ID: 915103149

View in Genome Browser
Species Human (GRCh38)
Location 1:153515128-153515150
Sequence AGGTGGGTGCAGAGGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915103149_915103163 12 Left 915103149 1:153515128-153515150 CCTCCTTCCCTCTGCACCCACCT No data
Right 915103163 1:153515163-153515185 GTGCCGGCCTCCAGGCAGGGTGG No data
915103149_915103162 9 Left 915103149 1:153515128-153515150 CCTCCTTCCCTCTGCACCCACCT No data
Right 915103162 1:153515160-153515182 GGTGTGCCGGCCTCCAGGCAGGG No data
915103149_915103161 8 Left 915103149 1:153515128-153515150 CCTCCTTCCCTCTGCACCCACCT No data
Right 915103161 1:153515159-153515181 AGGTGTGCCGGCCTCCAGGCAGG No data
915103149_915103156 -4 Left 915103149 1:153515128-153515150 CCTCCTTCCCTCTGCACCCACCT No data
Right 915103156 1:153515147-153515169 ACCTGCCCTGTGAGGTGTGCCGG No data
915103149_915103164 13 Left 915103149 1:153515128-153515150 CCTCCTTCCCTCTGCACCCACCT No data
Right 915103164 1:153515164-153515186 TGCCGGCCTCCAGGCAGGGTGGG No data
915103149_915103168 23 Left 915103149 1:153515128-153515150 CCTCCTTCCCTCTGCACCCACCT No data
Right 915103168 1:153515174-153515196 CAGGCAGGGTGGGCACCCATTGG No data
915103149_915103170 30 Left 915103149 1:153515128-153515150 CCTCCTTCCCTCTGCACCCACCT No data
Right 915103170 1:153515181-153515203 GGTGGGCACCCATTGGGCACTGG No data
915103149_915103160 4 Left 915103149 1:153515128-153515150 CCTCCTTCCCTCTGCACCCACCT No data
Right 915103160 1:153515155-153515177 TGTGAGGTGTGCCGGCCTCCAGG No data
915103149_915103169 24 Left 915103149 1:153515128-153515150 CCTCCTTCCCTCTGCACCCACCT No data
Right 915103169 1:153515175-153515197 AGGCAGGGTGGGCACCCATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915103149 Original CRISPR AGGTGGGTGCAGAGGGAAGG AGG (reversed) Intergenic
No off target data available for this crispr