ID: 915106581

View in Genome Browser
Species Human (GRCh38)
Location 1:153538481-153538503
Sequence AAGGAGAGACGCCCAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 360}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915106581_915106585 -3 Left 915106581 1:153538481-153538503 CCCTCCTCTGGGCGTCTCTCCTT 0: 1
1: 0
2: 2
3: 32
4: 360
Right 915106585 1:153538501-153538523 CTTCTGTAATTAATCCCTGCTGG 0: 1
1: 0
2: 1
3: 18
4: 113
915106581_915106586 5 Left 915106581 1:153538481-153538503 CCCTCCTCTGGGCGTCTCTCCTT 0: 1
1: 0
2: 2
3: 32
4: 360
Right 915106586 1:153538509-153538531 ATTAATCCCTGCTGGACCTGTGG 0: 1
1: 0
2: 0
3: 11
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915106581 Original CRISPR AAGGAGAGACGCCCAGAGGA GGG (reversed) Intronic
900410546 1:2510629-2510651 GAGCAGAGAAGCCCAGGGGAAGG + Intronic
900869457 1:5291608-5291630 TAGGAGAGAAAACCAGAGGAAGG + Intergenic
900913280 1:5617274-5617296 AAGGAGAGGTGCACAGTGGAGGG + Intergenic
901295383 1:8157112-8157134 TGGAAGAGACGCACAGAGGAAGG - Intergenic
901651617 1:10746465-10746487 TAGGAGAAGCTCCCAGAGGAAGG + Intronic
902035623 1:13456069-13456091 AGGCATAGATGCCCAGAGGAGGG + Intergenic
902556989 1:17252761-17252783 AATGACAGAGGCCCTGAGGATGG - Intronic
902770359 1:18642419-18642441 GAGGAGAGACCCCCAAAGAAAGG + Intronic
903270545 1:22185573-22185595 AAGGAGAGGGCCCCAGTGGAGGG - Intergenic
904266654 1:29322173-29322195 GAGGGGAGAGGCCCAGAGGGAGG + Intronic
904964749 1:34362983-34363005 ATGGAGAGAAGCCCAGAGGCAGG + Intergenic
905823905 1:41015181-41015203 CAGGAGAAACGGCCAGAGGCAGG + Intergenic
907248621 1:53123344-53123366 CTGGAGAGAGGCCCACAGGATGG - Intronic
910359196 1:86397326-86397348 AAGGAGAAGTGCCCAGTGGAGGG - Intergenic
914915468 1:151816545-151816567 ATGGAGAGGAGACCAGAGGATGG + Intronic
915041639 1:152972518-152972540 CAGGAGAGAAGCCCAGAGCAGGG - Exonic
915106581 1:153538481-153538503 AAGGAGAGACGCCCAGAGGAGGG - Intronic
915476332 1:156154778-156154800 AAGGAGAGAGGAACAGAGGAGGG + Intronic
915939856 1:160112247-160112269 AAGGAGAGATGCCCAGAGGGGGG + Intergenic
916028476 1:160855843-160855865 AAGGAGACAAGTACAGAGGATGG + Intronic
916838926 1:168579411-168579433 AAGGAAAGATGGCCAAAGGAAGG - Intronic
921538132 1:216377939-216377961 AAGGAGAGAGGAACAGGGGAGGG + Intronic
921692476 1:218165691-218165713 GAGGAGAAACAGCCAGAGGACGG + Intergenic
922824015 1:228504568-228504590 ATGCAGAGACACCCAGAGGGAGG + Intergenic
922870790 1:228900356-228900378 CAGGAGAGCTGGCCAGAGGATGG - Intergenic
923363229 1:233233715-233233737 AAGGAGAGAGGCAGGGAGGATGG + Intronic
923734864 1:236596475-236596497 AAGGAGAAACGCTGAGAGGCAGG + Intronic
924740079 1:246789842-246789864 AGGGAGAGACGCAGACAGGAGGG + Intergenic
1062964796 10:1598872-1598894 AAGGAGTGAAGCCCAGGGGAGGG + Intronic
1063051813 10:2457744-2457766 GAGGAGAGGCACCCTGAGGAGGG + Intergenic
1063489275 10:6448080-6448102 AACAAAAGACGCCCAGAGGTGGG + Intronic
1065439268 10:25733296-25733318 AAGGAGAGGTGCCAAGAAGAAGG - Intergenic
1065828134 10:29590220-29590242 AAGGAGAGAGTCCCAGGGGCTGG - Intronic
1066247541 10:33597974-33597996 AAGTATAGACCCCAAGAGGATGG + Intergenic
1067750168 10:48966474-48966496 GGGGAGAGATGCCCAGAGGAGGG - Intronic
1069785836 10:70987487-70987509 AAGGTGGGAAGCCCAGAGGCCGG - Intergenic
1069816418 10:71197526-71197548 AAGGAGAGATGCCAAGTGAAGGG - Intergenic
1071142558 10:82527793-82527815 AAGGAGAGACGGAGAGAGGGAGG - Intronic
1071525771 10:86357302-86357324 AAGGACAGTATCCCAGAGGAAGG + Intronic
1071852673 10:89590901-89590923 AAGGAGAGAGGACCAGAGGGAGG + Intronic
1073072195 10:100801718-100801740 AACGAGGGATGCCGAGAGGAAGG + Intronic
1073217840 10:101846344-101846366 CAGGAGAGGCTGCCAGAGGAGGG + Exonic
1073505329 10:103982810-103982832 ATGAAGAGATGACCAGAGGACGG + Intronic
1074169325 10:110918358-110918380 AAGGAGAGACGCGGAAAGGGGGG + Intronic
1075317448 10:121464424-121464446 AAGGATGGAGGCCCAGAGAAGGG - Intergenic
1075600199 10:123761944-123761966 CATGACAGACGCCCGGAGGAGGG - Exonic
1075903815 10:126063861-126063883 GAGGAGAGACACGCAGGGGATGG + Intronic
1076290341 10:129340853-129340875 AAGGAGAGAGGCACAGAAGGAGG - Intergenic
1076407421 10:130221927-130221949 ATGGAGACACACCCAGAGGCCGG - Intergenic
1076729241 10:132429959-132429981 CAGAAGAGACGCCCAGTGGAGGG - Intergenic
1076873563 10:133205142-133205164 GAGGAGGGGCGCCCTGAGGATGG - Intronic
1076910299 10:133384622-133384644 AATGGGAGACCCACAGAGGAAGG + Intronic
1078494997 11:11809024-11809046 AAGGAGTGACTCCTAAAGGAAGG - Intergenic
1079240649 11:18720152-18720174 AAGAAGAAAGGCCAAGAGGAAGG + Intronic
1079967196 11:26994194-26994216 AAGGGGAAACTCCGAGAGGAGGG + Exonic
1080389830 11:31834664-31834686 AGAGAGAGAAGCCCAGAGGGAGG - Intronic
1081710410 11:45212401-45212423 AAGGAGGGAGGCCCAGGGGTTGG - Intronic
1083841902 11:65309349-65309371 ATGGAGAAACACCCAGAGCAGGG - Intergenic
1084574936 11:69983009-69983031 AAGGAGAAATGCACAGAGGGAGG + Intergenic
1084789375 11:71463708-71463730 AAGGAGAGAGACGCAGAGGGTGG + Intronic
1089686051 11:120147458-120147480 AAGCTGAGACGCACAGAGGGTGG - Intronic
1089780997 11:120873201-120873223 AAGGAGAGGAGGGCAGAGGAGGG - Intronic
1090399926 11:126442678-126442700 GAGGGGGGACGCCCAGTGGATGG - Intronic
1090425899 11:126606897-126606919 AAGGGGAGAAGCTCAGATGATGG + Intronic
1090649918 11:128797527-128797549 AAGAAGAGAAAACCAGAGGAGGG - Intronic
1090727008 11:129537394-129537416 AAGGAGAGTGGACAAGAGGATGG - Intergenic
1091910583 12:4227299-4227321 GTGGAGAGAGGCCAAGAGGAGGG - Intergenic
1092009442 12:5097315-5097337 AAGGAGAGAGCACCAGAGGATGG - Intergenic
1092216698 12:6688852-6688874 AAGGAGGGACGTCCCAAGGAAGG - Intronic
1098241080 12:68467884-68467906 GAGAAGAGACGCACAGGGGAAGG - Intergenic
1101412324 12:104479892-104479914 AGGGAGAGAGGTCCAGCGGAGGG + Intronic
1101473444 12:105021014-105021036 AAGGACAGAGGCCCTGAGGCAGG + Exonic
1102250083 12:111380837-111380859 AAAGAGTGAAGCCCAGAGCAGGG - Intergenic
1102857609 12:116307657-116307679 AAGGAGCGACATCCAGAGAAAGG - Intergenic
1103609020 12:122110003-122110025 AATGAGAGGCACCCAGAGCAGGG - Intronic
1103760059 12:123242772-123242794 AAGGCGAGACTCCCAGACAAAGG - Intronic
1103935624 12:124475015-124475037 GAGGACAGAGGCCCTGAGGATGG - Intronic
1104092138 12:125526150-125526172 AAGGCAGGAGGCCCAGAGGAGGG - Intronic
1106371612 13:29139882-29139904 ATGGAGAGAGCGCCAGAGGAAGG - Intronic
1107656646 13:42598454-42598476 AAGAAGAGATGAACAGAGGAAGG + Intronic
1111488603 13:88938547-88938569 AAGGAGGGAGGGACAGAGGAAGG + Intergenic
1113379846 13:109794091-109794113 CAGGAGAGACGCACAGAGGAGGG - Intergenic
1113414375 13:110116906-110116928 AGGGAGAGAGGCTCAGAGGCAGG + Intergenic
1113785308 13:112999310-112999332 CAGGAGAGACGCACAGAAGAGGG + Intronic
1115730628 14:36265623-36265645 AAGGAGAAATGCCCAGAAAAGGG + Intergenic
1116783276 14:49260244-49260266 AAGAAGAGAATCCCAGAAGAGGG - Intergenic
1118073404 14:62271146-62271168 AAGGAGAGAGGGTGAGAGGATGG - Intergenic
1118393829 14:65318804-65318826 CATGAGAGAAGCCTAGAGGAGGG + Intergenic
1119463613 14:74833882-74833904 AAGGAGAGAGAACCAGAGCATGG - Intronic
1119918752 14:78426717-78426739 CATGAGAGGTGCCCAGAGGAAGG - Intronic
1120645139 14:87065021-87065043 CAGGAGAGAGAGCCAGAGGAGGG + Intergenic
1121732861 14:96198279-96198301 AGGGATAGACGGACAGAGGAAGG + Intergenic
1121800340 14:96769182-96769204 AGGGAGAGAGGGACAGAGGAAGG - Intergenic
1121874133 14:97435328-97435350 GAGGAGAGACGCAGGGAGGAAGG - Intergenic
1122059925 14:99130169-99130191 ACAGAGAGACGGCGAGAGGATGG - Intergenic
1122257596 14:100490431-100490453 AAGGAAGGATGCCCACAGGAGGG - Intronic
1122891420 14:104733867-104733889 AAGGAGAGAGGGCAACAGGAAGG + Intronic
1122935384 14:104953556-104953578 GAACAGAGACGCACAGAGGAAGG - Exonic
1122983194 14:105200691-105200713 ATGGAGAAGGGCCCAGAGGATGG - Intergenic
1125675421 15:41499794-41499816 AAGAGGAGAGGTCCAGAGGATGG + Intronic
1127391293 15:58506966-58506988 AAGGAGAAATGCCCAGCGAAGGG + Intronic
1128607912 15:69051061-69051083 AAGGAGAGATGCAGGGAGGAGGG - Intronic
1129657511 15:77533986-77534008 AGGGAGAGAGGCCCCAAGGAGGG + Intergenic
1129717541 15:77860850-77860872 AAAGAAGGACCCCCAGAGGAGGG + Intergenic
1130050346 15:80479062-80479084 ACTGAGAGAGGCTCAGAGGAGGG - Intronic
1130559516 15:84947138-84947160 AAGGACACAGGCCCTGAGGATGG - Intergenic
1131842498 15:96452287-96452309 ATGGAGAGATGACCAGAGGAAGG + Intergenic
1132588073 16:714899-714921 AAGGAGAGACGCACAGCGCGGGG + Intronic
1133235790 16:4386815-4386837 GCTGAGAGCCGCCCAGAGGAGGG - Intronic
1133762949 16:8814302-8814324 AGGCAGAGGGGCCCAGAGGATGG - Intronic
1134668008 16:16033635-16033657 AAAGAAAGACGACCAGAAGAAGG - Intronic
1134772325 16:16820487-16820509 AAGGACAGACACCCTGAGGTGGG - Intergenic
1136003171 16:27311682-27311704 AGGGAGAGAAGGCCACAGGAAGG - Intergenic
1137048422 16:35688852-35688874 AAGGAGAGACTCCCAGCCGACGG - Intergenic
1137932059 16:52598212-52598234 AAGGAGAGAAGCCCAAAGAGGGG + Intergenic
1140125028 16:72111631-72111653 AAGGAGAGATGCATAGAGCAAGG + Intronic
1140223423 16:73059865-73059887 AAGGAGAGAGGAAGAGAGGAGGG + Intergenic
1140479466 16:75254613-75254635 AAGGAGAGACGCCCTGAATAAGG + Intronic
1140485085 16:75287367-75287389 AGGGAGAGAGGCCCCAAGGAGGG + Intergenic
1141360728 16:83392948-83392970 GAGGGGAGAGGCCCAGGGGAGGG + Intronic
1142618391 17:1150095-1150117 TGGGAGAGACACCGAGAGGAAGG + Intronic
1142810428 17:2393333-2393355 AGGGAGCGACGCCCAAAGGGAGG + Intronic
1145083186 17:19912827-19912849 AAGGAGAGAAAGGCAGAGGAAGG + Intronic
1145997048 17:29110807-29110829 AAGGAGAGAAAGCCAGAGGTGGG + Intronic
1147648380 17:42048048-42048070 AAGGAGTGATGGACAGAGGAAGG - Intronic
1148147035 17:45372550-45372572 AAGGAGAGCTTCCCAGAGGAAGG - Intergenic
1148756627 17:49976524-49976546 AAGGAGAGGGGGCCAGAGGGGGG - Intergenic
1148806829 17:50268137-50268159 AAGGAGGGGGCCCCAGAGGAAGG + Intergenic
1149066826 17:52490464-52490486 AAGGAGAGACACCAAAAGAAAGG + Intergenic
1150128632 17:62654165-62654187 AGGGAGAGAGGCTCAGAGGCTGG + Intronic
1151557380 17:74853337-74853359 AAAGAGAGACAGACAGAGGAGGG + Intronic
1151660609 17:75516294-75516316 CTGGAGAGAAGCCCCGAGGAGGG + Intronic
1151703948 17:75757138-75757160 AAGGAGGCACGGCCCGAGGAGGG - Intronic
1152299147 17:79485239-79485261 CAGGGGAGGCGCCCACAGGAAGG + Intronic
1152343708 17:79739018-79739040 AAGAAGAGACGGCCACAGGCAGG + Intronic
1152511263 17:80790608-80790630 AAGGACAGTGGCCCAGGGGAGGG - Intronic
1153421266 18:4907985-4908007 AAGGAGGGACACGCAGAAGAGGG + Intergenic
1153966713 18:10189295-10189317 AAGGAGAGATGATTAGAGGAAGG + Intergenic
1155256743 18:24004522-24004544 AAGGAGACACGCCCACACTAAGG - Intronic
1156086205 18:33406772-33406794 AAGGAGAGGCCCCCAAAGAAAGG + Intronic
1156218588 18:35027935-35027957 ATGTAGAGAGGCCCAGAGGGTGG - Intronic
1156510792 18:37634901-37634923 GAGGACAGAAGCCCAAAGGAGGG - Intergenic
1157121057 18:44911591-44911613 ATGGTGAGACACCCAGAGGGTGG - Intronic
1157784316 18:50468499-50468521 AAGGAGATGTGACCAGAGGAAGG - Intergenic
1157805058 18:50651615-50651637 AAGGAGGCACCCACAGAGGAGGG + Intronic
1159285059 18:66337671-66337693 AAGGAAAGAAGCACAGAAGAGGG - Intergenic
1160146833 18:76372046-76372068 CAGGAGAGAGGGCCAGAGGTGGG - Intronic
1162046277 19:8002447-8002469 AGGGAGAGTCGTTCAGAGGAGGG + Intronic
1162837239 19:13328612-13328634 AAGGAAATACGCCCAAAGGGTGG + Intronic
1163127509 19:15252163-15252185 AAGCAGAGGAGCCCAGAAGAGGG + Intronic
1164418347 19:28065212-28065234 AAGGGGAGAAGCACAGAGGCAGG - Intergenic
1164654330 19:29909960-29909982 AAGGAGGGACGGAGAGAGGAGGG - Intergenic
1166219253 19:41354255-41354277 CAGGGGAGCCGACCAGAGGAGGG + Intronic
1166678927 19:44755994-44756016 AAGCAGAGAAGCCATGAGGATGG + Intronic
1166750081 19:45160373-45160395 AAGGAGGGATGGCCAGAGGAGGG + Intronic
1167108520 19:47445546-47445568 GAGGAGAGACACCCAGAGATGGG - Intronic
1167153933 19:47726607-47726629 AGGGAGAGAGGAACAGAGGAAGG - Intronic
1167264622 19:48477543-48477565 AGGGAAAGACGCAGAGAGGAGGG - Intronic
1167315760 19:48761962-48761984 AGGGACAGAGACCCAGAGGAAGG + Intergenic
1167409164 19:49334951-49334973 GAGGACAGAGACCCAGAGGAGGG + Intergenic
1167579139 19:50331788-50331810 AAAGAGAGAGACCCAGAAGAAGG - Intronic
1167587562 19:50383607-50383629 AAGGAGAGACGCCAGGAGTTCGG + Intergenic
1167775224 19:51550213-51550235 CAGGAGAGAGCCCCAGAGGCAGG - Intergenic
1168283128 19:55316671-55316693 AAAGAGTGAGGCCCAGAGAAAGG + Intronic
1168357677 19:55712744-55712766 GAGGAGAGAAGAGCAGAGGACGG + Intronic
1168498514 19:56874305-56874327 AATGAGAGACCACCAGAGTAAGG + Intergenic
925212743 2:2064121-2064143 GAGGGGAGAAGCCCAGAGAAAGG + Intronic
925542452 2:4980335-4980357 AAGGAGAGACAAGCAGAGAAAGG + Intergenic
925562442 2:5211506-5211528 AAGCAGAGACAACCAGAGAAGGG + Intergenic
925631885 2:5902738-5902760 AAAGAGAGAGTCCCAGAGGGTGG + Intergenic
925910266 2:8569326-8569348 AAGGAGAGGGGCCGGGAGGAAGG + Intergenic
925943223 2:8839163-8839185 AAGGAGGTAAGCACAGAGGATGG + Intergenic
927475969 2:23414449-23414471 TAGGAGAGACCCCCAGTGGCAGG + Intronic
928368620 2:30722630-30722652 AAGGTGAGGCCCACAGAGGATGG - Intergenic
929876540 2:45801345-45801367 AAGGGGAGAAGGCCAGAGGAGGG + Intronic
931228763 2:60356458-60356480 AAGGAGAGCCACCCAGATGCGGG - Intergenic
932017917 2:68051673-68051695 AAGGAGAGAAGCCCAAAGGGAGG - Intronic
934082871 2:88484264-88484286 CAGGAGAGAAGCCCAGTGAATGG - Intergenic
934551746 2:95267112-95267134 GGGGAGAGACGGCCAGAGGCAGG + Intergenic
934775565 2:96934976-96934998 AAGGAGAGGTGCCCTGGGGATGG - Intronic
935593951 2:104865247-104865269 AGGGAGAGTTGTCCAGAGGAAGG + Intergenic
936282227 2:111152213-111152235 AAGGAGACAGGCCCAGGGGATGG - Intronic
937757924 2:125563348-125563370 TTGGAGAAAGGCCCAGAGGAAGG - Intergenic
938320028 2:130356312-130356334 ACGGAGAGACCCCCCGAGGCGGG - Intronic
938783554 2:134606471-134606493 CAGGAGAGACTCGAAGAGGAGGG - Intronic
942489061 2:176471698-176471720 AAAGAGAGAGGGACAGAGGAAGG - Intergenic
944667170 2:201967900-201967922 AAGGAGAGAGGCTTAGAGGCTGG - Intergenic
946334627 2:219028763-219028785 AAGAACAGAAGCCCAGAGGGAGG - Intronic
947906941 2:233771755-233771777 AAGGAGAGAGGGACGGAGGAAGG - Intronic
948127681 2:235576764-235576786 ATGGAGAGATGCCCAGCGTAAGG + Intronic
948389492 2:237601797-237601819 TTGGGGAGTCGCCCAGAGGAGGG - Intergenic
948561537 2:238857032-238857054 AAGCAGAGGCCCCCAGAGGAAGG + Intronic
948577573 2:238964639-238964661 GAGGAGAAACGCAGAGAGGAAGG + Intergenic
948876365 2:240831888-240831910 CAGCAGAGACGCCCCGAGGGTGG + Intergenic
948921481 2:241067950-241067972 AAGAAGGGACACCCAGAGCATGG + Intronic
949065514 2:241987962-241987984 AAGGAAACCCACCCAGAGGAGGG + Intergenic
1169220872 20:3822034-3822056 CAGGAGAGGCGACCACAGGAAGG - Intronic
1170283637 20:14680158-14680180 AAGGAGAGAGTCACAGATGAAGG + Intronic
1170296538 20:14832390-14832412 AAGGAGGGAGGTACAGAGGAGGG + Intronic
1171036534 20:21716778-21716800 AAGGAGACAGGCTGAGAGGATGG - Intronic
1171771455 20:29325774-29325796 AAGGAGAGAAGAACAGAGGGAGG + Intergenic
1172205009 20:33157057-33157079 GAGGAGAGAGGCCCAGAGAGAGG - Intergenic
1172320636 20:33993366-33993388 ATGGAGAATCGCCCAGAGGGCGG - Intergenic
1172998659 20:39090074-39090096 AAGGAGAGAAGTCCAGAGGCTGG + Intergenic
1173270001 20:41525230-41525252 AAGGAATGACACCCACAGGAAGG - Intronic
1173563540 20:44023009-44023031 AGGAAGAGAAGGCCAGAGGAGGG + Intronic
1173793707 20:45844157-45844179 AAGGAAACAGGCCCAGAGAAGGG + Intronic
1173858914 20:46269321-46269343 ATGGAGAGAGGCCCAGAGAGGGG + Intronic
1175243133 20:57564372-57564394 AAGGAGTGGAGCTCAGAGGATGG + Exonic
1175311103 20:58012082-58012104 GAGGAGAGACACACAGAGAAGGG + Intergenic
1177173837 21:17682545-17682567 AAGGATAGAGGCTCAGAGCATGG + Intergenic
1178285551 21:31322607-31322629 AAGTAGAAACACCCACAGGAGGG - Intronic
1179633931 21:42695486-42695508 GAGGGGAGAGGGCCAGAGGACGG + Intronic
1179914448 21:44467309-44467331 ATGGAGAGACGTCCAGGGGGAGG + Intergenic
1180923806 22:19538248-19538270 AAGGAGAGACGGAGAGAGGGAGG + Intergenic
1180953135 22:19729776-19729798 ACGGAGAGCCGGCAAGAGGAGGG - Intergenic
1181004158 22:20001958-20001980 CAGGAGAGATGACAAGAGGATGG + Intronic
1181061535 22:20284272-20284294 AAGGGGAGGCATCCAGAGGAAGG + Intergenic
1181627731 22:24133064-24133086 AAGGAGAGACAGGCAGAGGAGGG - Intronic
1182053746 22:27333391-27333413 ATGGAGAGACCCCCAGGGTAAGG - Intergenic
1182943169 22:34297672-34297694 AAGGAGAGCAGGCCAGGGGAGGG - Intergenic
1183379263 22:37482791-37482813 AGGGAGAGAGGCTCAGAGGGTGG - Intronic
1183545709 22:38454094-38454116 AGGGAGGGAGGCCCAGAGAAGGG - Intronic
1183900645 22:41003342-41003364 AAGAAGAGTGGCCCAGAGAAAGG - Intergenic
1184128063 22:42501436-42501458 GAGTGGAGACTCCCAGAGGAGGG - Intergenic
1184136854 22:42554749-42554771 GAGTGGAGACTCCCAGAGGAGGG - Intronic
1184485584 22:44776851-44776873 AGGGAGAGGCTCCCAGTGGAAGG - Intronic
1184669003 22:46003145-46003167 GAGAAGACCCGCCCAGAGGAAGG + Intergenic
1185062178 22:48612755-48612777 CAGGAGAGACCCCCATGGGAAGG - Intronic
1185398679 22:50605084-50605106 AAGGGGGGTGGCCCAGAGGAAGG + Intronic
949232707 3:1770683-1770705 TAAGAGAGAAGGCCAGAGGAAGG - Intergenic
950430755 3:12949655-12949677 AAGGTTAGTCACCCAGAGGAAGG + Intronic
950441531 3:13013614-13013636 AAGGAGAGTAGGGCAGAGGAAGG - Intronic
952000565 3:28781115-28781137 ATGGAGAGAGGGCAAGAGGAAGG + Intergenic
952343710 3:32465899-32465921 AAGGAGGCAAGCCCAGAGAAAGG + Intronic
952971288 3:38651757-38651779 GGGGAGAGAAGCCCAGGGGATGG + Intergenic
953228539 3:41043244-41043266 AGGGTGAGACTCCCAGAGAATGG + Intergenic
953553530 3:43923878-43923900 AGGGAGAGAGGCCCGCAGGAGGG - Intergenic
954372447 3:50175974-50175996 AAGGAGAGAGGAACAGAGGCAGG - Intronic
954629551 3:52040548-52040570 AGGGAGAGAGGGCCAGAGAAGGG + Intergenic
954629582 3:52040656-52040678 AGGGAGAGAGGGCCAGAGAAGGG + Intergenic
954629598 3:52040710-52040732 AGGGAGAGAGGGCCAGAGAAGGG + Intergenic
954629615 3:52040764-52040786 AGGGAGAGAGGGCCAGAGAAGGG + Intergenic
955080594 3:55654859-55654881 AATGAGAGACAGGCAGAGGAAGG - Intronic
960573735 3:119209461-119209483 AAGTAGAGAAGCCAAGAAGAAGG + Intergenic
960837661 3:121923905-121923927 AATAAGAGACAGCCAGAGGAAGG - Intronic
961714355 3:128848445-128848467 AAGGTGGGAACCCCAGAGGAAGG + Intergenic
962009859 3:131382100-131382122 CAGGACAGAAGCCTAGAGGACGG + Exonic
962367987 3:134798282-134798304 AAGGAGATGTGGCCAGAGGAAGG + Intronic
963948419 3:151171322-151171344 ACAGAGAGATGCCAAGAGGAAGG - Intronic
965721643 3:171668543-171668565 AAGGAGAGAGGGAGAGAGGAAGG - Intronic
966919486 3:184602478-184602500 GAGGAGAGAAGCCCAGGGGCAGG - Intronic
969365197 4:6690128-6690150 AAGCAGAGAGGCCAGGAGGAGGG - Intergenic
970877199 4:20885033-20885055 AGGGAAAGATGGCCAGAGGAAGG - Intronic
972664525 4:41151498-41151520 AAGGAGAGATTCCAGGAGGAAGG - Intronic
977756656 4:100679698-100679720 TAGCAGAGATGACCAGAGGATGG + Intronic
978300426 4:107263745-107263767 AAGGAGAGAGGAAGAGAGGAAGG + Intronic
979108815 4:116723876-116723898 AAGAAGAGACACCCAGAGTTGGG + Intergenic
979863073 4:125718596-125718618 ATGGAGAGATGCACAGAGGAAGG - Intergenic
980237658 4:130130277-130130299 AAGGTGAGAAACACAGAGGATGG + Intergenic
981536270 4:145803050-145803072 AAGGAGAGAGGGAGAGAGGAAGG - Intronic
982271338 4:153592499-153592521 AAGGAGACCGGCCAAGAGGACGG - Exonic
982638736 4:157929637-157929659 AAGCAGTGACTGCCAGAGGAAGG - Intergenic
984060575 4:174984721-174984743 AAGGAGAGACTTCCAAAGGATGG + Intergenic
984261868 4:177452323-177452345 AAGGAGAGGCGGGGAGAGGAGGG - Intergenic
984262010 4:177453480-177453502 AAGGAGAGGAGAGCAGAGGAAGG - Intergenic
984445511 4:179831025-179831047 AAAAAGAGATGCCCAGAGGAAGG + Intergenic
985546652 5:513327-513349 AAGGAGAAAGGCCGGGAGGAAGG + Intronic
985587894 5:750429-750451 AAGGAGAGACGCAGAGGGGAGGG - Intronic
985714849 5:1449998-1450020 AAGGAGGGATGGCCAGAGGATGG + Intergenic
985773231 5:1825809-1825831 AAGGAGAGCCGGGCAGAGGCAGG - Intergenic
986415113 5:7520371-7520393 AAAGGGAGACCCACAGAGGAGGG - Intronic
986733763 5:10653428-10653450 AGGGAGGGAAGCCCAGATGATGG + Intergenic
990203312 5:53402231-53402253 AAGGAGGGAATCTCAGAGGAGGG - Intergenic
990309111 5:54520738-54520760 AAGGAGAGAAGCAGAGAGGAAGG - Intronic
991509250 5:67358737-67358759 AAGGGGAGAAGGCTAGAGGAAGG - Intergenic
992033269 5:72745781-72745803 AAGGAGAAATGCCAAGAGAAGGG + Intergenic
992127940 5:73661688-73661710 AAGGAGAGAGGCAGAGAAGAGGG + Intronic
994647561 5:102490094-102490116 AAGGAGGGATGCACAGAGGTTGG + Intronic
994843086 5:104951414-104951436 AAGGACAGAGACCCAGAGGAAGG - Intergenic
997204977 5:132042973-132042995 AAGGAGGAGCTCCCAGAGGAAGG - Intergenic
997838541 5:137216967-137216989 AAGGAGAGGAGCCCAGAGGCAGG + Intronic
999354660 5:150914899-150914921 AAGGAGAGACCCCCAGGAGTGGG + Intergenic
999405203 5:151300827-151300849 AAATAAAGATGCCCAGAGGAGGG - Intronic
999563150 5:152827074-152827096 ATACAGAAACGCCCAGAGGAAGG - Intergenic
999737555 5:154523967-154523989 AGGGAGAGAGGCCCAGGGCAGGG - Intergenic
1000616855 5:163437370-163437392 AATGAGAGACGCTTAGAGGTAGG + Intergenic
1001075800 5:168627259-168627281 CAGGTGAGACACCCAGGGGAAGG - Intergenic
1001122229 5:168990272-168990294 AAGGAGAGAGTCACAGAGAAGGG + Intronic
1001406216 5:171479558-171479580 GAGGACAGGAGCCCAGAGGAAGG + Intergenic
1001577941 5:172776926-172776948 CAGGAAAGATGCCCAGAGGAGGG + Intergenic
1002465236 5:179405051-179405073 AGGGAGAGAGGCCCAGATGGAGG - Intergenic
1002800276 6:515634-515656 AAGGAGAGACGCACACAGCTGGG + Intronic
1002800288 6:515719-515741 AAGGAGAGACGCACACAGCTGGG + Intronic
1002932545 6:1644373-1644395 ATGGTGAGACGCCAACAGGAAGG - Intronic
1003282490 6:4706098-4706120 CAGGCGAGAGGCCCAGTGGAGGG + Intergenic
1003442884 6:6159654-6159676 GAGGGAAGCCGCCCAGAGGAAGG + Intronic
1004017455 6:11745035-11745057 AGGGAGAGAAGGCCAGAGGCAGG - Intronic
1006079622 6:31557936-31557958 AAGCAGGGAAGCACAGAGGAGGG - Intronic
1006397921 6:33799062-33799084 AAGGAGAGAAACTCAGAGCAGGG - Intronic
1006460071 6:34153032-34153054 AAGCTGAGAGGCACAGAGGAGGG + Intronic
1007233272 6:40367822-40367844 AAGGAGAAATGCCCAGTGAAGGG + Intergenic
1007241013 6:40425220-40425242 AAGGAGAGAGACCCTGAAGATGG - Intronic
1007607986 6:43130106-43130128 ATGGAGAAACGGCCTGAGGAAGG - Intronic
1009327652 6:62373815-62373837 AAGGAGAAATGCCCAGTGAATGG + Intergenic
1012929746 6:105304532-105304554 CAGGAGGGGCCCCCAGAGGAGGG - Intronic
1013209105 6:107970951-107970973 CAGGAGAGACGTCCACAGAAAGG + Intergenic
1013588391 6:111599363-111599385 GAGTAGAGAAGCCCAGAGAAAGG - Intronic
1015759016 6:136637350-136637372 AAGGGGAGAAGCACAGAGGAAGG - Exonic
1015976695 6:138798068-138798090 TAGAAGAGAGGCCCAGAGAAAGG + Intronic
1016114298 6:140261894-140261916 AAGGAGGCAAGCCCAGAGAAAGG + Intergenic
1017408198 6:154142110-154142132 CAGCAGAGACGGCCAGAGGTTGG - Intronic
1018481848 6:164199060-164199082 AGGGAGAGACGCACAGACCACGG + Intergenic
1018699240 6:166413433-166413455 AAGGAGTCCCACCCAGAGGATGG + Intronic
1018984732 6:168627875-168627897 GAGGAGAAAGGCCCACAGGAGGG + Intronic
1019368882 7:650492-650514 CAGGAATGACTCCCAGAGGAGGG - Intronic
1019492459 7:1321759-1321781 AAGGAAAAACTCCCAAAGGAGGG + Intergenic
1019730720 7:2627919-2627941 AAGGAGAGAAGGCCAGAGAGAGG - Intergenic
1020436051 7:8163687-8163709 AGGGAGAGAAGTCCAGTGGAAGG + Intronic
1020945010 7:14593207-14593229 AAGGAGAGAGGGACAGAGAAAGG + Intronic
1022013743 7:26330624-26330646 GATGAGAGAACCCCAGAGGATGG + Intronic
1022531656 7:31070507-31070529 GAGGGGAGAGGCCAAGAGGAAGG + Intronic
1025873133 7:65453697-65453719 AAGGAGAGCTCCCCACAGGAAGG - Intergenic
1026104152 7:67407849-67407871 CAGGAGGGACACTCAGAGGAGGG - Intergenic
1026686020 7:72510868-72510890 AAGGAGGGATGGCCAGAGGTTGG + Intergenic
1027718747 7:81710819-81710841 AAGGCGAGGAGCACAGAGGAGGG - Intronic
1027826080 7:83118426-83118448 AAGGAAAGAGGCACAGAAGAGGG + Intronic
1029449050 7:100630759-100630781 CAGGAGTGGTGCCCAGAGGAGGG - Intronic
1029648559 7:101874463-101874485 CAGGACACACGCACAGAGGAAGG + Intronic
1031269731 7:119633406-119633428 AAGGAGAGATGACAAAAGGAGGG - Intergenic
1032012010 7:128352812-128352834 AAGGTGAGAGGCCAAGAGGTGGG - Intronic
1032283336 7:130523689-130523711 GAGGAGTGAGGCCCAGAGAAGGG + Intronic
1032284078 7:130527914-130527936 GAGGAGTGAGGCCCAGAGAAGGG + Intronic
1032284852 7:130532291-130532313 GAGGAGTGAGGCCCAGAGAAGGG + Intronic
1033229762 7:139587563-139587585 CAGTAGAGACACCCAGAGGGTGG + Intronic
1033276310 7:139974172-139974194 AAGGAGGGAGGTCCAGAGGGAGG + Intronic
1034076379 7:148235590-148235612 AGGAAGAGCCTCCCAGAGGATGG - Intronic
1035612971 8:980678-980700 AAGGAGAGACTCCAGCAGGAAGG + Intergenic
1035965979 8:4192435-4192457 ACGGAGAGCCACACAGAGGAAGG - Intronic
1037735915 8:21566050-21566072 AAGAAGAGAGGCCTACAGGAGGG - Intergenic
1037916988 8:22778782-22778804 AAGGAGAGAAGGCCAGGGTAGGG - Intronic
1038761032 8:30384459-30384481 GAGGAGAGGCGCGGAGAGGAGGG + Intronic
1039325723 8:36483465-36483487 AAGGAAAGACCCACAGAGTATGG + Intergenic
1039785626 8:40832091-40832113 GAGGACAGAGGCCCAGAGTAGGG - Intronic
1039843683 8:41310647-41310669 TAGGGCAGACGCCAAGAGGACGG + Intergenic
1041749465 8:61244127-61244149 ATGCAGAGATGACCAGAGGATGG + Intronic
1043206976 8:77456848-77456870 GAGGAGAAAGGCCCAGAGGCAGG + Intergenic
1045664421 8:104469601-104469623 AAGGAGAGACGGAGAGAGGCTGG + Intergenic
1046504185 8:115115839-115115861 AAGCAGTGACACCCAGTGGATGG + Intergenic
1046858477 8:119063533-119063555 TAGAAGAGACACCCAAAGGAGGG - Intronic
1046997552 8:120541291-120541313 GTGGAGAGAGGGCCAGAGGAGGG - Intronic
1047329851 8:123876979-123877001 ATGCAGAGAAGCACAGAGGAGGG - Intronic
1048030034 8:130622206-130622228 AAGGAAAGAGGCACTGAGGAGGG - Intergenic
1049116839 8:140696044-140696066 AACGTTAGAGGCCCAGAGGAAGG - Intronic
1049313051 8:141943552-141943574 GAGGAGAGCCGCAGAGAGGAGGG - Intergenic
1049473867 8:142788010-142788032 AGGGAGAGATGCCGGGAGGAAGG - Intergenic
1049480084 8:142818431-142818453 AAGGAGAGGCGAGCAGAGGCCGG - Intergenic
1049759574 8:144326004-144326026 TAGGAAAGGCTCCCAGAGGAGGG - Intronic
1051740177 9:20243928-20243950 AAGGAGGGACCTCGAGAGGAAGG + Intergenic
1052439278 9:28473351-28473373 AAGGTGAGACGACCACAGAATGG - Intronic
1053460809 9:38269815-38269837 GAGGAGAGAAGACCAGAGGCAGG + Intergenic
1054734861 9:68740741-68740763 AAGGAAATACGCCATGAGGAAGG - Intronic
1054988387 9:71290084-71290106 AAGGAGAGAAGCTCAGAGGCTGG + Intronic
1056534710 9:87517280-87517302 AAGAAGAGAGGCCCAGCAGATGG - Intronic
1056681647 9:88724638-88724660 CAGCAGAGACGGCCAGGGGAGGG + Intergenic
1056810053 9:89757226-89757248 AGGGTGAGACGCACACAGGAAGG - Intergenic
1057202248 9:93147797-93147819 AATGAGAGACACACAGAGCAAGG - Intergenic
1057260848 9:93582476-93582498 AAGGAGAGATGCAGAGAGGGAGG - Intronic
1057917731 9:99070584-99070606 GAGGAGAGCCGCCAAGGGGAAGG - Exonic
1058285379 9:103170181-103170203 AAGGAGAGAGGCCCTGAAGAAGG - Intergenic
1058419891 9:104823589-104823611 AAGGAGGGATGCTCAGGGGAGGG + Intronic
1060176236 9:121499423-121499445 AGGGAGGGACGGCCACAGGATGG + Intergenic
1060546537 9:124465176-124465198 AAGGAGAGAGACCAGGAGGATGG - Intronic
1061169283 9:128942817-128942839 GAGGAAACAGGCCCAGAGGAAGG - Intronic
1061263671 9:129493809-129493831 AAGGAGAGACCTCCAGAGCCTGG + Intergenic
1061276102 9:129570089-129570111 GAGGAGAGAGACCAAGAGGAAGG + Intergenic
1061832201 9:133303390-133303412 AAGGAGAGAGCCTCGGAGGAGGG + Intergenic
1062236853 9:135514492-135514514 AAGGAGAGGGTCTCAGAGGAGGG + Intergenic
1062337280 9:136077589-136077611 AAAGGGAAACGCACAGAGGAGGG + Intronic
1062369383 9:136229817-136229839 CAGGAGAGGTGGCCAGAGGAGGG - Intronic
1203365146 Un_KI270442v1:249564-249586 AAGGAGAGAAGAACAGAGGGAGG + Intergenic
1185535150 X:855195-855217 AAGGAGGGAGGGACAGAGGAAGG - Intergenic
1186888906 X:13940847-13940869 TAGGAGAGAGTCCCAGAAGAGGG - Intergenic
1187575145 X:20546113-20546135 AAGGAAAGAGGCCCTGAAGAGGG - Intergenic
1187680882 X:21766996-21767018 GAAGAGCGAGGCCCAGAGGAGGG + Intergenic
1189585496 X:42456999-42457021 AAGGAGAGAGGAAAAGAGGAGGG - Intergenic
1190213763 X:48467191-48467213 AAGGAGAGACCATCGGAGGAGGG + Intronic
1193037022 X:76962395-76962417 AAGGAGAGAAGGTGAGAGGAGGG - Intergenic
1196279346 X:113804595-113804617 AAGAATAGAGGCCCAGAGCATGG - Intergenic
1197015535 X:121621319-121621341 AATGAAAGCAGCCCAGAGGAGGG - Intergenic
1197523725 X:127533955-127533977 GAGGAGATACGACCAGAGGTTGG + Intergenic
1198160033 X:133999055-133999077 AAGGAGAGCTCCCCACAGGAAGG + Intergenic
1199236823 X:145502480-145502502 AAGCAGGGATGCCCATAGGATGG + Intergenic
1200128267 X:153828451-153828473 AAGGAGACCCGCCAGGAGGAGGG - Intronic
1201073592 Y:10170862-10170884 AAGGAGAGAAGAACAGAGGGAGG - Intergenic