ID: 915098892

View in Genome Browser
Species Human (GRCh38)
Location 1:153484495-153484517
Sequence CCTAATTCCCAGAGTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915098892_915098900 12 Left 915098892 1:153484495-153484517 CCCTCCTCACTCTGGGAATTAGG No data
Right 915098900 1:153484530-153484552 CACGCCCCCGCTGTCAGCCCAGG No data
915098892_915098901 13 Left 915098892 1:153484495-153484517 CCCTCCTCACTCTGGGAATTAGG No data
Right 915098901 1:153484531-153484553 ACGCCCCCGCTGTCAGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915098892 Original CRISPR CCTAATTCCCAGAGTGAGGA GGG (reversed) Intergenic
No off target data available for this crispr