ID: 915108036

View in Genome Browser
Species Human (GRCh38)
Location 1:153546519-153546541
Sequence TGCCATGCCAAGTAAGGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 115}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915108032_915108036 -6 Left 915108032 1:153546502-153546524 CCATGCCCGGTACTGTCTGCCAT 0: 1
1: 0
2: 1
3: 12
4: 122
Right 915108036 1:153546519-153546541 TGCCATGCCAAGTAAGGCTCAGG 0: 1
1: 0
2: 0
3: 5
4: 115
915108030_915108036 -4 Left 915108030 1:153546500-153546522 CCCCATGCCCGGTACTGTCTGCC 0: 1
1: 0
2: 0
3: 4
4: 105
Right 915108036 1:153546519-153546541 TGCCATGCCAAGTAAGGCTCAGG 0: 1
1: 0
2: 0
3: 5
4: 115
915108031_915108036 -5 Left 915108031 1:153546501-153546523 CCCATGCCCGGTACTGTCTGCCA 0: 1
1: 0
2: 0
3: 2
4: 66
Right 915108036 1:153546519-153546541 TGCCATGCCAAGTAAGGCTCAGG 0: 1
1: 0
2: 0
3: 5
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915108036 Original CRISPR TGCCATGCCAAGTAAGGCTC AGG Intronic
900344936 1:2206000-2206022 TGCCGTGCCAATTAGGGCCCAGG + Intronic
900351189 1:2235454-2235476 TGCCATGCCAGGTGACCCTCAGG + Intronic
900809120 1:4787709-4787731 TGCCAGGCCAAGCAGGTCTCAGG + Exonic
901204437 1:7485711-7485733 TCCCATGCAAAGCAAGGCACTGG - Intronic
901456870 1:9368055-9368077 TGCCATGGCAGATAAAGCTCAGG + Exonic
907439862 1:54472540-54472562 TCCCATGACAAGTAAGGGACTGG + Intergenic
907458979 1:54594090-54594112 TGCCATGGCGAGTCTGGCTCAGG + Intronic
909196398 1:72631074-72631096 TACCATGCCAAGGATGGCACTGG + Intergenic
911072250 1:93841510-93841532 TTCCAAGCCTAGTAGGGCTCAGG - Intronic
913685452 1:121227669-121227691 TGACATGCCTAGTAAGGACCTGG + Intronic
914037299 1:144015273-144015295 TGACATGCCTAGTAAGGACCTGG + Intergenic
914152156 1:145052659-145052681 TGACATGCCTAGTAAGGACCTGG - Intronic
915108036 1:153546519-153546541 TGCCATGCCAAGTAAGGCTCAGG + Intronic
915541522 1:156570037-156570059 TTTCAAGCCAAGGAAGGCTCTGG - Intronic
916549223 1:165833328-165833350 TGCCATGCCAAGAGTGGGTCTGG - Intronic
916647281 1:166797963-166797985 AGCCCTGCCAAGTACTGCTCAGG + Intergenic
917226288 1:172787667-172787689 TGCCAAGCCCAGTAATGCTGTGG + Intergenic
919767584 1:201137132-201137154 TGCCAGGCTAGGTGAGGCTCAGG + Intronic
920472770 1:206246227-206246249 TGACATGCCTAGTAAGGACCTGG + Intronic
1067325899 10:45266120-45266142 TGCCCTGCCAAGCCAGGCACAGG - Intergenic
1067482642 10:46613704-46613726 TGCCATGCCACATAAGGGACAGG + Intergenic
1067612109 10:47727960-47727982 TGCCATGCCACATAAGGGACAGG - Intergenic
1069263018 10:66422954-66422976 TGCTATGCCAAGAATAGCTCAGG + Intronic
1069582664 10:69576229-69576251 TCCCATGCCAGGAAAGACTCTGG + Intergenic
1069684650 10:70309832-70309854 TGCCATGCCCAGCAAGCCTGTGG - Intronic
1069827437 10:71262762-71262784 TGCTGTGCCAAGTGAGGCCCAGG - Intronic
1071627531 10:87188203-87188225 TGCCATGCCACATAAGGGACAGG - Intronic
1071788107 10:88925714-88925736 TGCCAGCCAAAGTCAGGCTCTGG - Intronic
1072401341 10:95105439-95105461 TCCCATCCCATGAAAGGCTCTGG + Intergenic
1072459375 10:95605318-95605340 TGCCAGACCATGTAAGGGTCTGG + Intergenic
1074359093 10:112811009-112811031 GGCCAAGCCAAGAGAGGCTCTGG - Intronic
1074423481 10:113329979-113330001 TGCAATGACAAGGAAGGCACTGG + Intergenic
1075416383 10:122267591-122267613 TTCCAGGCCAACTGAGGCTCCGG + Intergenic
1075920939 10:126212117-126212139 TGCCATGCCAGGTACCGCACTGG + Intronic
1077609241 11:3634263-3634285 TGCCAGGCCAAGTAAGGAACAGG - Intergenic
1081520730 11:43878784-43878806 TCCACTGCCAAGGAAGGCTCAGG + Intergenic
1085760467 11:79236980-79237002 TGCCATGCCAGGTACTTCTCTGG + Intronic
1086102811 11:83118839-83118861 TGACATCTCAAGGAAGGCTCAGG - Intergenic
1087201464 11:95348040-95348062 TGCCAAGCCCAGTAACACTCTGG - Intergenic
1089744086 11:120604820-120604842 GGCCATTCCAAGTAAGTCTGAGG - Intronic
1097826202 12:64177100-64177122 GGCCGTGCCAAGGAATGCTCAGG - Intergenic
1097938149 12:65276355-65276377 TGACAAGCCAGGTAAGCCTCTGG + Intergenic
1104669200 12:130668797-130668819 TGCCATGCCAAGCTATGCCCTGG + Intronic
1106433632 13:29705386-29705408 TGCCATGCTAGGTCAGCCTCTGG - Intergenic
1108349735 13:49581018-49581040 ACTCATGCCAGGTAAGGCTCTGG + Intronic
1110742905 13:79018633-79018655 TTCCATGCCAAGGACAGCTCTGG - Intergenic
1115972683 14:38963374-38963396 AGAGATGCCAAGCAAGGCTCTGG - Intergenic
1122398229 14:101450514-101450536 TGCCATGCAAAGCAGGGCTGAGG + Intergenic
1124552839 15:30697250-30697272 TGCCATCCCAAATAATGCTGAGG + Intronic
1124678403 15:31708420-31708442 TGCCATCCCAAATAATGCTGAGG - Intronic
1126115356 15:45202729-45202751 TGGGATGCCAGGAAAGGCTCTGG + Intergenic
1131337521 15:91563515-91563537 TGCCAGGCAGAGTAAAGCTCTGG - Intergenic
1134132611 16:11659676-11659698 TGCCAGGCCCTGCAAGGCTCAGG - Intergenic
1134276498 16:12781173-12781195 CGCCATGCCAGGTAAGACTCGGG - Exonic
1135085803 16:19473632-19473654 TGCCAAGCAAACTGAGGCTCAGG - Intronic
1140788995 16:78372108-78372130 TGCCCTGCAAACTAAGGCACAGG + Intronic
1144810336 17:17994717-17994739 TGACATGCCAGGAACGGCTCAGG + Intronic
1144836831 17:18160956-18160978 GGTCATGCCAGGTAAGGCCCAGG - Intronic
1148194485 17:45703472-45703494 TGCCCTGGAAAGTGAGGCTCTGG - Intergenic
1149778050 17:59373572-59373594 TGCGGTGCCCAGCAAGGCTCCGG + Intronic
1150069439 17:62139011-62139033 TGCCGCGGCAAGCAAGGCTCGGG + Intergenic
1151620366 17:75241258-75241280 TGCCATTCCAAGCAATCCTCCGG - Intronic
1151727314 17:75892543-75892565 TGCCATACCAAGGGAGGCTAGGG + Intronic
1153814385 18:8780168-8780190 TGATATGACAAGGAAGGCTCAGG - Intronic
1155119825 18:22806970-22806992 TACCATGCCAAGCATTGCTCTGG - Intronic
1155725814 18:29081581-29081603 TACCATGGCAAGTAATGGTCTGG - Intergenic
1161167943 19:2798555-2798577 AGCCATGCCAGGGAAGGCTCTGG - Intronic
1167884899 19:52492662-52492684 TGCCAGGCCAAGTGATGCACAGG + Intronic
925939677 2:8804942-8804964 TCCCATGCCAATGAAAGCTCAGG + Intronic
926156091 2:10454735-10454757 TTCCATGCCCTGTATGGCTCAGG + Intergenic
932044974 2:68339345-68339367 TGCCATGCCCAGAGAGGGTCTGG + Intergenic
937754114 2:125515528-125515550 TGCCATGTCAATTCAAGCTCAGG - Intergenic
938735646 2:134184283-134184305 TGAAATGCCAAGTAGGACTCAGG - Intronic
940020500 2:149151489-149151511 TGCCATGCCATATAGGGCTCAGG + Intronic
940702884 2:157068418-157068440 GGCCATGCAAATGAAGGCTCAGG - Intergenic
941933570 2:170965817-170965839 TGCAATGCCAGGTAAGTTTCGGG - Exonic
944116176 2:196188955-196188977 TGCCATGCCTAGAAAGGTTCTGG - Intergenic
944503618 2:200387211-200387233 TGCCATTGAAAGTAAGGCTAAGG - Intronic
947936473 2:234009104-234009126 TCCCATGCAAGGGAAGGCTCGGG + Intronic
1173081361 20:39871084-39871106 AGCCATGCCACTTATGGCTCTGG + Intergenic
1176089270 20:63311801-63311823 TCCCATGCCATGGAAGGCTGAGG - Intronic
1176182908 20:63760090-63760112 TGAAATGCCACGTCAGGCTCTGG + Intronic
1178616741 21:34141207-34141229 TGCCATAGGAAGAAAGGCTCTGG - Intronic
1180930188 22:19584943-19584965 TGCCATGCTAATTAAGGGGCAGG - Intergenic
1181638255 22:24184227-24184249 TGACATGCCAGGTCAGGCTGAGG - Exonic
1182051915 22:27318901-27318923 TGCCCTGCCAAGTTAGGTTTGGG - Intergenic
951043278 3:18011610-18011632 TGCCTGGCCAGGTGAGGCTCTGG + Intronic
952526142 3:34212311-34212333 TGCCCTGCCAGGTCAGGCTGAGG + Intergenic
953501008 3:43434549-43434571 TGTCATGTCATGTAGGGCTCTGG - Intronic
961653352 3:128428459-128428481 TGCCAAGCCCAGAATGGCTCTGG - Intergenic
967770375 3:193327883-193327905 TGCCATGCTTGGTAAAGCTCTGG - Intronic
969504256 4:7574445-7574467 TCCCATGCCAAGCAAGGCAGGGG - Intronic
975846773 4:78533475-78533497 TGCCATGACCGGTAAAGCTCTGG - Intronic
976847516 4:89506964-89506986 TGTGATGCCAAAAAAGGCTCTGG + Intergenic
989556614 5:42803943-42803965 TTCCATTCCAAGTAATGCTGTGG + Intronic
992208164 5:74451532-74451554 AGTCATGCCAACAAAGGCTCAGG + Intergenic
998984804 5:147744420-147744442 TCCAAGGCCAAGTAAGGCTTAGG + Intronic
1002770613 6:287681-287703 TGCTCTGCCAAGTACGGCTATGG + Intergenic
1004078825 6:12370713-12370735 GTCCATACCAAGTAAGCCTCTGG + Intergenic
1007407622 6:41644037-41644059 TGCCATGAAAAGGGAGGCTCAGG - Intronic
1012592262 6:100996575-100996597 TGCCATATCAAGTAAGGATGTGG + Intergenic
1015206243 6:130642748-130642770 CCCCATGCCAAGTATGGCTATGG - Intergenic
1016071072 6:139739941-139739963 TGCCATGTGAATTAATGCTCTGG - Intergenic
1018044421 6:159953165-159953187 TGCCATGGCGAATCAGGCTCAGG - Intergenic
1018845465 6:167552364-167552386 TGCAAAGGCAAGAAAGGCTCAGG - Intergenic
1019584100 7:1787358-1787380 TTCCCTGCCGACTAAGGCTCAGG + Intergenic
1028361719 7:89975447-89975469 TGCAATCCCAAGTTAGCCTCTGG - Intergenic
1029271494 7:99379766-99379788 TGCCAGGCAAAGAAAGCCTCAGG - Intronic
1029498752 7:100914398-100914420 TGCCATGCTGAGTAAGGCCTTGG - Intergenic
1035067852 7:156121286-156121308 AGCCATGCCAAGGAATGGTCGGG + Intergenic
1037713225 8:21372479-21372501 TTCAATGCCAGGCAAGGCTCAGG + Intergenic
1042027756 8:64442231-64442253 TGCCATCTCTAGTAAGGATCTGG - Intergenic
1047344907 8:124018215-124018237 TGCCAGACCAAGTCAGGCCCTGG + Intronic
1047698739 8:127429418-127429440 TGCCATGCCAAGAAATGGCCTGG - Intergenic
1051022057 9:12556519-12556541 GGCCATGCCAGGCAAGGGTCTGG - Intergenic
1052792535 9:32889369-32889391 GGCCATGACAAGCAAGTCTCAGG + Intergenic
1055786764 9:79878328-79878350 TACCATGCGAATTAAGCCTCAGG + Intergenic
1185522678 X:753466-753488 TGCCTTGACAATTAAGGCACGGG + Intergenic
1188721393 X:33527827-33527849 TGCCAAGCCCAGTAATGCTGTGG + Intergenic
1188876172 X:35432757-35432779 TGCCATGCAATGTAAGCCTGAGG + Intergenic
1194264569 X:91738798-91738820 TGCCATCCCAAGAAAGCATCAGG + Intergenic