ID: 915118811

View in Genome Browser
Species Human (GRCh38)
Location 1:153616064-153616086
Sequence CCTGAAGCCCAGGCGGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 469
Summary {0: 1, 1: 0, 2: 2, 3: 51, 4: 415}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915118811_915118824 15 Left 915118811 1:153616064-153616086 CCAGGCCCCGCCTGGGCTTCAGG 0: 1
1: 0
2: 2
3: 51
4: 415
Right 915118824 1:153616102-153616124 CCCCAGGCCAACGCATCTAGGGG 0: 1
1: 0
2: 0
3: 2
4: 55
915118811_915118829 26 Left 915118811 1:153616064-153616086 CCAGGCCCCGCCTGGGCTTCAGG 0: 1
1: 0
2: 2
3: 51
4: 415
Right 915118829 1:153616113-153616135 CGCATCTAGGGGGAATCCCTTGG 0: 1
1: 0
2: 0
3: 2
4: 45
915118811_915118818 -1 Left 915118811 1:153616064-153616086 CCAGGCCCCGCCTGGGCTTCAGG 0: 1
1: 0
2: 2
3: 51
4: 415
Right 915118818 1:153616086-153616108 GAGCCAAGGTCATATCCCCCAGG 0: 1
1: 0
2: 1
3: 7
4: 112
915118811_915118826 16 Left 915118811 1:153616064-153616086 CCAGGCCCCGCCTGGGCTTCAGG 0: 1
1: 0
2: 2
3: 51
4: 415
Right 915118826 1:153616103-153616125 CCCAGGCCAACGCATCTAGGGGG 0: 1
1: 0
2: 0
3: 3
4: 63
915118811_915118820 13 Left 915118811 1:153616064-153616086 CCAGGCCCCGCCTGGGCTTCAGG 0: 1
1: 0
2: 2
3: 51
4: 415
Right 915118820 1:153616100-153616122 TCCCCCAGGCCAACGCATCTAGG 0: 1
1: 0
2: 1
3: 10
4: 114
915118811_915118822 14 Left 915118811 1:153616064-153616086 CCAGGCCCCGCCTGGGCTTCAGG 0: 1
1: 0
2: 2
3: 51
4: 415
Right 915118822 1:153616101-153616123 CCCCCAGGCCAACGCATCTAGGG 0: 1
1: 0
2: 0
3: 9
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915118811 Original CRISPR CCTGAAGCCCAGGCGGGGCC TGG (reversed) Intronic
900127273 1:1074127-1074149 GGTGAAGCACAGGCCGGGCCGGG - Exonic
900292007 1:1927596-1927618 GCTGAGGCCCAGGTGGGTCCAGG - Exonic
900485257 1:2919740-2919762 CCTGGAGGCCAGGCGGGAACAGG + Intergenic
900485916 1:2922704-2922726 CCTGCAGCCCTGGAGAGGCCTGG + Intergenic
900579585 1:3402505-3402527 CCTGAGGCACAGGCAGGGCCGGG + Intronic
900687291 1:3956890-3956912 CCTGGAGCCCAGTCAGGCCCTGG + Intergenic
901222354 1:7590434-7590456 CCTGAAGAGCCAGCGGGGCCTGG - Intronic
901598219 1:10401723-10401745 AATGAAGCCCAGGCTGGGCGCGG + Intronic
901628909 1:10638832-10638854 CCGGAAGCACCGGCGGGGCGCGG + Exonic
901833607 1:11909176-11909198 CCTGACCCCCAGGCCGGGCGCGG + Intergenic
902246515 1:15124474-15124496 CCTGCGCCCCAGGCGCGGCCCGG + Intergenic
902529425 1:17081029-17081051 CTTGAGGCCCAGGCCAGGCCCGG - Intronic
902813852 1:18904839-18904861 ACTGCAGCCCAGGCTTGGCCTGG + Exonic
902839222 1:19064916-19064938 ACTGAGGCCCAGGAGGGGCAGGG - Intergenic
903014731 1:20354461-20354483 ACTGAGGCCCAGACGGGGGCAGG - Intronic
903331985 1:22601182-22601204 CCGGGGGCCCAGGCTGGGCCTGG - Intronic
903391348 1:22965494-22965516 CTTGAGGCCTAGGAGGGGCCAGG - Intergenic
903874819 1:26466596-26466618 GCTGTAGCCCAGGCAGAGCCTGG - Intronic
903881575 1:26513675-26513697 CGTGAAGCACAGGCTGGGCACGG - Intergenic
904009792 1:27383057-27383079 CCTCAAGCCCAGGCTGCTCCTGG + Intronic
904398613 1:30240866-30240888 ACTGAAGCCCAGGGTGGGCCAGG - Intergenic
904539256 1:31221812-31221834 CCTGAAGGCAATGAGGGGCCAGG + Intronic
904716669 1:32473148-32473170 CCTTAAGCCAAGGCTGGGCGCGG + Intronic
904897010 1:33824980-33825002 GCTGAAGCCCAGGAAGGGCTGGG - Intronic
905314047 1:37069802-37069824 CCTGTAGTGCAGGAGGGGCCAGG + Intergenic
905478257 1:38244077-38244099 CCCCCAGCCCAGGCTGGGCCTGG + Intergenic
905915658 1:41682616-41682638 ACTGACGCCCAGCCGGGGACAGG + Intronic
906998010 1:50818741-50818763 CTTGGAGGCCAGGCGGGGGCCGG + Intronic
907404664 1:54246607-54246629 CCTGAAGGCCAGGCAGGGTCAGG - Intronic
907516648 1:54997239-54997261 CCTGGAGCCCAGGCGGGTGGCGG - Intergenic
908119836 1:60975651-60975673 CCTAAACCCAAGGTGGGGCCGGG - Intronic
908747045 1:67385918-67385940 ACTGAAGTCCAGGCCGGGCACGG + Intronic
910771526 1:90836264-90836286 CCTGAACGCCCAGCGGGGCCGGG + Intergenic
910963340 1:92784675-92784697 ACTTAGGCCCTGGCGGGGCCAGG + Intronic
912641587 1:111351434-111351456 CCTGGAGCCCAGGGAGGGACAGG + Exonic
915118811 1:153616064-153616086 CCTGAAGCCCAGGCGGGGCCTGG - Intronic
916666951 1:166975407-166975429 CCGGCCGCGCAGGCGGGGCCGGG + Intronic
920009567 1:202858085-202858107 TCTCAAGCCCAGGCAGGACCTGG - Intergenic
920218508 1:204378192-204378214 CTTGAACCACCGGCGGGGCCGGG + Intergenic
920373334 1:205493140-205493162 CCTGAAGCCTGGGAGGGGCTGGG - Intergenic
921923413 1:220691923-220691945 CCTGAAGCCCCCCCGGGGGCGGG - Intronic
922241377 1:223757459-223757481 CGTGAAGCCCGGGCAGGGGCTGG + Intronic
922721478 1:227902183-227902205 CCTGATGGCCAGGCCAGGCCAGG + Intergenic
923498144 1:234542539-234542561 CAGGAAGCCCAGGCGAGGTCGGG - Intergenic
923537347 1:234863357-234863379 CCTGCAGCCCAGGCTGGGGCTGG - Intergenic
924464337 1:244286414-244286436 CCTGAAGACCAGGCTGTACCAGG + Intergenic
924709732 1:246522360-246522382 CCTGAAACCCAGAGGGAGCCAGG + Intergenic
1063299262 10:4836893-4836915 CCTGAAGCTCAGGGGCAGCCTGG + Intronic
1064086398 10:12349323-12349345 CCTGGAGCCCCGGCGAGGGCGGG - Intergenic
1064933105 10:20649451-20649473 CCTGAAGCCCACGCTGGCCAGGG + Intergenic
1067532495 10:47084579-47084601 TCTAAAGCCCAGGTGGGGCTAGG + Intergenic
1067785417 10:49242184-49242206 CCTGAAACCCAGGTGGGTTCTGG - Intergenic
1069438297 10:68406552-68406574 CCTGTAGCGCAGCCGGGGCGTGG - Intronic
1069895013 10:71675058-71675080 CCTGAAGCCTCAGCTGGGCCTGG + Intronic
1070132538 10:73665364-73665386 CCTGGAGCTCAGGCGGGTCCAGG + Intergenic
1070281098 10:75049485-75049507 CCTGAGGCCCTGGCCTGGCCTGG - Intronic
1070305246 10:75235513-75235535 CCGGAAGCCCAGGGAGGGCCAGG + Intronic
1070610232 10:77927238-77927260 CCCGAGGCCCAGGCGCAGCCGGG + Intergenic
1071573809 10:86711746-86711768 CCTGAGGCCCGGGAGGGGGCGGG + Intronic
1071690788 10:87817954-87817976 CCGGACGCCAAGGCGAGGCCCGG + Exonic
1072193701 10:93097009-93097031 GCTGAAGGCCTGGCAGGGCCCGG - Intergenic
1073285526 10:102385286-102385308 CCTGAAGTCCAGGCCATGCCTGG + Intergenic
1073890756 10:108097563-108097585 CATGGAGCCCAGCAGGGGCCAGG - Intergenic
1074385904 10:113016570-113016592 CCTGAAGCTCCGGCAGAGCCTGG + Intronic
1074884565 10:117684162-117684184 CCTGGAGCCCAGTCTGGGCAAGG - Intergenic
1075401478 10:122164086-122164108 CCTGGAGCCCAGGCTGGCCTGGG + Intronic
1075563562 10:123486595-123486617 GCTGCAGCCCAGGCAGAGCCAGG - Intergenic
1075999552 10:126904579-126904601 CCTGAGCCCCACGCGTGGCCTGG + Intergenic
1076489014 10:130844052-130844074 CATGAATCCCAGGCCGGGACTGG - Intergenic
1076594762 10:131618791-131618813 CCTGAAGCCCGGGTGGGCCGTGG - Intergenic
1077038001 11:504471-504493 CCTTCCGCCCAGGCGGGGGCGGG + Intronic
1077076861 11:706013-706035 GCTGGAGCCCAGGCGGGGCAGGG + Intronic
1077077376 11:707695-707717 CCTCAGGCCCAGGCAGGGCCGGG - Intronic
1077077695 11:708853-708875 CCTGAAGTCCAGAGGGAGCCCGG - Intronic
1077103656 11:832885-832907 CTTGAGGCCGGGGCGGGGCCGGG + Exonic
1077236965 11:1486510-1486532 CCTGAAGACCAAGCCCGGCCCGG - Exonic
1077375392 11:2203151-2203173 CCCGAGGCCCAGGAGGGACCTGG + Intergenic
1077423280 11:2462884-2462906 CCTGAACCCCAGGCTGGGCACGG - Intronic
1077500893 11:2909371-2909393 ACTGGAGTCCAGGTGGGGCCGGG + Intronic
1077504522 11:2923932-2923954 CCCTGAGCCCAGGTGGGGCCTGG + Intronic
1077556641 11:3229112-3229134 CCTGTAGGCCAGGTGGGGGCAGG + Intronic
1078539055 11:12198869-12198891 CATGAAGCTCAGGCTGGACCTGG + Intronic
1079328540 11:19514822-19514844 GCTGCAGCCCAGGCAGGCCCAGG + Intronic
1081529454 11:43947965-43947987 GCTGAAGCCCAGGCAGGGAGGGG - Intergenic
1081864576 11:46352497-46352519 CCTGAGGCCCAGGCCCAGCCAGG + Intronic
1081997632 11:47375580-47375602 CCAGGAGCCCAGGCTGGGCTGGG + Intronic
1083160354 11:60850503-60850525 ACAGAAGCCCAGAGGGGGCCTGG + Exonic
1083170529 11:60921793-60921815 CCTGAAGCTCAGCCCTGGCCAGG + Exonic
1083613140 11:64013929-64013951 CCTGATGCCCAAGCAGGGACAGG + Intronic
1084151395 11:67289418-67289440 CCCGAAGCCGAGGCGGGGCCGGG + Exonic
1084386227 11:68844080-68844102 CCTGCAGGCCGGGCGGGGCAGGG + Intronic
1084450599 11:69234545-69234567 TCGGAAGGCCAGGCTGGGCCGGG + Intergenic
1084717645 11:70883785-70883807 CCTGAAAGCCAGGCAGGGCTGGG + Intronic
1084797729 11:71519346-71519368 CCCCCAGCCCAGGAGGGGCCTGG - Intronic
1085347771 11:75779295-75779317 CCTGAAGTCCAGGTGTGGGCTGG + Intronic
1086474144 11:87152488-87152510 CTTGACGCCCAGGCTGGGCTTGG + Intronic
1087104741 11:94398301-94398323 CCAGAAGGAAAGGCGGGGCCAGG - Intronic
1089056579 11:115590544-115590566 CCTGAGGCGCAGGTGGGGCGGGG + Intergenic
1089497827 11:118916626-118916648 CCTGAAGCCCAGAAGGGGAGTGG - Intronic
1090645904 11:128766609-128766631 CCTGAGACCCAGGCAGGGCGGGG - Intronic
1090840167 11:130480507-130480529 CTTGAAGCCTAGGCTGGGCTGGG + Intergenic
1090857830 11:130625761-130625783 CCCGAGGCCCAGGCGGGACTGGG - Intergenic
1091787933 12:3254174-3254196 CCTGCAGCACAGGCTGGGCAGGG + Intronic
1097277904 12:57825668-57825690 CCTGCAGCCCAGGCAGTCCCAGG - Intronic
1101398533 12:104368814-104368836 CTGGAAGCCCAGGTGGGGCTTGG - Intergenic
1101948308 12:109154804-109154826 CCTGAAGCCGACCCGAGGCCCGG - Intronic
1102005732 12:109588164-109588186 CCTGAAGACAGGCCGGGGCCCGG - Intronic
1102101487 12:110281681-110281703 CCGGGAGCCCAGGCGCGGACGGG - Exonic
1102146914 12:110661203-110661225 CCTGAAGTCAAGGGGGGCCCTGG + Exonic
1102527422 12:113521690-113521712 CCTGACCCCCAGGCCGGGTCAGG + Intergenic
1102774536 12:115507090-115507112 TCAGGAGCCCAGGCAGGGCCGGG - Intergenic
1103800292 12:123533560-123533582 CCCGCGGCCCAGGCTGGGCCCGG - Exonic
1104460066 12:128948097-128948119 CGTGAAACCCAGGCAGGCCCTGG + Intronic
1104929163 12:132329251-132329273 GCTGAAGCCCAGGCCCGGGCGGG - Intronic
1105705815 13:22966806-22966828 CCTGAAGTCCAGGCCAGCCCAGG + Intergenic
1105858718 13:24391792-24391814 CCTGAAGTCCAGGCCAGCCCAGG + Intergenic
1106483903 13:30156202-30156224 GCTGAGGACCAGGCGGGTCCTGG + Intergenic
1111129513 13:83956191-83956213 ACTGAAGCCCAGGCCGGGTGCGG - Intergenic
1111396321 13:87672712-87672734 TCTCAAGCCCAGGCAGGGCGAGG - Exonic
1111698378 13:91654798-91654820 GCTTAAGCCCAGGTGGGGCTTGG + Intronic
1111924249 13:94445958-94445980 CCTGGAACCCAGAGGGGGCCAGG - Intronic
1112385113 13:98932015-98932037 CCTGAAGCCCAGGCCGGGCATGG - Intronic
1112580861 13:100675105-100675127 GCTGAGGCGGAGGCGGGGCCGGG + Intergenic
1113067196 13:106384544-106384566 CCTGAAGCCAAGGAGCGGCCAGG - Intergenic
1113646304 13:111998926-111998948 CCTGAGGCCAAGGCAGTGCCCGG + Intergenic
1113794383 13:113048802-113048824 CGTGATGCCCAGGCAGTGCCTGG - Intronic
1114405509 14:22452701-22452723 CCTGAGGCAGAGGCTGGGCCAGG - Intergenic
1115102546 14:29720489-29720511 CCTGAAGCCCAAGCCGAGCACGG + Intronic
1117575261 14:57091363-57091385 CCAGAAGCCCAGGCGCTTCCTGG + Intergenic
1119386633 14:74261430-74261452 CCTGCAGACCTGGCTGGGCCTGG + Exonic
1119456858 14:74763571-74763593 CCTGAGGCCTCGCCGGGGCCCGG + Exonic
1119480616 14:74955608-74955630 CCTGAAACCCAGGCGCGGACCGG - Exonic
1121439881 14:93941940-93941962 CCTGAAGCCCAGGCTTGGGGTGG + Intronic
1121444450 14:93969748-93969770 CCTGAAGGCCCTGCGGGGCCAGG - Intronic
1122152573 14:99732854-99732876 CCTGAGGCCCAGCCAGGGCCGGG + Intergenic
1122255349 14:100472205-100472227 CCTGGAGCCCCGGCTGGGCAGGG + Intronic
1122264695 14:100541130-100541152 CCTCAGGCCCAGGCGGGCGCTGG + Intronic
1122378651 14:101286213-101286235 CCTGAAGTCCAGGAGGAGCCCGG + Intergenic
1122647965 14:103207463-103207485 CCGGCAGCCCTGGCGGGGCGCGG - Intergenic
1122650265 14:103222116-103222138 CCAGAAGCCGGGGCGGTGCCCGG - Intergenic
1122658559 14:103279197-103279219 CCGGCAGCCCTGGCGGGGCGCGG - Intergenic
1122834434 14:104424000-104424022 CCTGCTCCCCAGGCGTGGCCTGG + Intergenic
1122918066 14:104867906-104867928 ACTGAGCCCCAGGCAGGGCCTGG - Intronic
1122923956 14:104891390-104891412 CTTGAAGCCCATGAGGGACCTGG + Intronic
1123107237 14:105847663-105847685 CCCAAAGCCCAGGCCGGGCCTGG + Intergenic
1123109892 14:105861460-105861482 CCCAAAGCCCAGGCCGGGCCTGG + Intergenic
1123467062 15:20525266-20525288 CCCAAAGCCCAGGAGGGTCCAGG + Intergenic
1123651053 15:22475776-22475798 CCCAAAGCCCAGGAGGGTCCAGG - Intergenic
1123741461 15:23284618-23284640 CCCAAAGCCCAGGAGGGTCCAGG - Intergenic
1123745536 15:23317940-23317962 CCCAAAGCCCAGGAGGGTCCAGG + Intergenic
1124277808 15:28341257-28341279 CCCAAAGCCCAGGAGGGTCCAGG + Intergenic
1124304893 15:28570351-28570373 CCCAAAGCCCAGGAGGGTCCAGG - Intergenic
1125884030 15:43215061-43215083 CATGCAGCCCAGGCTGGCCCAGG + Intronic
1126100736 15:45116916-45116938 CCTGAGGTCCAGGCGGTGGCTGG - Intronic
1126372728 15:47964303-47964325 CCTGAAGCTCAGGGGGAGCCAGG + Intergenic
1127267928 15:57376385-57376407 CCGGCAGCCCCGGCGGGTCCAGG + Intronic
1128999341 15:72319812-72319834 GCTGAAACCCAGGCGCGGGCCGG + Exonic
1129754972 15:78092644-78092666 CCTGGAGCTCAGCCAGGGCCTGG - Exonic
1131912631 15:97224526-97224548 GCGGAAGCCCATGCGGGGTCTGG - Intergenic
1132320120 15:100919430-100919452 CCTGAGGCGGCGGCGGGGCCGGG - Exonic
1132350081 15:101133958-101133980 GCTGCAGCTCAGGCGTGGCCTGG + Intergenic
1132356398 15:101174327-101174349 CCTGCAGCCCCTGCTGGGCCTGG - Intergenic
1132366878 15:101264284-101264306 GCTGAAGCCCAGCCCAGGCCTGG + Intergenic
1132692844 16:1189259-1189281 CCTGAAGCCCTGCCAGGGGCTGG - Intronic
1132806490 16:1777463-1777485 CCTGAACCCCAGGCAGGGAAGGG + Intronic
1132885586 16:2180747-2180769 CCTGAGGCCGACGCGGAGCCGGG - Exonic
1132968615 16:2673616-2673638 CCCCCTGCCCAGGCGGGGCCGGG - Intergenic
1132991487 16:2798105-2798127 CCTGAGGGCCCGGTGGGGCCTGG - Intergenic
1136008156 16:27345163-27345185 ACTGAGGCCCAGGCAGGGGCAGG - Intronic
1136008632 16:27348038-27348060 CCAGGGGCCCAGGCTGGGCCTGG + Intronic
1136429467 16:30188260-30188282 CCTGGAGCCCAGGGTGGGGCGGG - Intronic
1136895337 16:33993009-33993031 GCTGTAGCCCAGTCGGGGGCAGG - Intergenic
1138468266 16:57210109-57210131 ACTCTAGCCTAGGCGGGGCCGGG - Intronic
1138512224 16:57515330-57515352 CCTGCAGTCCAGGTGGGCCCCGG - Exonic
1138517068 16:57541972-57541994 CCTGAAGCCCAGAGAGGACCTGG - Intergenic
1138527922 16:57619688-57619710 CCAGGATTCCAGGCGGGGCCTGG + Intronic
1139279908 16:65761682-65761704 CCTGATACCTAGGCTGGGCCTGG - Intergenic
1139511256 16:67429866-67429888 CCTGAAACCCTGGCAGAGCCTGG + Intergenic
1140124129 16:72106169-72106191 CGTGGAGCCCGGGCGGGGGCGGG + Intronic
1140529072 16:75648434-75648456 CCTCAAGCACCTGCGGGGCCAGG + Exonic
1141172809 16:81701835-81701857 CCAGCAGGCCAGGGGGGGCCAGG + Intronic
1141684388 16:85561961-85561983 CTTGGAGCCGAGGCGGGGACGGG + Intergenic
1141805512 16:86338880-86338902 TCTGAAGCCCATGCTGGGACAGG - Intergenic
1141927041 16:87176899-87176921 CCTGAAGCCCAGGCCTGCCTCGG - Intronic
1141945234 16:87305118-87305140 CCCGAAGCCCAGCTGTGGCCCGG + Intronic
1142338988 16:89508490-89508512 CCTGGACTCCAGGCCGGGCCTGG - Exonic
1142418141 16:89954221-89954243 CCTGAGGGCCAGGCAGGGCCAGG - Exonic
1203077696 16_KI270728v1_random:1130612-1130634 GCTGTAGCCCAGTCGGGGGCAGG + Intergenic
1143542543 17:7578283-7578305 CTTTAAGCCCAGGGAGGGCCAGG - Intronic
1143631066 17:8140646-8140668 CCTGAGGCCCAAGCAGGACCCGG - Exonic
1144493948 17:15735575-15735597 CCTGAAACCCAGAGGAGGCCAGG - Exonic
1144753545 17:17666355-17666377 CCTGTAGGCCAGCAGGGGCCCGG - Intergenic
1144843464 17:18203213-18203235 TCTAAAGCACAGGTGGGGCCAGG - Intronic
1144906313 17:18641104-18641126 CCTGAAACCCAGAGGAGGCCAGG + Exonic
1144967773 17:19088972-19088994 CGGGAAGGCGAGGCGGGGCCCGG - Intergenic
1144980143 17:19163091-19163113 CGGGAAGGCGAGGCGGGGCCCGG + Intergenic
1144988079 17:19215141-19215163 CGGGAAGGCGAGGCGGGGCCCGG - Intergenic
1145056341 17:19706363-19706385 CCTGAATCCCAGCATGGGCCAGG - Intronic
1145190727 17:20841161-20841183 CCTGAGCCCAAGCCGGGGCCTGG + Intronic
1145999784 17:29124356-29124378 ACTGGAGCCCAAGGGGGGCCTGG - Intronic
1146121557 17:30200311-30200333 GCAGAAGGCCAGGCAGGGCCTGG - Intronic
1147186597 17:38716568-38716590 CCTCCAGCTCAGGCCGGGCCCGG + Exonic
1147578078 17:41613874-41613896 TCTGAGGCCCAGGTGGGGTCAGG - Intronic
1147617156 17:41836269-41836291 CCTGGAGCCCGGGCGGGGGTTGG + Intronic
1147769611 17:42858429-42858451 CCAGAAGCCCAGGCCAGGGCAGG + Intergenic
1148157202 17:45431219-45431241 CCCGAAGCCCGGGCGGGAGCGGG - Intronic
1148777141 17:50102152-50102174 CCTGAAGCCCCTCAGGGGCCTGG - Intronic
1148794702 17:50191436-50191458 CCTGAAGGCCAGGGGCGCCCTGG + Exonic
1148816116 17:50329346-50329368 CCTGTTTCCCAGGCTGGGCCAGG + Intergenic
1149309219 17:55378000-55378022 CCTGAAGCCCACGCAGGTCTGGG - Intergenic
1149772238 17:59331469-59331491 CCCCTAGCCCAGGCTGGGCCGGG + Intergenic
1149996394 17:61408211-61408233 GCTGAAACGCAGTCGGGGCCGGG - Exonic
1150250025 17:63700031-63700053 CCCGCGGCCCAGGCCGGGCCTGG - Exonic
1150358323 17:64506776-64506798 CCGGCAGCCCGGGCGGGTCCCGG - Exonic
1150634390 17:66902673-66902695 TCGGGAGCCCAGGTGGGGCCAGG + Intergenic
1151302731 17:73239809-73239831 TCTGAAGCTCAGGCCAGGCCTGG - Intronic
1151582407 17:74987870-74987892 CCGGGAGCCCACGCGGGGCCTGG - Exonic
1151819425 17:76489681-76489703 CCGGAAGCCCTCCCGGGGCCGGG + Intronic
1152091586 17:78250523-78250545 ACTGAACCCCAGGATGGGCCAGG + Intergenic
1152206649 17:78977845-78977867 GCTGCAGCCCAGGGTGGGCCAGG + Intronic
1152242479 17:79167751-79167773 CCTGGACCCCAGGTAGGGCCAGG - Intronic
1152364040 17:79844884-79844906 CCGGGTGCCCAGGCAGGGCCCGG + Intergenic
1152540216 17:80970946-80970968 CCTGATGGGCAGGCGGGGGCGGG + Intergenic
1152615757 17:81337088-81337110 ACTGAAGCTCAGGCCGGGCGGGG - Intergenic
1152621282 17:81366133-81366155 CCTGCAGCCCAGGGCAGGCCTGG - Intergenic
1152645204 17:81465534-81465556 CCTGAAGCTCCCGTGGGGCCAGG - Exonic
1153225497 18:2896731-2896753 CCTGAATCCCAGGCTGAGGCAGG - Intronic
1153842172 18:9017016-9017038 CCTGTGGCGGAGGCGGGGCCAGG + Intergenic
1153997537 18:10454862-10454884 CCTGAAGCCCCGGCCTGGCCCGG + Exonic
1154176043 18:12087719-12087741 CATGATGCCAAGGCAGGGCCAGG - Intergenic
1155963948 18:32018926-32018948 CCTGGAGCGCAGGAGGGACCCGG + Exonic
1156239707 18:35241087-35241109 CGCGAAGCCCAGGAGCGGCCAGG - Exonic
1158434718 18:57427937-57427959 ACTGAAGACGAGGCGGGGGCGGG - Intergenic
1160551577 18:79696808-79696830 CCTCAAGCACAGGAGGTGCCCGG - Intronic
1160763725 19:798004-798026 CCGGAAGCGCAGGCGGGGCTGGG + Intronic
1160842918 19:1154485-1154507 GCTGCAGCCCAGGCTGGGACCGG - Intronic
1160963863 19:1737033-1737055 GCTGAAGCCCAGGCAGGGAGTGG + Intergenic
1160995780 19:1881430-1881452 CCTGAGCCCGAGCCGGGGCCTGG - Exonic
1161288851 19:3482251-3482273 CCAGCAGCCGAGGCGGGGGCTGG + Intergenic
1161739662 19:6012975-6012997 CCAGAAGCCCAGGTGGGTGCCGG - Exonic
1162154001 19:8664460-8664482 CCTGAGGCTCAGGAGGTGCCGGG + Intergenic
1163699591 19:18780663-18780685 CCAGAAGCCCATGGGGGGCCAGG + Exonic
1163705117 19:18807984-18808006 CTCGAGGCCCAGGCAGGGCCAGG - Intergenic
1164840492 19:31389207-31389229 CCAGAGGCCCAGCAGGGGCCAGG + Intergenic
1165837993 19:38771003-38771025 GCAGAAGCCCAGGCGGGCCCGGG - Exonic
1165841572 19:38791694-38791716 GCAGAAGCCCAGGCGGGCCCGGG + Exonic
1166007538 19:39917688-39917710 CCTGCTCCCCAGGCTGGGCCAGG + Intronic
1166011937 19:39949148-39949170 CCAGTAGCCCAGGTGTGGCCTGG - Intergenic
1166310198 19:41958479-41958501 CCTGGAGACCAGGGAGGGCCAGG + Intronic
1166394183 19:42426725-42426747 CATGTAGCCCAGCCAGGGCCTGG - Exonic
1166716708 19:44973136-44973158 CCTCAGGACCAGGCGGGCCCCGG + Exonic
1166748685 19:45154274-45154296 CCTGATCCCCAGGCTGGGTCGGG + Intronic
1166891767 19:45998463-45998485 CCTGACTCCCAGGCTGGGTCAGG - Intronic
1166995101 19:46716394-46716416 CCTGGAGCCCACCCGGGACCCGG + Exonic
1167096633 19:47378005-47378027 ACTGAAGCTCAGGCAGGGGCGGG + Intronic
1167120626 19:47514484-47514506 CCTGAAGCCTTGGAGGGGACCGG - Intronic
1167636544 19:50659138-50659160 CCTGACGCCCGGGCGGGCCCCGG + Exonic
1168195425 19:54770740-54770762 CCTTCAGCCCAGGAAGGGCCTGG + Intronic
1168309010 19:55451518-55451540 CCCGCAGCCCAGGCGGCGGCCGG + Intergenic
1168402054 19:56090882-56090904 GCTGAAGCACAGGCCCGGCCCGG - Intronic
1168553713 19:57320823-57320845 CCTGCAGCCCTAGCGGGGCCCGG - Exonic
925090991 2:1155974-1155996 CCAGAAGGCCAGGCCAGGCCAGG + Intronic
926155671 2:10452597-10452619 CCTGGAGCCCAGAAGGGCCCTGG + Intergenic
927125934 2:20012521-20012543 CCGGAAGCCCGGGCGGGCCACGG + Exonic
930103093 2:47618064-47618086 CCTGAGGCCCAAGCCGTGCCAGG + Intergenic
932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG + Exonic
933829545 2:86195638-86195660 CCTGCAGCCCGGGCGCGACCCGG - Exonic
935892514 2:107694488-107694510 CCTGAAGCCCAGGTGGTGTGAGG - Intergenic
937234365 2:120421594-120421616 CCTCAGGCCCAGGCGGATCCAGG + Intergenic
937950933 2:127387641-127387663 CATGAAGCCCGGGCCGGGCGGGG + Intronic
937985385 2:127635972-127635994 CTTGGAGCCCAGGCAGGGCATGG - Intronic
937992368 2:127671777-127671799 CCTGAGCCCCAGACTGGGCCAGG - Intronic
937999342 2:127719846-127719868 CCTGAGGGCCAGGCGGGCCTTGG + Exonic
938466628 2:131529360-131529382 CCTAAAGCCCAGGCCCTGCCTGG + Intronic
940615791 2:156047563-156047585 CCTGAAAGCCACGCGGGGGCAGG + Intergenic
942292578 2:174487086-174487108 CCTGAAGGCGGGGCGGGGGCGGG - Intronic
942578680 2:177393088-177393110 CCTGCAGCACAGGCCCGGCCTGG - Intronic
944270991 2:197785483-197785505 CCTGTGGCCCAGGCGGGACCCGG - Intronic
944471086 2:200054822-200054844 CCGACAGCCCAGGCGGGGCTGGG - Intergenic
944792207 2:203142444-203142466 ACTGATGCCCAGGCTGGGCATGG - Intronic
946003095 2:216499214-216499236 CCTGGAACCCAGGCAGGCCCTGG - Intronic
946327830 2:218993746-218993768 CCCGAGGCCCAGGGGAGGCCAGG - Intergenic
946405354 2:219489381-219489403 CCTCAAGGCCAGCCAGGGCCCGG + Exonic
946843247 2:223837791-223837813 GCTGCAGCCGAGGCGGGGGCGGG - Intronic
947119704 2:226801111-226801133 CCTGAGGCCGAGGAGGGTCCCGG - Intergenic
948584800 2:239012583-239012605 CCTGGTGCCCAGGCTGGTCCAGG + Intergenic
948597548 2:239089993-239090015 GCTGAAGGTCAGTCGGGGCCTGG - Exonic
948663422 2:239520380-239520402 GCAGAGGCCCAGGTGGGGCCTGG - Intergenic
948698765 2:239747695-239747717 CCTGAATCACAGTCAGGGCCAGG + Intergenic
948840609 2:240647097-240647119 CCTGGAGCCAAGGGGGAGCCGGG - Intergenic
948864527 2:240768578-240768600 CCAGCAGCCCAGGTGGGGCATGG - Intronic
948896548 2:240930402-240930424 CCTGAGGCCCAGCCAGGGCTGGG - Intronic
948950037 2:241243518-241243540 CCTGCAGCTCAGTCGGGGCCTGG + Intronic
948950046 2:241243576-241243598 CCTGCAGCTCAGTCGGGGCCTGG + Intronic
948950053 2:241243634-241243656 CCTGCAGCTCAGTCGGAGCCTGG + Intronic
949019749 2:241734532-241734554 CCTGGAGGGCAGGCGGGGCGGGG + Intergenic
1169064715 20:2688465-2688487 CCTGAAGGTGAGGAGGGGCCCGG - Intergenic
1169137244 20:3204546-3204568 CCTGACTCGCAGCCGGGGCCGGG - Exonic
1172175311 20:32968652-32968674 CCTGAACCCTATGTGGGGCCGGG - Intergenic
1172874182 20:38154347-38154369 CCCGATTCCCAGGAGGGGCCTGG + Intronic
1173813750 20:45971909-45971931 CCTGGAGCACAGGCAGCGCCGGG - Intronic
1173893829 20:46534510-46534532 CCTTCAGGCCAGGCAGGGCCTGG + Intergenic
1174384605 20:50179674-50179696 CCTGAAGTCCAGCTGGAGCCTGG + Intergenic
1174388408 20:50200805-50200827 CCTGGAGCCCTGGCAGGGACAGG + Intergenic
1174414983 20:50360446-50360468 TCAGAATCCCAGGCTGGGCCTGG - Intergenic
1175650221 20:60715391-60715413 CCTGGATCCCAGGCAGAGCCTGG - Intergenic
1175899258 20:62353599-62353621 CCTGCGGCCCAGGCAGGGACTGG + Intronic
1176138481 20:63535253-63535275 CCTGAGGACCCGGCGGGGGCAGG + Intronic
1176254264 20:64142651-64142673 CCTGAAGCCCAGGTGAGGACAGG + Intergenic
1177255914 21:18662793-18662815 CCAGAAGCCCAGGCAGGAACAGG - Intergenic
1178367524 21:31999670-31999692 CCTGAAGGCCAGCAGGAGCCGGG + Exonic
1178697872 21:34809620-34809642 CCTGCAGTCCAGGCTGGGCATGG + Intronic
1178840718 21:36135651-36135673 GCTGAGCCCCAGGCGGGCCCGGG + Intronic
1179617902 21:42593677-42593699 CCTAAAGCCCAGGCTGGCTCTGG - Intergenic
1180046250 21:45307119-45307141 CCCGCAGCCCAGGCAGGGGCTGG + Intergenic
1180143489 21:45907041-45907063 GCTGAAGGCCAGGCGGAGGCCGG + Intronic
1180655752 22:17419161-17419183 CCTGAAGCCCCCGCGGGGTCAGG + Intronic
1180867097 22:19126007-19126029 CCTCAGGCCCAGGCTGGGGCTGG + Intergenic
1180917348 22:19498504-19498526 CCTGAGACCCAGGCAAGGCCTGG - Intronic
1181334521 22:22117872-22117894 CCTGAGCCCGAGCCGGGGCCTGG - Intergenic
1181782214 22:25201500-25201522 CCTGAGGCCCAGGAGTAGCCTGG - Intronic
1182283638 22:29231824-29231846 CATGGAGCCCAGGCGTGGGCAGG - Intronic
1182434602 22:30322274-30322296 ATTGAAGCCCAGGAAGGGCCGGG - Intronic
1183354477 22:37350916-37350938 CCTGACTCCCAGGCGGGGGAAGG - Intergenic
1183410246 22:37650688-37650710 GCTGAAGCCAAGGCTGGGGCCGG - Exonic
1183700159 22:39446490-39446512 TGTGAGGCCGAGGCGGGGCCAGG - Intergenic
1184154521 22:42658441-42658463 CCTGTTGCCCAGGCTGGTCCTGG - Intergenic
1184533452 22:45071161-45071183 CCTGATGCCCAGGCCAGGTCGGG + Intergenic
1184726257 22:46348439-46348461 CCAGAGACCCAGGCTGGGCCAGG - Intronic
1184756584 22:46519552-46519574 CCTGATGCCCAGGCTCTGCCTGG - Intronic
1185038077 22:48489940-48489962 CCTGACTCCCCGGCAGGGCCCGG + Intronic
1185340192 22:50287618-50287640 CCTGGGCCCCAGGCCGGGCCAGG - Intronic
949396076 3:3615892-3615914 CCTGAAGCCCAGTCTGTTCCTGG - Intergenic
950185890 3:10945332-10945354 CTTGTAGCCCAGGCTGAGCCAGG + Intergenic
950450131 3:13060712-13060734 CCTGGAGCCCCGCCGGGGGCAGG - Intronic
952301252 3:32106483-32106505 CCTGGAGGCCGGCCGGGGCCAGG + Intronic
952744541 3:36764552-36764574 CCTGGAGGCCGGGCGGGGCCGGG + Intergenic
953607442 3:44420909-44420931 CCTCAAGCCCAGGAGGCCCCAGG + Intergenic
954028805 3:47803431-47803453 CATGGAGCCCGGGCGGGGGCGGG + Intronic
954141448 3:48608988-48609010 CGTGAAGCCAAGGCGTGGCTAGG + Intronic
954210600 3:49094803-49094825 TCTGAGGCCCAGGCTGGGTCAGG + Intergenic
954423644 3:50432044-50432066 CCTGCAGCCCAGCCATGGCCTGG - Intronic
954615023 3:51965055-51965077 CCTGGAGCCCAGCCTGGGCCCGG - Intronic
955392135 3:58529688-58529710 TCTGAAGCCCAGGCCAGGCGAGG + Intronic
956414597 3:69013321-69013343 CCCGGAGCGCAGGCGGGCCCCGG - Intronic
956482500 3:69687330-69687352 CAGGACGCCCAGGCAGGGCCTGG - Intergenic
960625426 3:119677265-119677287 CCTGAGACTCAGGCGGGGCAGGG + Exonic
960947696 3:122978192-122978214 CCTGGGGCCCAGGTGGGGCCAGG - Intronic
961318556 3:126056963-126056985 GCTGAAGCCCACGTGGTGCCTGG + Intronic
961365883 3:126398944-126398966 CCTGCAGCCCTGGCCAGGCCAGG + Intronic
961455911 3:127023833-127023855 TCTGAAGACCAGGCGGGGGGAGG + Intronic
961459541 3:127041582-127041604 CCTCCACCCCAGGCAGGGCCAGG + Intergenic
961681783 3:128604334-128604356 TCTGATGCCCAGGCAGGTCCTGG + Intergenic
962840461 3:139227927-139227949 CCTGCAGCCCAGGTTGGGCTTGG + Intronic
962847256 3:139283520-139283542 CCCAAAGCCCAGGCAGGGCCTGG - Intronic
963121205 3:141778392-141778414 CCTGCAGCCCGGGCAGGGCCAGG - Exonic
964475087 3:157090791-157090813 ACTGAAGCCAAGGCAGGGCTGGG + Intergenic
966888843 3:184391662-184391684 CCTGGGGCTCAGGCAGGGCCTGG - Intronic
967099909 3:186207769-186207791 CCTGAGTCACAGGCAGGGCCAGG + Intronic
968441965 4:628762-628784 CAGGGAGCCCAGGCGGTGCCAGG + Intronic
968661962 4:1802354-1802376 TCTGAGGCCCAGAGGGGGCCTGG - Intronic
968700961 4:2058329-2058351 CCTGAAGGCCAGGAGGGGCTGGG - Intergenic
969156857 4:5218899-5218921 CCTGAGGCCCAGTAGGGGCCTGG - Intronic
969288386 4:6222382-6222404 CCTTCAGCACAGGCGGCGCCGGG - Intergenic
969614974 4:8247037-8247059 CCTGAAGCCCAGGCTGTCCTGGG - Intergenic
969691577 4:8706906-8706928 CCTCCAGCCCCGCCGGGGCCCGG + Intergenic
970609113 4:17709223-17709245 CCTGAAACCAAGTCGGAGCCAGG - Exonic
975689103 4:76948345-76948367 CCTGAAGCGCAGGCGAGGCAGGG + Intergenic
980416892 4:132501044-132501066 CCTGAAGTCCAGTCAGGGGCGGG - Intergenic
981128565 4:141133186-141133208 CCTCCAGCCCCGGCGGGGACGGG + Intronic
981815825 4:148829666-148829688 CCTGAAGCCTAGGTGGGGACCGG + Intergenic
982107419 4:152023159-152023181 CCTGAAGCCCAGCAGAGGTCAGG - Intergenic
983988040 4:174083900-174083922 CTTGAAGCCAAGGCAGGTCCAGG + Intergenic
983995410 4:174175946-174175968 CCTCAACCCCATGCAGGGCCCGG + Intergenic
985136819 4:186794406-186794428 CGGGAAGCCCAGGGGAGGCCTGG - Intergenic
985211983 4:187605176-187605198 ACTGAAGCCGAGCCGGGGTCGGG - Intergenic
985859070 5:2456097-2456119 CTTGATGCCCAGGAGCGGCCTGG - Intergenic
987258484 5:16180180-16180202 CCTTAAGCCCACGCGGGTCTCGG - Intronic
995433759 5:112112348-112112370 GCTGAAGTCCAGGCATGGCCAGG + Intergenic
995790829 5:115884481-115884503 CTTGAACCCCAGGCGGGGAGGGG + Intronic
997400133 5:133595913-133595935 CTTGAAGCAAAGGCAGGGCCGGG + Intronic
997513126 5:134466555-134466577 CCTCACACCCAGGCTGGGCCAGG - Intergenic
999122444 5:149219610-149219632 CCTGAATATCAGGCAGGGCCTGG - Intronic
1000195374 5:158952090-158952112 CCTGAGCTCCAGGCAGGGCCAGG + Intronic
1000359066 5:160431141-160431163 CCTGAAGCCCACACAGGGCTGGG - Intergenic
1001101180 5:168815814-168815836 CCAGCAGCCCATGCTGGGCCCGG + Intronic
1001293845 5:170485270-170485292 CCAGAGGCCCAGGCCAGGCCAGG - Intronic
1002043624 5:176530547-176530569 CCTGGAGCCCAGGTGGGGGTCGG + Intronic
1002257777 5:177971339-177971361 GCTCCAGCCCGGGCGGGGCCGGG - Intergenic
1002296291 5:178232905-178232927 CCCGGCGCCCAGGCGGGGCTCGG + Intergenic
1002721030 5:181261553-181261575 CCGGAAGCCCCGCCCGGGCCGGG + Intergenic
1002785042 6:393606-393628 GCTGAAGGCCCGGCCGGGCCCGG + Intronic
1003238777 6:4323127-4323149 ACTGAAGCCAAGGTGGGGCTGGG - Intergenic
1003524215 6:6884875-6884897 CCTTAAGCCCAGGCGGGTCTGGG + Intergenic
1003530827 6:6936233-6936255 CTTAAAGGCCAGGCAGGGCCTGG - Intergenic
1004504684 6:16238499-16238521 CCTGAGGCGGAGGCGGTGCCCGG + Intergenic
1005327756 6:24719771-24719793 CCCAAATCCCAGGCGGTGCCCGG + Exonic
1005495705 6:26385838-26385860 AGTGAAGCCCAGGCTGGGCGTGG - Intronic
1006882936 6:37354811-37354833 CGGGAAGCCGAGGCAGGGCCCGG + Intronic
1008815215 6:55556840-55556862 CCTGACTCCCAGGCTGGGCAGGG + Intronic
1018831409 6:167446446-167446468 CCTGAAGCCCTGACGGGGGCAGG + Intergenic
1018847821 6:167567338-167567360 TCTGCAGCCCAGGCGGTGGCTGG + Intergenic
1019354164 7:570253-570275 CCTGAGGCCAAGGGTGGGCCAGG + Intronic
1019409080 7:898808-898830 CCTGAGGAGCAGGTGGGGCCAGG + Exonic
1019427098 7:983005-983027 GCTGAGGCCCTGGTGGGGCCGGG - Intergenic
1019433543 7:1010615-1010637 CCTGCAGCCCAGGGGGAGCCAGG - Intronic
1019539382 7:1544987-1545009 CCCGGAGCCCAGGCGGTGTCTGG + Exonic
1019554099 7:1620011-1620033 CCTGAGGCCCGGGCGGGGGCGGG - Intergenic
1019605376 7:1907495-1907517 CCTGAGGCCCAGGCCAAGCCAGG + Intronic
1019606102 7:1910966-1910988 CCGGAGGCCCTGGCGGGGCCTGG + Intronic
1019709466 7:2511682-2511704 CCTGAAGACAAGGCTGGGGCTGG - Intergenic
1020106801 7:5425975-5425997 CTGGAAGCCCAGGCGGGGGAAGG + Intergenic
1021180231 7:17497461-17497483 CCTGATGCCCAGGCTGAACCTGG - Intergenic
1021558554 7:21945915-21945937 CCCGGAGCACAGGCGGGCCCCGG + Exonic
1022721268 7:32943234-32943256 GCTGGAGCCGAGGCGGGGCGGGG + Intergenic
1023907220 7:44531405-44531427 CCTGAAGCCCGGGGAGGGCAGGG - Intronic
1024084323 7:45881098-45881120 CCTGAAGCCCATGCATGGTCCGG + Intergenic
1025255503 7:57381744-57381766 TCAGAATCCCAGGCTGGGCCTGG + Intergenic
1026024020 7:66731115-66731137 CCTGGAGCCATGGCTGGGCCAGG + Intronic
1026880578 7:73904597-73904619 CCTAGAGCCCAGGCTGGGCCAGG - Intergenic
1029706597 7:102279768-102279790 ACTGAGGCCCAGGCAGGGCCGGG - Intronic
1030570281 7:111213490-111213512 CCTGAAGCCCTCCAGGGGCCAGG + Intronic
1031977569 7:128103754-128103776 CCTGAGGCCCAGGAGAGGCCGGG + Intergenic
1032423205 7:131799866-131799888 CCAGATGTCCAGGCTGGGCCTGG + Intergenic
1033818385 7:145103146-145103168 CCAGAAACCCAGGCAGAGCCTGG + Intergenic
1034675646 7:152891044-152891066 TATTAAGCCCAGGCTGGGCCAGG - Intergenic
1035068462 7:156124416-156124438 CCTGAGGCCCAGGGAGGGCATGG - Intergenic
1035173268 7:157032764-157032786 CCTGGGGCTCAGGCGGGGCTTGG + Intergenic
1035456487 7:159012846-159012868 CCTGGAGCCCCAGCGGGGCCGGG - Intergenic
1037899853 8:22681566-22681588 CCTGCAGCCCAGGGCTGGCCTGG + Intergenic
1037916694 8:22777404-22777426 GCTGGAGCCCAGGGTGGGCCTGG + Intronic
1038506592 8:28090220-28090242 CCTGAAGCTTCGGCTGGGCCTGG - Intronic
1039494648 8:37971816-37971838 CCTGAGGCCCAGGCTGGGTGCGG + Intergenic
1041072235 8:54136584-54136606 CTCAAAGCCCAAGCGGGGCCGGG - Exonic
1041084078 8:54241294-54241316 CCTGTATCCCAGGCTGGGGCAGG + Intergenic
1041979627 8:63842199-63842221 CCTGGAGCCTAGGAGGGCCCAGG - Intergenic
1043439631 8:80265846-80265868 CCACAAGACCAAGCGGGGCCAGG - Intergenic
1044558479 8:93589936-93589958 AATGAAGCCCAGGCTGGGCATGG + Intergenic
1045040479 8:98219236-98219258 TCTGGAGCTCAGGAGGGGCCTGG + Intronic
1048182069 8:132204512-132204534 CCTGATGCCCAGCCAAGGCCAGG - Intronic
1049374791 8:142284281-142284303 CCTGGACCCCAGCCTGGGCCTGG + Intronic
1049403407 8:142440888-142440910 GCTGAAGCCCTGGTGGGGCTTGG + Intergenic
1049583084 8:143421519-143421541 GCTGGAGCCGAGGCCGGGCCAGG + Intronic
1049643290 8:143725127-143725149 AGTGAAGCCCAGGCGGGGGAGGG + Exonic
1049700977 8:144012428-144012450 CCTTCAGCCCAGGCAAGGCCTGG + Exonic
1049801165 8:144518089-144518111 CCTTGAGGCCAGGCAGGGCCAGG - Intronic
1051429111 9:16964045-16964067 GCAGAAGCCAAGGCAGGGCCAGG - Intergenic
1053121114 9:35548103-35548125 CCTGCAGCCATGGCCGGGCCTGG + Exonic
1053294396 9:36902576-36902598 CCTGAAGCCCAGGTGGAGAGGGG + Intronic
1053351234 9:37414624-37414646 ACAAAAGCCCAGGCAGGGCCGGG + Intergenic
1054349915 9:64012198-64012220 CCTGATGTCCAGCTGGGGCCTGG - Intergenic
1056684366 9:88747271-88747293 GCCGAAGGCCAGGCAGGGCCCGG + Intergenic
1056943132 9:90972195-90972217 CCTGAATGGCAGGCGTGGCCAGG - Intergenic
1059440935 9:114306459-114306481 CTTGAACCCCAGGCTGGACCAGG + Intronic
1060971990 9:127743581-127743603 CCTGAAGCCCGGGCAGGGAATGG + Intronic
1061769675 9:132908932-132908954 CCTGTTGCCCAGGCTGGGGCTGG + Intronic
1061840551 9:133356458-133356480 CCGGAAGCGCCCGCGGGGCCGGG - Exonic
1062094539 9:134696017-134696039 CTGGCAGCCCAGGAGGGGCCGGG - Intronic
1062529092 9:136992168-136992190 CCTGAAGCCCGCGCGGGTACCGG + Intergenic
1062536454 9:137023203-137023225 CCTGTAGCCCAGCTGGGGCCAGG - Intronic
1062745943 9:138212072-138212094 CCTGGAGCCCAGGCTGCTCCAGG + Intergenic
1203792304 EBV:158342-158364 CCTAAAGCCCACCGGGGGCCTGG - Intergenic
1186551476 X:10510540-10510562 GCTGAAACCCAGGCCGGGCGTGG + Intronic
1189334858 X:40164964-40164986 CCTGATGCCCAGGCGGCCCATGG + Intronic
1189354440 X:40300278-40300300 CCTGAGGCCCAGGCGGACCCTGG - Intergenic
1189731836 X:44029119-44029141 AGAGAAGCCCACGCGGGGCCGGG - Intergenic
1192141805 X:68652561-68652583 CCTGGAGGCCAGTCAGGGCCCGG + Intronic
1197373199 X:125649754-125649776 CCTGAGGCCCAGTCCAGGCCTGG + Intergenic
1198841892 X:140865774-140865796 CCTGATGCACTGGAGGGGCCAGG - Intergenic