
2: 0
3: 9
4: 76
Right 915095806 1:153461281-153461303 CACATCAGGGTCTGCCCTATGGG 0: 1
1: 0
2: 1
3: 10
4: 88
915095801_915095814 27 Left 915095801 1:153461259-153461281 CCCTGTGCTATAGGTCTTGGGTC 0: 1
1: 1
2: 0
3: 9
4: 76
Right 915095814 1:153461309-153461331 AAAGTCCAGGGAGGGAAGCAGGG 0: 1
1: 0
2: 2
3: 61
4: 618
915095801_915095805 -2 Left 915095801 1:153461259-153461281 CCCTGTGCTATAGGTCTTGGGTC 0: 1
1: 1
2: 0
3: 9
4: 76
Right 915095805 1:153461280-153461302 TCACATCAGGGTCTGCCCTATGG 0: 1
1: 0
2: 1
3: 9
4: 130
915095801_915095812 19 Left 915095801 1:153461259-153461281 CCCTGTGCTATAGGTCTTGGGTC 0: 1
1: 1
2: 0
3: 9
4: 76
Right 915095812 1:153461301-153461323 GGGAACTCAAAGTCCAGGGAGGG 0: 2
1: 0
2: 8
3: 47
4: 425
915095801_915095811 18 Left 915095801 1:153461259-153461281 CCCTGTGCTATAGGTCTTGGGTC 0: 1
1: 1
2: 0
3: 9
4: 76
Right 915095811 1:153461300-153461322 TGGGAACTCAAAGTCCAGGGAGG 0: 2
1: 0
2: 1
3: 36
4: 301
915095801_915095810 15 Left 915095801 1:153461259-153461281 CCCTGTGCTATAGGTCTTGGGTC 0: 1
1: 1
2: 0
3: 9
4: 76
Right 915095810 1:153461297-153461319 CTATGGGAACTCAAAGTCCAGGG 0: 2
1: 0
2: 1
3: 14
4: 178
915095801_915095809 14 Left 915095801 1:153461259-153461281 CCCTGTGCTATAGGTCTTGGGTC 0: 1
1: 1
2: 0
3: 9
4: 76
Right 915095809 1:153461296-153461318 CCTATGGGAACTCAAAGTCCAGG 0: 2
1: 0
2: 0
3: 11
4: 150
915095801_915095813 26 Left 915095801 1:153461259-153461281 CCCTGTGCTATAGGTCTTGGGTC 0: 1
1: 1
2: 0
3: 9
4: 76
Right 915095813 1:153461308-153461330 CAAAGTCCAGGGAGGGAAGCAGG 0: 2
1: 1
2: 8
3: 57
4: 528

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915095801 Original CRISPR GACCCAAGACCTATAGCACA GGG (reversed) Intergenic
901510782 1:9717170-9717192 GACCCATGGCCAGTAGCACATGG - Intronic
902343179 1:15797922-15797944 GACCCAATATCTATAGCATGTGG + Intergenic
904266609 1:29321948-29321970 GTCCAGAGACCTAAAGCACATGG - Intronic
904948708 1:34218382-34218404 TGCCCAAGACCCATAGAACAGGG - Intronic
907978266 1:59454953-59454975 AACCCAAAACCTATCTCACAAGG - Intronic
912507939 1:110169335-110169357 GACCCAACACCTATCACACAGGG - Intronic
913034450 1:114949521-114949543 GACCCAAGTCACATAGCAGAAGG - Intronic
913123151 1:115760386-115760408 GACCCCAGACCAGTAGCAAATGG - Intronic
915089707 1:153415881-153415903 AACCCAAGACCTATAGCACAGGG + Intergenic
915095801 1:153461259-153461281 GACCCAAGACCTATAGCACAGGG - Intergenic
923242980 1:232103784-232103806 GAGGCAAGACCTATAGGAAATGG - Intergenic
1071674283 10:87639978-87640000 GACACAAGGCCTACAGCAAAAGG - Intergenic
1079241691 11:18726418-18726440 GAGCCAAAACCTGTACCACAAGG - Intergenic
1087129382 11:94655279-94655301 GACTTAACCCCTATAGCACAAGG + Intergenic
1088073143 11:105814134-105814156 GAATCAAGGCCTTTAGCACATGG + Intronic
1090154567 11:124424152-124424174 GATCCAAAGCCTTTAGCACATGG - Exonic
1094703516 12:32893714-32893736 GACCCAAGCATTATAGCAGAAGG + Intronic
1095385904 12:41649446-41649468 GACTCATGACTTATACCACATGG - Intergenic
1103038882 12:117678465-117678487 GACCCAAGAGCTTGACCACAGGG + Intronic
1111106162 13:83648379-83648401 AACTCAAGATCTCTAGCACAAGG - Intergenic
1111386772 13:87538218-87538240 GACCCAAAGCCTTTTGCACAAGG + Intergenic
1111683437 13:91472076-91472098 GAAACAAGACCTATTGCAGAAGG - Intronic
1112448573 13:99489350-99489372 GACTTAACCCCTATAGCACAAGG - Intergenic
1117447896 14:55822165-55822187 TAGCCAAGTCCTGTAGCACAAGG - Intergenic
1121229582 14:92346937-92346959 TACCCCAGCCCCATAGCACAGGG - Intronic
1122100162 14:99402137-99402159 GACTGAAGACCTTTAGCATAGGG - Intronic
1129669702 15:77600573-77600595 GACCCAACACCTATGGGGCACGG - Intergenic
1131071269 15:89467640-89467662 GACTTAACTCCTATAGCACAAGG + Intergenic
1136124707 16:28169598-28169620 TTCCCAACACCTATAGCCCAGGG - Intronic
1138462360 16:57158022-57158044 CCCCCAGGACATATAGCACAGGG + Intronic
1140827331 16:78718903-78718925 GACTCATGACCTAAAGAACATGG + Intronic
1147391015 17:40109181-40109203 GACCGAAGACCTAAAGCAGTGGG - Intergenic
1149893780 17:60413239-60413261 GACCCCAGTTCTATAACACAGGG - Intronic
1153737181 18:8083085-8083107 GGGCCTAGAGCTATAGCACAAGG - Intronic
1157622969 18:49026748-49026770 GACCAAGGAGCTATGGCACAGGG - Intergenic
1161558477 19:4957663-4957685 GCCCCAAGGCCCACAGCACAGGG - Intronic
1162554392 19:11377908-11377930 GACTCAAGACTTATGGAACAGGG - Exonic
1162931908 19:13961674-13961696 GCCCCAAAAGCTATAGCACGCGG + Exonic
1167353769 19:48991576-48991598 GGCCCCAGACCTCTAGCTCAGGG + Intronic
929050872 2:37835671-37835693 GACCCAAACCCTAGAGCACTAGG + Intergenic
935657447 2:105436973-105436995 TTCCCATGACCTAAAGCACAGGG - Intronic
937723791 2:125135116-125135138 TACACAAAACCTATACCACAAGG - Intergenic
937872904 2:126798657-126798679 GACACCAGACTTAAAGCACAGGG + Intergenic
941187674 2:162337277-162337299 GACACATGACTTTTAGCACACGG - Intronic
945205825 2:207331153-207331175 GAGCAATGAGCTATAGCACAGGG + Intergenic
949042714 2:241856916-241856938 CACCCATGACCCAAAGCACACGG + Intronic
1169157983 20:3350047-3350069 GGCCCTAGACATAAAGCACAAGG + Intronic
1170628089 20:18044732-18044754 TACCCCAGACCTACAGCACCAGG + Intronic
1172772459 20:37389512-37389534 GCCCCAAGACCTGGAGCACATGG - Intronic
1174381157 20:50156142-50156164 GATCCAAGACCTAAAGGATATGG + Intergenic
1174589083 20:51630922-51630944 GACCCAGGGCTTATACCACAGGG - Intronic
1177754837 21:25334033-25334055 GACCCAGGACTTATATCTCAAGG + Intergenic
1179566074 21:42250062-42250084 GACCCAAGACACACAACACACGG - Intronic
1182422809 22:30256788-30256810 GGCCCAAGGCCAAAAGCACAGGG + Intergenic
949276194 3:2284886-2284908 GATCCAAAACATATACCACAGGG + Intronic
949895908 3:8767579-8767601 GACCCAAGGCCTACATCACATGG - Exonic
956292632 3:67677408-67677430 GACCCAAGACCAAAAGCAACAGG - Intergenic
961196663 3:125007717-125007739 GGGCCACCACCTATAGCACATGG - Intronic
962916981 3:139912977-139912999 GACACAACAGCTATAGCACAGGG - Intergenic
963257390 3:143159239-143159261 CACCCAAGCCCTATAGCAGAGGG - Intergenic
963821847 3:149905585-149905607 GACTCAAGACCAACAGCCCAAGG - Intronic
966642555 3:182206745-182206767 GACACAACACCTATGGCAGATGG + Intergenic
968955163 4:3715382-3715404 GACCCAGGAACTACAGCACAGGG - Intergenic
969900345 4:10343656-10343678 TACCTAAGACATATAGCACTTGG - Intergenic
970848877 4:20577697-20577719 GACTGATGATCTATAGCACAGGG - Intronic
971785673 4:31099251-31099273 AACTCAAGACCTACAACACAGGG - Intronic
975492343 4:75002832-75002854 GACCCAAGACTAATGGGACAAGG - Intronic
978235470 4:106452734-106452756 TTCCCAAGTCCTATAACACAGGG - Intergenic
981186735 4:141812542-141812564 AACCCCACACCTATAGCACATGG - Intergenic
995297864 5:110540950-110540972 GACTTAACGCCTATAGCACAAGG + Intronic
1003439749 6:6128596-6128618 GGCCCAAGACGTATAAGACAAGG - Intergenic
1007776840 6:44228690-44228712 GCCCCAAGCCCTATACCTCAAGG - Intronic
1009169111 6:60377151-60377173 GACCTAAAAGCTTTAGCACATGG + Intergenic
1009620036 6:66063725-66063747 TCCACAAGACCTACAGCACATGG - Intergenic
1024541428 7:50478073-50478095 GACCACAGACGTACAGCACAAGG - Intronic
1028880726 7:95876802-95876824 GACACAAGAGATAGAGCACATGG + Intronic
1034377293 7:150657302-150657324 GACTTAACCCCTATAGCACAAGG - Intergenic
1040747645 8:50664643-50664665 TACCCAAGGCCTTTAGCCCAGGG + Intronic
1041793799 8:61725043-61725065 GACCCCAGAGCTATAGTACAGGG + Intergenic
1048472626 8:134717197-134717219 GACCCAAGACTTCATGCACATGG + Intergenic
1049321599 8:141999714-141999736 GACCCCACACCGATGGCACATGG - Intergenic
1050289245 9:4136970-4136992 GCGCCACTACCTATAGCACAAGG - Intronic
1058095211 9:100852369-100852391 GACCTGAGACCTAAAGCACGAGG - Intergenic
1061077369 9:128349856-128349878 GCCCCAAGTCATAGAGCACAGGG - Intronic
1187191511 X:17039730-17039752 GACCACACACCTATGGCACATGG - Intronic
1194695755 X:97047674-97047696 GAACCAAGACTTAAAACACAAGG - Intronic
1197794574 X:130285595-130285617 GACTCAACCCCTATAGCACAAGG + Intergenic