ID: 915121379

View in Genome Browser
Species Human (GRCh38)
Location 1:153631626-153631648
Sequence CTGAGTCAGAGGCAAGGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 526
Summary {0: 1, 1: 0, 2: 4, 3: 53, 4: 468}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915121379_915121392 27 Left 915121379 1:153631626-153631648 CCACCCCCTTGCCTCTGACTCAG 0: 1
1: 0
2: 4
3: 53
4: 468
Right 915121392 1:153631676-153631698 TCTTCCTCTCCTCCCACCACAGG 0: 1
1: 0
2: 4
3: 71
4: 566

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915121379 Original CRISPR CTGAGTCAGAGGCAAGGGGG TGG (reversed) Intronic
900430107 1:2597362-2597384 CTGAGGCAGAGGCAAGCTGGGGG - Intronic
900989002 1:6089335-6089357 CTGTGGCAGAGGCATGGGGCAGG - Intronic
901150803 1:7099958-7099980 CTGGGGCAGAGGCCAGGGGGTGG + Intronic
901273284 1:7970452-7970474 AGGAGTCAGAGGCCAGGGTGAGG + Intronic
901501971 1:9657969-9657991 CTGTGGCTGATGCAAGGGGGGGG - Intronic
901656528 1:10772869-10772891 TCAAGTCAGAGGCGAGGGGGAGG - Intronic
901804135 1:11726972-11726994 CTGAGTCAGAGGCCCAGGTGGGG - Intergenic
902332166 1:15736029-15736051 CTAAGCCAGAGGCAAGGCAGGGG + Intergenic
903496697 1:23773233-23773255 CCGAGTCAGGGGCAGGGGAGGGG + Intergenic
903761674 1:25702903-25702925 CTGAGTCCCAGGGAAGGGTGAGG - Intronic
905015223 1:34773499-34773521 CTGGGTCGGGGGCAAGGGGAGGG + Intronic
905129038 1:35738494-35738516 ATGAGTCAGAAGCCAGGTGGAGG - Exonic
905270484 1:36784223-36784245 TTCAGTCAGAGGAAAGGGGCTGG + Intergenic
905285921 1:36880398-36880420 CTGAGTGTGAGGCAGGGGTGAGG + Intronic
906532943 1:46533758-46533780 CAGAGGCAGAGGCAGGGGGCTGG - Intergenic
906555450 1:46708603-46708625 CTTAGTCAACTGCAAGGGGGAGG + Intronic
906662576 1:47593377-47593399 CAGAGCCAGGGGCTAGGGGGAGG + Intergenic
906746428 1:48225130-48225152 CTGAGCCAGAGGGAAGCAGGGGG + Intronic
908475491 1:64483868-64483890 CAGAGTTATATGCAAGGGGGGGG - Intronic
910022836 1:82613500-82613522 CTGACTGAAAGGCAAGGGGATGG + Intergenic
910569714 1:88685079-88685101 CGGAGTCTGAGGGGAGGGGGAGG - Intronic
912577576 1:110687442-110687464 CTGAGTCAGAGGAAATGTTGAGG + Intergenic
913255739 1:116951694-116951716 CTGAGTCATAGGCACAGGGAAGG - Intronic
913971612 1:143421678-143421700 CTGGGTCAGAGGCCAGGGGCTGG - Intergenic
914044780 1:144082151-144082173 CTGAGTCAGAGAGATGGGGATGG - Intergenic
914065989 1:144247291-144247313 CTGGGTCAGAGGCCAGGGGCTGG - Intergenic
914113162 1:144719063-144719085 CTGGGTCAGAGGCCAGGGGCTGG + Intergenic
914133330 1:144878535-144878557 CTGAGTCAGAGAGATGGGGATGG + Intergenic
914619898 1:149395539-149395561 TTGAGTGAGAGGCAGGGGGTGGG - Intergenic
914705079 1:150163572-150163594 CTAGGTCAGAGGCAACGGGTTGG - Intronic
914707068 1:150179150-150179172 CAGAGGCAGTGGGAAGGGGGTGG - Intergenic
914802062 1:150969092-150969114 CTGAGTGAGGGGCAAAGGGGAGG + Exonic
914849395 1:151302913-151302935 CTGTGTCAGAATCCAGGGGGAGG - Intronic
915121379 1:153631626-153631648 CTGAGTCAGAGGCAAGGGGGTGG - Intronic
915320438 1:155053135-155053157 CTGAGTCAGAGGAAGGGCTGGGG + Intronic
915460841 1:156069897-156069919 CTGAGTGGGAGGCACTGGGGAGG - Intronic
915706599 1:157849652-157849674 CTGAGAGAGAGGCAAGAAGGAGG + Intronic
915839864 1:159205169-159205191 CTGACTCAAAGGCAAAGGGAGGG - Intronic
916058860 1:161085534-161085556 CAGATTTAGAGGGAAGGGGGTGG + Intronic
916368545 1:164061783-164061805 CTGTGTCAGTGGGAAAGGGGAGG - Intergenic
917646085 1:177029955-177029977 CCTAGTCAGAGGGAAGTGGGTGG - Intronic
920252192 1:204629122-204629144 CTGGGACAGAGGCAAGGGCGGGG + Intronic
920573073 1:207032741-207032763 CTGAGTCAGTGGCAGGGTGGGGG - Exonic
922156088 1:223040642-223040664 CAGAGTCATGGGCAAGGGGCAGG + Intergenic
922239012 1:223743303-223743325 CTGAGTCAGAGGCAGAAGGCTGG - Intronic
922942540 1:229480235-229480257 CTAAGTCTGAGGGAAGTGGGAGG + Intronic
923474127 1:234316895-234316917 TTCAGTCAAGGGCAAGGGGGAGG + Intronic
923519346 1:234724051-234724073 GAAAGTCAGAGGCGAGGGGGAGG + Intergenic
923566657 1:235081478-235081500 GTGAGGCAGAGGAAATGGGGAGG + Intergenic
923766892 1:236900856-236900878 CTAAGACAGAGGCCAGGGGATGG + Exonic
924274364 1:242370492-242370514 CTGAGCCAGGGGCCAGGGGAGGG + Intronic
924514052 1:244751606-244751628 CTGAGACAGAGGCAGAGGTGAGG - Intergenic
1063103592 10:2973332-2973354 CTGAGGCAGGGGCAAGGGGGAGG + Intergenic
1063799038 10:9550756-9550778 CTCAGAAAGAGACAAGGGGGAGG + Intergenic
1064268333 10:13843208-13843230 CTGAGTCAGAGGCTGGGAGTGGG - Intronic
1065399810 10:25286258-25286280 CAGAGTGGGAGGCAAGGGGAAGG - Intronic
1066707143 10:38192812-38192834 GGGGGTCAGAGGCAAGGGGAGGG + Intergenic
1066956902 10:42181830-42181852 CTGAGTCAGAGAGATGGGGATGG - Intergenic
1067344634 10:45428506-45428528 CTGAGTCGCAGGAAAGGGAGAGG + Intronic
1069875259 10:71559061-71559083 CTGAGTGGGAGGGAATGGGGTGG - Intronic
1070301992 10:75210573-75210595 CAGCCTCAGAGGCGAGGGGGCGG - Intronic
1070827322 10:79398872-79398894 CTGAGGCACAGGGAAGGGGTGGG + Intronic
1070976640 10:80610601-80610623 CTGGGTGAGAGGCAGGGGTGAGG - Intronic
1074144495 10:110704618-110704640 CTGTGTAAGAGGAAAGGGAGAGG + Intronic
1074667347 10:115743365-115743387 CAGAGTCAGAGGCAAGGGCAGGG - Intronic
1074919468 10:117992964-117992986 AAGAGTCAAAGGCAAGGGTGAGG + Intergenic
1075077157 10:119359179-119359201 CTGTGCCAGAGGCCAGGGGTGGG + Intronic
1075372575 10:121950385-121950407 TTGGGACAGAGGCAAGGTGGTGG + Intergenic
1075641540 10:124068145-124068167 CAGAGGCAGAGCCAAGGGGATGG + Intronic
1076682624 10:132181818-132181840 CTGGGACAGAGGCAGAGGGGCGG - Intronic
1077308262 11:1877348-1877370 CTGGGTCAGAGGCCAGGGGCTGG + Intronic
1077411296 11:2405112-2405134 CTGGCTCAGAGGCAAGGGCCAGG + Intronic
1078064270 11:8067745-8067767 CTGAGGCAGAGGCTCAGGGGAGG - Intronic
1079103255 11:17554554-17554576 CTGAGTTAGGGTCAAGGGGTTGG + Intronic
1079320567 11:19448191-19448213 CTCAGTCAGGCGCAAGGTGGGGG + Intronic
1079320750 11:19449562-19449584 CTCAGTCAGGTGCAAGGTGGGGG - Intronic
1080949484 11:37014202-37014224 CTGAATCAGAGTCAAGGAGTGGG + Intergenic
1082705176 11:56486011-56486033 CTGGGACAGAGGCAAGGGAAGGG - Intergenic
1083267594 11:61553962-61553984 CTGAGGCGGAGGGGAGGGGGTGG + Intronic
1083293311 11:61701666-61701688 CTGTGTCACAGGGAAGGGGGTGG + Intronic
1083605477 11:63976100-63976122 AGGACTCAGAGGCAAGTGGGAGG - Intronic
1083770367 11:64863771-64863793 CAGAGTCAGTGGCAGGGGGCGGG - Intronic
1083897782 11:65628796-65628818 CTGAGCCACAGTCAAGGAGGCGG - Intronic
1084045539 11:66565879-66565901 CTCAGTCACAGGCAATGTGGAGG - Exonic
1085037307 11:73308239-73308261 TTGCGGCAGAGGCAAGGGGGCGG - Intergenic
1085297154 11:75437684-75437706 CTGAGACAGGTGCAAGGTGGGGG + Intronic
1085464903 11:76716698-76716720 CTGAGTCAGAGGCCAGACTGAGG - Intergenic
1087624461 11:100581277-100581299 CTGACCCAGAGGCAAAGGGTTGG + Intergenic
1088801805 11:113313782-113313804 CTGAGTCAGTTGCCAGGTGGGGG - Intergenic
1088830005 11:113528852-113528874 CTGAGTTAGAGGCAATTGGAAGG - Intergenic
1088970831 11:114773388-114773410 TTGAGTCAAGGGCAAAGGGGCGG - Intergenic
1089178962 11:116567748-116567770 CTGAGCCAGAGGCACCGGGAGGG + Intergenic
1089413162 11:118264279-118264301 CTGAGTCACAGGCACAGGTGAGG - Exonic
1089514874 11:119026132-119026154 CTGTGTCAGAGTCCAGGGGTGGG - Intronic
1089672070 11:120063423-120063445 CTGAGTCAGAGGCAGAGACGAGG + Intergenic
1089781426 11:120875687-120875709 CTGTGTCATTGGCATGGGGGTGG - Intronic
1091198219 11:133749929-133749951 ATGAGGCAGAGGCAGGGGGGAGG - Intergenic
1091448632 12:559244-559266 ATGAGCCAGAGGCCAGGAGGAGG - Intronic
1091583236 12:1801159-1801181 CTGAGGCAGGGGCAGGGGGTGGG - Intronic
1091590253 12:1838477-1838499 CTGAGCCACAGGCCAGGGAGAGG + Intronic
1091702673 12:2674273-2674295 CTGAGCCACAGGCAGGGGGAAGG + Intronic
1091986134 12:4911171-4911193 CTGAGTGAAAGGCAGGGTGGAGG + Exonic
1092898960 12:13040634-13040656 CTATGTCAGAGTCAAGGTGGGGG - Intergenic
1096298462 12:50404614-50404636 CTGAGACCGAGGCTAGAGGGTGG + Intronic
1096408539 12:51360936-51360958 CTGAGAAAGAGGAAAGGAGGGGG - Intronic
1096691654 12:53325428-53325450 CTGGGGCAGAGGAAAGGCGGGGG - Intergenic
1096977754 12:55708907-55708929 CTGGGACAGAGGCAAGGGGGTGG + Intronic
1097180197 12:57167450-57167472 CTGAGTCAGGGGGAAGCAGGTGG - Exonic
1098147773 12:67515470-67515492 CTGTGTGATGGGCAAGGGGGTGG + Intergenic
1098306963 12:69111957-69111979 CTGAGTCAAAGGGAATGGGATGG + Intergenic
1099016370 12:77348385-77348407 CTGGAGCAGAGGGAAGGGGGAGG + Intergenic
1099772068 12:87073633-87073655 GAGAGTGAGAAGCAAGGGGGTGG - Intergenic
1099957948 12:89369627-89369649 CTGAATCAGAGGGAAGGTGAGGG - Intergenic
1099978541 12:89571649-89571671 CTGACTCAGAGGGAGGGGGAGGG + Intergenic
1101083091 12:101208995-101209017 CTGTTTCAGTGGAAAGGGGGTGG + Intronic
1101953530 12:109194590-109194612 CAGAGGCAGAGGCCAGGGGGTGG - Intronic
1102633476 12:114302195-114302217 CTGAGTCTGAGACAAGGAGGAGG - Intergenic
1103228629 12:119309187-119309209 CTGGGTCAGAGGGGAGGGGAAGG + Intergenic
1103568121 12:121827225-121827247 CTGGGTGAGAGCCAAGGAGGGGG + Intronic
1103926937 12:124428421-124428443 CTGCGTCAGAATCAAGTGGGTGG + Intronic
1104224967 12:126822655-126822677 CTGAGGCAGAGGAAGGGAGGGGG + Intergenic
1105828333 13:24142647-24142669 ATGAGGAAGAGGAAAGGGGGAGG - Intronic
1106076725 13:26466709-26466731 CTGAGTCAAAGAAAAGGTGGAGG - Intergenic
1106918299 13:34538597-34538619 CTGGGTAGGAGGGAAGGGGGTGG + Intergenic
1106976999 13:35230885-35230907 CTGAATCAGAGACTAGGGTGGGG + Intronic
1107174617 13:37386056-37386078 CTGAGTATGAGGGAAGAGGGAGG - Intergenic
1107821069 13:44286154-44286176 CAGAGTCATGGCCAAGGGGGAGG - Intergenic
1107933028 13:45322029-45322051 TTGAGTCAGTGGAAAGGGAGAGG + Intergenic
1108354972 13:49621835-49621857 CTGATTCAGAGGCAAGATGCTGG + Intergenic
1108436630 13:50407062-50407084 CTGATTCAGAGTCAAGTGAGAGG + Intronic
1110775721 13:79406030-79406052 CTGGGGAAGAGGGAAGGGGGAGG - Exonic
1111893728 13:94115324-94115346 TTATGTCAGAGGCAAGGGGTTGG + Intronic
1111974988 13:94956986-94957008 CTGAGTCAGTGGGCAGGGGCAGG - Intergenic
1113319537 13:109220496-109220518 CTTAGTCAGAGGCAATGCTGTGG + Intergenic
1113640965 13:111956403-111956425 CGGAGTCACAGGCCAGGGGGCGG + Intergenic
1114450093 14:22819683-22819705 CTGAGTCAGGGGAGAGGGGAAGG + Intronic
1114593846 14:23894276-23894298 CTTGGTCAGAGACCAGGGGGTGG - Intergenic
1115612389 14:35061319-35061341 CTGAGTGAGAGGCAGAAGGGCGG - Intronic
1116657703 14:47673455-47673477 CTGACTCAGGGGCGAGGGGTGGG + Intronic
1117398877 14:55339979-55340001 CTGAGTGGGAGTGAAGGGGGTGG - Intronic
1118666161 14:68072549-68072571 CTGAGTCAGAGGGCTGGGGAAGG - Intronic
1119181314 14:72607071-72607093 CTGAGTCAGAGGGATGGAGGAGG - Intergenic
1120861912 14:89262205-89262227 CTGAGTCACAGGCAAACTGGTGG - Intronic
1121426504 14:93856116-93856138 GTGAGGCAGAAGCAAGGGTGGGG + Intergenic
1121739864 14:96243725-96243747 CTGAGGCAGAGGAGAGTGGGTGG - Exonic
1122093076 14:99352797-99352819 CTGAGACAGAGGAGAGGAGGAGG + Intergenic
1122400755 14:101465965-101465987 CAGAGTAAGACGCATGGGGGAGG - Intergenic
1202936209 14_KI270725v1_random:89950-89972 CTGAGTCAGAGAGATGGGGATGG + Intergenic
1124880509 15:33638227-33638249 CTGGTTCAGAGGCAAAGGAGAGG + Intronic
1125726669 15:41871727-41871749 CTGAGGCAGAGCCTATGGGGTGG - Intronic
1125767853 15:42147051-42147073 ATGAGGCAGAAGCAAGGGGCGGG + Intronic
1125832698 15:42728050-42728072 CAGAGTCAGGGGCTAGGGGAGGG + Intronic
1127374296 15:58368904-58368926 GGGAGTCAGGGGCAAGGGGAGGG + Intronic
1127896164 15:63301089-63301111 CTGAATCAGAAACAATGGGGTGG - Intronic
1129060772 15:72858942-72858964 CTCAGTGACAGGCCAGGGGGTGG - Intergenic
1129152566 15:73698142-73698164 CTGAGTAAGAGGCAAGTCTGTGG - Intronic
1129394230 15:75235544-75235566 CTGTGTCAGAGGCTGGGGAGGGG - Intergenic
1129521990 15:76191923-76191945 CTGAATCAGCGGCGAGGGGCCGG - Intronic
1129672701 15:77616071-77616093 CAGGGTAAGAGGCAAGGAGGGGG - Intronic
1130006452 15:80103735-80103757 CTGAGGCAGAGGAAAAGGGTAGG - Intronic
1131562293 15:93455127-93455149 CTGAATGAGTGGGAAGGGGGTGG + Intergenic
1132692402 16:1187469-1187491 CTGAGCCAGGGGCAGGGGTGTGG - Intronic
1132769367 16:1552344-1552366 CCGAGACAGAGGCGAGCGGGAGG - Intronic
1133392800 16:5422930-5422952 ATGAGGGAGAGGGAAGGGGGAGG + Intergenic
1133801833 16:9091322-9091344 TTGCGTCCGAGCCAAGGGGGCGG - Intergenic
1133932717 16:10245179-10245201 CTGCCTCTGAGGCAAGGGGGTGG + Intergenic
1134021077 16:10922140-10922162 CGGAAACAGAGGCCAGGGGGAGG - Intronic
1135491894 16:22916461-22916483 ATGGGGCAGAGGCAAGGCGGTGG + Intergenic
1136584216 16:31173557-31173579 CTGAGTCTGGGGCAGGGGGGTGG - Intergenic
1137275222 16:46929066-46929088 CCGAGGCAGAGTCACGGGGGAGG - Exonic
1137325530 16:47431465-47431487 CAGGGTCAGAGGCCAGGTGGTGG - Intronic
1137556717 16:49474852-49474874 CAGAGTCTGTGGCAAGGGGGTGG + Intergenic
1138079649 16:54077761-54077783 CTGAGTCAGAAGGAAGAGGTAGG + Intronic
1138142773 16:54582937-54582959 CGGAGAGGGAGGCAAGGGGGCGG - Intergenic
1138200094 16:55082003-55082025 CATAGTCAGAGGCCTGGGGGTGG + Intergenic
1138382280 16:56610961-56610983 CTGGGTCAGAGGCTGGGGAGTGG + Intergenic
1138428140 16:56950285-56950307 CTCAGGCAGAGCCAAGGGGAGGG - Intergenic
1139317984 16:66089820-66089842 CTGGCTCTGAGGCAAGGAGGGGG - Intergenic
1140034930 16:71364620-71364642 CTGAGTCCCAGGCATGAGGGAGG - Intronic
1140662217 16:77198542-77198564 ATGAGACAGAGGGAAGGGAGAGG - Exonic
1140762650 16:78124873-78124895 CTGAGACAGAGAGATGGGGGCGG + Intronic
1141081964 16:81060730-81060752 CTTAGTTTGAGGCACGGGGGTGG + Intronic
1141429125 16:83961836-83961858 CTGTGCCAGAGGCACGGGGCAGG - Intronic
1141573763 16:84951100-84951122 CTGTGTCAGAGGCCAGCGGGGGG + Intergenic
1142128477 16:88421596-88421618 CTGGGGCAGAGGAAAGGGGATGG + Intergenic
1142199427 16:88754039-88754061 CTGAGTCAGCTGCAATGGGATGG + Intronic
1142209951 16:88804137-88804159 CTGAGGCGGAGGGACGGGGGCGG + Intronic
1142270413 16:89086163-89086185 CTGAGTAAGGGGCTATGGGGAGG - Intergenic
1142418612 16:89956885-89956907 CTGAGACCCAGGCAAAGGGGAGG - Intronic
1142741358 17:1933522-1933544 CTGAACCAGACGCAAGGGGCTGG + Intergenic
1142847472 17:2689241-2689263 TTGAGTGGGAGGTAAGGGGGTGG - Intergenic
1142857079 17:2737084-2737106 CAGAGTCATGGGGAAGGGGGCGG - Intergenic
1143006068 17:3835329-3835351 CTGAGACAGAGACAACGGTGAGG + Intronic
1143592295 17:7892895-7892917 CTGAGGCTGAGGCAGGAGGGTGG - Intronic
1144063234 17:11601726-11601748 CTGAGAGAGAGGAGAGGGGGTGG - Intronic
1144864481 17:18326269-18326291 CTGCTTCAGAAGCAAGGGAGGGG - Intergenic
1145980688 17:29009646-29009668 CTGACTCCGAAGCCAGGGGGTGG + Intronic
1146683714 17:34826493-34826515 ATGAGTCAGAGGCTTGGGTGGGG - Intergenic
1146930468 17:36773925-36773947 GTGAGGTAGAGGCAAGGGCGAGG - Intergenic
1146935958 17:36812904-36812926 ATGAGTGTGAGGCATGGGGGTGG - Intergenic
1146946235 17:36875620-36875642 GTGAGTCAGAGGGGAAGGGGAGG + Intergenic
1147187449 17:38720329-38720351 CTGAGGGAGGGGCGAGGGGGCGG - Intronic
1147477788 17:40729847-40729869 GGGAGACAGAGGCAGGGGGGTGG + Intergenic
1147986280 17:44309217-44309239 CTGTGTGAGGGGGAAGGGGGTGG + Intronic
1148464624 17:47857562-47857584 CTGATCCAGAGGCCAGGGGAAGG - Intergenic
1148651361 17:49252396-49252418 CTGAGTCAGGGACCAAGGGGAGG - Intergenic
1148846862 17:50534548-50534570 CTGAGTCACTAGCAAGGGGGAGG + Intronic
1149146175 17:53496438-53496460 CTGTGTCAGAAACTAGGGGGCGG - Intergenic
1149269981 17:54967601-54967623 CTGAGTCAGAAACACGGGGTGGG - Intronic
1149491455 17:57087713-57087735 CTGGGTCAGAGGCTAAGGAGAGG - Intronic
1149773822 17:59341868-59341890 CTGAGGGAGAGGAAAGGCGGTGG - Intronic
1150147224 17:62779133-62779155 CTGAGCTAGAGTCAAGAGGGCGG + Intronic
1150219296 17:63487093-63487115 CTGAGTGAGAGGCGAGGGCTGGG + Intronic
1150247296 17:63686153-63686175 ATGAGGCAGAGGCGAGGGAGTGG - Intronic
1150551038 17:66210427-66210449 CTGAGAAAGAGGCATGGGTGGGG + Intergenic
1150787392 17:68174117-68174139 CTGAGTCAAAGCCAAGGGGAAGG - Intergenic
1151419087 17:73985662-73985684 CTGGGTGAGAGGCAAGGGGCTGG - Intergenic
1151595317 17:75074845-75074867 CTGAGCCAGAGGCAGAGGGCTGG - Intergenic
1151902620 17:77026964-77026986 CAGAGTCACAGGAAAGGGTGGGG - Intergenic
1152031371 17:77845578-77845600 CTGACTGAGAGGAAAAGGGGGGG - Intergenic
1152250232 17:79208656-79208678 CAGAGGCAGAGGCAGAGGGGAGG + Intronic
1152281850 17:79389561-79389583 CTGAGGCCGAGGCAGGGTGGGGG - Intronic
1152457596 17:80425229-80425251 CTCAGTCAGAGGCAGGAGGATGG - Intronic
1152510712 17:80785683-80785705 CTCAGTCAGAGTCAAGGGGCCGG - Intronic
1152705420 17:81841164-81841186 CTGAGTCACAGCTAAAGGGGTGG - Intergenic
1155420610 18:25651578-25651600 CTGAGTCAGAGACACTGAGGTGG - Intergenic
1156180096 18:34593214-34593236 CTCAGTCAGAGGGAGCGGGGAGG + Intronic
1156271842 18:35542387-35542409 CTGAGTCTGTGGCAGTGGGGTGG + Intergenic
1156430850 18:37072760-37072782 GGGAGTCAGGGGCAAGGGGAAGG - Intronic
1156619147 18:38828195-38828217 TTGAGTCAGTGGCATGGGGAAGG - Intergenic
1157481879 18:48060414-48060436 CTGAGTCAGGAGCAAGGAAGAGG - Intronic
1157736626 18:50055239-50055261 GTGAGTCCGGGGCAGGGGGGCGG - Intronic
1158723791 18:59949740-59949762 TTGAGTCAGTGGCATGGGAGAGG + Intergenic
1158962777 18:62600506-62600528 CTGAGGCAGAGGTAGGGGGAGGG + Intergenic
1160234237 18:77073380-77073402 CTGGGTCAGAGACAAAGGGTGGG + Intronic
1160265860 18:77340426-77340448 CTGAGTGAGGTGCAAGGGAGAGG - Intergenic
1160939775 19:1614810-1614832 CTGAGTCAGAGACAGGGGATGGG + Intronic
1161455189 19:4366431-4366453 CTGTGTCAGAGGGAAGGCAGGGG - Intronic
1161646905 19:5458686-5458708 GTGAGTCAGAGGGGAGAGGGAGG + Intergenic
1161684807 19:5697490-5697512 CTGAGGCAGAGGGAGGAGGGGGG + Intronic
1162333599 19:10046321-10046343 CAGAGTCAGAGGGAAAGAGGAGG - Intergenic
1162395021 19:10412909-10412931 CTGAGTCAGAGTCAGGGGGATGG - Intronic
1162421681 19:10569001-10569023 CTGAGGCAGCCGCCAGGGGGCGG + Intronic
1162504374 19:11074331-11074353 CTGAGGCAGGGGGGAGGGGGCGG + Intergenic
1162787477 19:13044814-13044836 CTGAGTGAGAGGCAAGGGATGGG + Intronic
1163484408 19:17577468-17577490 GTGAGTCCGAGGCCTGGGGGTGG + Intronic
1163644173 19:18478957-18478979 CTGAGACAGAGGAAAGGGTGAGG + Intronic
1163745342 19:19043395-19043417 CTGGGGCAGAGGCAGGGGGCTGG + Intronic
1165386039 19:35511185-35511207 CAGAGTCAGAAGCAGTGGGGTGG + Intronic
1166250050 19:41563740-41563762 TTGAGTGAAGGGCAAGGGGGTGG + Intronic
1166567807 19:43775774-43775796 CTGGGTCTGGGGCAAGAGGGAGG + Intronic
1166813621 19:45528501-45528523 CTGAGGTAGATGGAAGGGGGCGG + Exonic
1167144339 19:47672920-47672942 CTGAGGCAGAAGCAAGGGAGAGG - Intronic
1167144503 19:47673632-47673654 TTGAGACAGAGGGCAGGGGGTGG - Intronic
1167174043 19:47853156-47853178 CTGAGACAGAGGCCAGGTGTGGG + Intergenic
1167217708 19:48175799-48175821 CTGAGAGAGAGGGATGGGGGAGG - Intronic
1167720724 19:51178592-51178614 CTGAGCCACAGGGAAGGAGGAGG - Intergenic
1167856799 19:52248520-52248542 CAGAGACAGAGGCCAGGAGGGGG + Intergenic
1168249400 19:55133219-55133241 ATGAGTCAGGGGCCAGGGTGGGG + Intronic
1168277401 19:55285273-55285295 CTGAGTCTGAGGGAGGAGGGCGG + Intronic
1168451394 19:56469309-56469331 CAGGGTCAGAGGGAAGGGTGAGG + Intronic
1168668868 19:58226325-58226347 TTGAGTCAGAGGCAGGCTGGAGG + Intergenic
1202684338 1_KI270712v1_random:35555-35577 CTGAGTCAGAGAGATGGGGATGG - Intergenic
925346214 2:3173811-3173833 CTGAGGCAGAGGCAATGGCCTGG - Intergenic
925542316 2:4979234-4979256 CTGCGTCTGAGGCAAAGGGGCGG + Intergenic
927213709 2:20653981-20654003 CTGAGTGACAAGCAAGGTGGTGG - Intergenic
928201718 2:29251463-29251485 CTGAGTCAGAGACAAAGATGGGG + Intronic
929599641 2:43197135-43197157 CTGAGTCTAAGACAAGGGGCTGG - Intergenic
929777725 2:44939084-44939106 CTGGGGCAGAGGCTGGGGGGCGG + Intergenic
929915358 2:46131214-46131236 TGGAGTCAGAGGCAGGGGTGAGG + Intronic
929971441 2:46580583-46580605 CTGGGTAAGAGGCACAGGGGAGG - Intronic
930002505 2:46870606-46870628 CTGACTCAGAGGCAGAGGGGTGG + Intergenic
930154771 2:48094719-48094741 CTGAGGCAGAGGCAAGAGCATGG + Intergenic
931636498 2:64345117-64345139 CAGAGTCAGAGGCATGAGTGTGG - Intergenic
932153621 2:69395263-69395285 CTGAGTCAGAAGCCAGTGGGAGG + Intergenic
932215271 2:69962291-69962313 CTGATTCAGAGGCAGAGGGGTGG + Intergenic
932305966 2:70704534-70704556 CTGACCCAGGGGCAAGGGGTGGG - Intronic
932771491 2:74503093-74503115 CTGAGTCAAAGGAGAGGTGGCGG - Intronic
933557430 2:83848596-83848618 GTGAGTCTGGGGCAAGGGGAGGG - Intergenic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
934159101 2:89231107-89231129 TTGAGTTAGGGGCAAGAGGGAGG + Intergenic
934176308 2:89582611-89582633 CTGGGTCAGAGGCCAGGGGCTGG - Intergenic
934208171 2:89951318-89951340 TTGAGTTAGGGGCAAGAGGGAGG - Intergenic
934247380 2:90319291-90319313 CTGAGTCAGAGAGATGGGGATGG + Intergenic
934261945 2:91483312-91483334 CTGAGTCAGAGAGATGGGGATGG - Intergenic
934286618 2:91656972-91656994 CTGGGTCAGAGGCCAGGGGCTGG - Intergenic
934304985 2:91814300-91814322 CTGAGTCAGAGAGATGGGGATGG - Intergenic
934328272 2:92038448-92038470 CTGAGTCAGAGAGATGGGGATGG + Intergenic
934466652 2:94268989-94269011 CTGAGTCAGAGAGATGGGGATGG + Intergenic
934711089 2:96514623-96514645 CTAAGTCAGAGGCTACTGGGTGG + Intergenic
935236120 2:101139569-101139591 CTGAGGCATGGGCAAGGGGCAGG - Intronic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936500834 2:113065045-113065067 CTGAGGCACTGGCAAGGAGGTGG + Intronic
936606038 2:113955456-113955478 CTGTCTCAGAGGAAAGGGGTTGG - Intronic
937313483 2:120916410-120916432 CAGAGCCAGAAGGAAGGGGGAGG - Intronic
937345531 2:121123264-121123286 CTTCCTCAGAGACAAGGGGGTGG + Intergenic
937446610 2:121963496-121963518 CTGGGTCAGTGGCTGGGGGGAGG + Intergenic
937467567 2:122148087-122148109 CTTAGACAGAGGCTAGGAGGTGG + Intergenic
937472564 2:122186680-122186702 CTGAGTCAGGGGGATTGGGGTGG - Intergenic
938072127 2:128314312-128314334 CTGAGTCACAGGGAAAGGGCAGG + Intronic
938463472 2:131512287-131512309 CTGCGTGTGAGGCAGGGGGGTGG + Intergenic
938930722 2:136084319-136084341 CAGAGACAGAGGCAAGGGAGAGG - Intergenic
940847476 2:158657178-158657200 CTGAGTAAGAGGAAAGTAGGTGG - Intronic
940856293 2:158730899-158730921 AGGAGTGAGAGGCCAGGGGGAGG - Intergenic
944505364 2:200405186-200405208 CTGATTCAGAGGCTTGGGGTGGG - Intronic
944542598 2:200767736-200767758 CAGACTCAGAGGCAAGGCAGGGG + Intergenic
945096833 2:206228497-206228519 GAGAGTTAGAGGAAAGGGGGTGG + Intergenic
945417272 2:209590005-209590027 CTGAGTTAGGGTCAAGGTGGAGG + Intronic
945868125 2:215199435-215199457 CTGAGACAGAGGCTGGTGGGTGG + Intergenic
945990722 2:216393280-216393302 CAGAGGCTGAGGCAAGGGAGGGG + Intergenic
946133189 2:217623403-217623425 CTGATTCAGAGGCTGGGTGGAGG - Intronic
946247146 2:218394403-218394425 CTGAGTCTGAGGCGAGAGTGAGG - Intronic
946252933 2:218424352-218424374 GTGAGTCAGGGGCAGGGGAGGGG + Intronic
946406756 2:219496023-219496045 CTGAGTCAGAGGGAGGCGGATGG + Intronic
946413170 2:219525835-219525857 CTAAGAGAGAGGCATGGGGGTGG + Intronic
947077059 2:226355995-226356017 AAGAGACAGAGGGAAGGGGGAGG + Intergenic
947731263 2:232432908-232432930 CAGAGGCAGAGGCAAAGTGGGGG + Intergenic
947739961 2:232480527-232480549 CTGGGTGGGGGGCAAGGGGGCGG - Intronic
947810198 2:232999360-232999382 CTGGGTCAGAGACAAGGGGAGGG - Intronic
948611197 2:239168106-239168128 CTTCCTCAGAGGCAAGGGGGTGG - Intronic
948710844 2:239824640-239824662 CAGAGCCAGAAGGAAGGGGGAGG - Intergenic
1168751940 20:288732-288754 CTTACTCAGAGGCAATGAGGTGG + Intronic
1168766031 20:381910-381932 GTGAGGCAGAGGGAAGGAGGTGG - Intronic
1169302397 20:4455533-4455555 GTGACTCAGAGGAAAGGTGGAGG - Intergenic
1170155890 20:13269071-13269093 CTGGGTCAGAGGCACTGTGGTGG + Intronic
1170556701 20:17520623-17520645 CTGAGGCAGAGGCAAGAGAGAGG - Intronic
1170575296 20:17658182-17658204 CTGAGCCTGAGTCAAGGGGCAGG - Intronic
1170724704 20:18916039-18916061 CTGAGTCAGAGAAAAGGAGTGGG + Intergenic
1170935522 20:20805859-20805881 CTCAGTGAGAGACAAGTGGGTGG + Intergenic
1172184807 20:33024738-33024760 CTGAGAGAGTGGCAAGGGGCAGG + Intergenic
1173864034 20:46302941-46302963 CTGGGTCTGAGGCATGGAGGGGG - Intronic
1173883702 20:46438607-46438629 CTGTCTCAGAGGCCAGGGAGGGG - Intergenic
1173941263 20:46913337-46913359 CTGAGTGAGAGGAGAGGGGCAGG + Intronic
1174046786 20:47739441-47739463 CTGAGGCAGGGGCCAGGAGGTGG - Intronic
1174181777 20:48679617-48679639 CTGAGTCAGAGTCACAGGGGCGG + Intronic
1174300086 20:49575517-49575539 CTGAATCAGAGGCAGAGGGTTGG + Intergenic
1174364861 20:50050524-50050546 CCAAGTCAGAGGGAAGGGAGGGG + Intergenic
1174861148 20:54092479-54092501 CTGAGCTAGAGGCAGGTGGGTGG - Intergenic
1175260738 20:57672648-57672670 CTGGGGCAGAGGCAGGGAGGTGG + Intronic
1175370339 20:58483942-58483964 CTGAGGCAGAGGCCAGGGGAGGG + Intronic
1176103136 20:63373598-63373620 CAGAGGCAGAGGCAGGGGCGAGG - Intronic
1176587291 21:8599654-8599676 CTGAGTCAGAGAGATGGGGATGG - Intergenic
1177999967 21:28150050-28150072 CTGAGAAAGAAGCAAGGGAGAGG + Intergenic
1180065457 21:45410030-45410052 CTGAGTCAGATGAAATGTGGAGG + Intronic
1180270122 22:10576651-10576673 CTGAGTCAGAGAGATGGGGATGG - Intergenic
1180280560 22:10689626-10689648 CTGAGTCAGAGAGATGGGGATGG + Intergenic
1180587781 22:16908163-16908185 CTGAGTCAGAGAGATGGGGATGG + Intergenic
1182302720 22:29346735-29346757 CTGAGACAGAGGGAAGAGGCTGG + Intronic
1182935514 22:34218302-34218324 AGGAGTCAGAGGCAGGAGGGTGG - Intergenic
1183035582 22:35138691-35138713 CTGACTCAGAGGCTATGGGAAGG + Intergenic
1183884539 22:40867307-40867329 CCTAGTGAGCGGCAAGGGGGAGG - Intronic
1184122068 22:42458164-42458186 CTCAGTCAGTGGGAAGGGAGAGG - Intergenic
1184466007 22:44669119-44669141 CAGAGATAGAGGGAAGGGGGCGG - Intronic
1184653836 22:45931496-45931518 GTGAGTCAGAGGCACAGAGGGGG - Intronic
1184924267 22:47626198-47626220 CACAGGCAGTGGCAAGGGGGTGG + Intergenic
949611570 3:5708402-5708424 CTGAGGCCGCTGCAAGGGGGTGG + Intergenic
950043952 3:9937992-9938014 CTGAGGCAGGGGCAGGGTGGAGG - Intronic
950121511 3:10485091-10485113 GGGAGACAGAGGCAAGGGGCAGG + Intronic
952329645 3:32352446-32352468 CTGAATCACAGGCAAGCGGTAGG + Intronic
952953661 3:38543603-38543625 CTGAGAGTGAGGCAAGGGTGTGG - Intergenic
953044316 3:39281380-39281402 GGGAGTCAGAGGCAAGGAAGGGG - Intronic
954216135 3:49125502-49125524 CTGAGCCAGAGCCAGGGGAGGGG + Intronic
954405509 3:50343007-50343029 CTGAGAGAGAGGCTAGGGGCAGG + Exonic
956743247 3:72291390-72291412 CTGAGTCAGAGCCAACACGGTGG + Intergenic
956906696 3:73773362-73773384 CTGACTCAGAGGGAAGCTGGAGG + Intergenic
957585911 3:82131716-82131738 CTGAGCCAGAGGAAAAGAGGTGG - Intergenic
957959243 3:87227707-87227729 GTGAGTCAGAAGCAAGAGGGAGG - Intronic
958136383 3:89499253-89499275 CAGAGGCAGAGACAAGGGGGTGG + Intergenic
959660527 3:108863235-108863257 TTGGGTAAGAGGCAAGGGTGAGG - Intergenic
961359175 3:126356798-126356820 CAGTGTCGGGGGCAAGGGGGGGG - Intronic
963273446 3:143307842-143307864 CTGAGTCACAGGCATGGGGCTGG - Intronic
964479544 3:157127968-157127990 CTGACCCACAGGCAAGGGGGAGG - Intergenic
964774045 3:160255874-160255896 CTGGGTCAAAGACAAGGGTGTGG + Intronic
965498253 3:169425103-169425125 CTGAGGCACATGCAAGTGGGGGG - Intronic
967040608 3:185688983-185689005 CTGAGTCAGAGCCCTGGGGGTGG - Intronic
968064602 3:195751547-195751569 ATGTGTCAGAGGCAAGGTAGGGG - Intronic
968401144 4:298760-298782 CTAACTCTGAGGCAAGGGGAAGG + Intronic
968511204 4:996715-996737 CTGAGGCAGAGACACGTGGGAGG - Intronic
968754017 4:2405592-2405614 CTAGGTCAGAGGGAAGGGGCCGG + Intronic
968902234 4:3437150-3437172 CTGAGTCACAGGCCTGGGGCTGG + Intronic
968970893 4:3793196-3793218 CTGAGGGAGAGGCAGAGGGGAGG - Intergenic
969596271 4:8150999-8151021 CTGAGTGAGAGTCAAGGGCCTGG - Intronic
969701008 4:8767852-8767874 TTGAGCCAGGGGCCAGGGGGTGG - Intergenic
971417949 4:26450806-26450828 GAGGGTCAGAGGCAAGGGGAGGG + Intergenic
971438821 4:26657226-26657248 GGGGGTCAGAGGCAAGGGGAGGG - Intronic
973808614 4:54548929-54548951 CTGAGTTACAGGTAAGAGGGGGG + Intergenic
974932826 4:68378797-68378819 CTGGGGCAGAGGCATGGGGCAGG + Intergenic
976123545 4:81808640-81808662 CTGAGTCAGGGGCTTGAGGGAGG - Intronic
976166021 4:82255818-82255840 CTGAGCTAGAGTCAAGGGGTGGG - Intergenic
978408818 4:108407187-108407209 CAGAGCCAGAGAGAAGGGGGAGG + Intergenic
978709342 4:111759116-111759138 GTGGGGCAGGGGCAAGGGGGAGG + Intergenic
979942256 4:126776534-126776556 ATGTGGCAGAGGCGAGGGGGTGG + Intergenic
980001016 4:127488239-127488261 CTGAGGCTGAGGCAAGGAGGTGG - Intergenic
980835645 4:138188447-138188469 CTTTGACAGAGGGAAGGGGGTGG + Intronic
982854118 4:160360154-160360176 CCTAGTCAGAGGCAATAGGGAGG + Intergenic
983922820 4:173365721-173365743 CTGGTTCAGAGGAAATGGGGAGG + Intergenic
984759803 4:183353824-183353846 CTGAGCCATAGGAAAGAGGGTGG - Intergenic
985669895 5:1201831-1201853 CTGTGTCAGAGCCACGGAGGAGG + Exonic
985800687 5:2003865-2003887 CTGAGGCGGAGGAAAGAGGGGGG + Intergenic
985821773 5:2165498-2165520 CTGACTCGGAGGCCCGGGGGTGG - Intergenic
988267591 5:28972174-28972196 CTTGGTCAGAGGCAATGCGGTGG + Intergenic
989387906 5:40871614-40871636 ATAATTCAGAGGCTAGGGGGTGG + Intergenic
989591088 5:43113507-43113529 GGGAGGCTGAGGCAAGGGGGTGG + Intronic
990006200 5:50946484-50946506 CTGAGAGAGAGAGAAGGGGGAGG - Intergenic
990059609 5:51630896-51630918 GTGAGTCAGGGGGAAGGGGAGGG + Intergenic
992032761 5:72739582-72739604 CTAAGTGAGAGACGAGGGGGTGG - Intergenic
992744063 5:79801962-79801984 CTGACTCTGTGGCAAGGGGACGG + Intergenic
996443606 5:123518746-123518768 CTGAGTTAGATGGAAGAGGGAGG + Intronic
997200693 5:132008425-132008447 CTAAGGCAGAGGCCAGGGGTGGG + Intronic
997213902 5:132094821-132094843 CTGGGCCAGAGGCCAGGGTGGGG + Intergenic
997437379 5:133885257-133885279 CTGACTCACAGGGAAGCGGGGGG - Intergenic
998397024 5:141825276-141825298 TGCAGTCAGAGGGAAGGGGGTGG + Intergenic
998759242 5:145413699-145413721 CAGGGTCTGAGGGAAGGGGGTGG - Intergenic
999770315 5:154770556-154770578 CTGAGACACAGGCAAGGGCATGG + Intronic
1000349539 5:160342536-160342558 CTGCGTCAGAGGGAAGATGGTGG + Intronic
1002017505 5:176336803-176336825 CAGAGACAGAGGCAGGCGGGTGG - Exonic
1003426026 6:5999053-5999075 CTGCGGCAGCGGCAACGGGGCGG - Exonic
1003533970 6:6959867-6959889 GTGAGCCAGAGGGAATGGGGTGG + Intergenic
1003790028 6:9535968-9535990 CTGAGGCAGAGGCAAGAGAATGG - Intergenic
1003963147 6:11228060-11228082 GTGTGTGGGAGGCAAGGGGGCGG + Intronic
1004053976 6:12115833-12115855 CTGAGGCAGAGGCTCGCGGGGGG + Intronic
1006326600 6:33358657-33358679 CTAAGTCAGTGGCAATAGGGAGG - Intergenic
1006400957 6:33817083-33817105 CTGACTGAGAGGCAAGGAGATGG + Intergenic
1006746046 6:36342728-36342750 ATGACTAAGTGGCAAGGGGGAGG + Intergenic
1007227611 6:40325944-40325966 CTCAGACAGAGGAAATGGGGAGG - Intergenic
1007511531 6:42378027-42378049 CTGGGTAAGAGGCAAGGGATTGG + Intronic
1007790249 6:44304571-44304593 CTGAGTGGGAGCCAAGGGGAGGG - Intronic
1010175987 6:73028478-73028500 CTGGGTCAGAGTGAACGGGGTGG - Intronic
1013591851 6:111625562-111625584 CAGAGTAAGAGGCAGGCGGGCGG - Intergenic
1014281299 6:119445126-119445148 GTGAGTAAGATGTAAGGGGGAGG - Intergenic
1014558231 6:122859193-122859215 CAGTGTCAGCAGCAAGGGGGAGG - Intergenic
1014707996 6:124772184-124772206 CTGAGGCAGTGGCAATGAGGTGG + Intronic
1014709104 6:124785686-124785708 ATCAGTCAGAGGCTAGTGGGGGG - Intronic
1016325710 6:142898806-142898828 CTGAGTCAGTGTGAAGGGTGAGG - Intronic
1017232349 6:152086661-152086683 CTGAATCAGAGGCATGTGGTTGG + Intronic
1018474543 6:164127367-164127389 CAGAGGCAGAGGCAGGGGTGGGG - Intergenic
1018867115 6:167754854-167754876 CTGAGTCGGAGGACAGGGGCAGG + Intergenic
1019610351 7:1933586-1933608 CTCAGCCAGAGGCCTGGGGGCGG - Intronic
1021731679 7:23601280-23601302 CTGAGGCAGGGGCAAGGGTGGGG + Intronic
1021792261 7:24217598-24217620 CTCACTCAGATTCAAGGGGGAGG - Intergenic
1022015330 7:26344454-26344476 CAGAGGCAGAGGCCAGGTGGTGG - Intronic
1022291419 7:29007772-29007794 CACAGTCAGAGGCAAAGGAGAGG + Intronic
1022488600 7:30799665-30799687 CTGAGTCAGAAGTTTGGGGGTGG + Intronic
1022856969 7:34324328-34324350 CTAGGTCAGAGGCAAGGCAGTGG - Intergenic
1023989274 7:45118513-45118535 CTGAGGCAGAGGAATGGGGCAGG + Intergenic
1024914122 7:54479859-54479881 CTGGAACAGAGGCAAGGGGAAGG + Intergenic
1024966535 7:55026969-55026991 CTTACTCAGAGGCCAGGGTGGGG - Intronic
1025150308 7:56542039-56542061 CTGAGTCAGAGAAAAATGGGAGG - Intergenic
1026633997 7:72065373-72065395 CTGGGGCAGGGGCAGGGGGGCGG - Intronic
1026651915 7:72223100-72223122 CTGGGACACAGGCAAGGGAGTGG + Intronic
1028319323 7:89439391-89439413 AAGAGACAGAGACAAGGGGGTGG - Intergenic
1028801649 7:94972463-94972485 CTGAGTCAGGGCCAAGGTAGAGG - Intronic
1029513469 7:101011217-101011239 CTGAGCCAGGGGCAAGGTTGGGG - Intronic
1031586314 7:123535020-123535042 AGGAGCCAGAGGCGAGGGGGCGG + Intronic
1031737832 7:125389051-125389073 CTGAGTCAGAGGCAAGGAGAAGG - Intergenic
1032950184 7:136900197-136900219 CTGACTCAGAGCCAAGGGTTGGG - Intronic
1033565526 7:142574905-142574927 CAGAGGCAGAGGCAGGGGGAGGG - Intergenic
1034202978 7:149294097-149294119 CTGGGTGAGAGGCAAAGAGGAGG + Intronic
1034396505 7:150829689-150829711 GTGAGTCTGGGGAAAGGGGGAGG - Intronic
1034406808 7:150909392-150909414 CTGAGGCAGAGGCAAGGGGCTGG + Intergenic
1034777265 7:153839793-153839815 CTGAATCAGAAACAGGGGGGCGG - Intergenic
1034936480 7:155203690-155203712 CTGAGTCGGCGGCAAGGAGCAGG + Intergenic
1035070398 7:156140485-156140507 CTGAGGCAGAGAGAAGGGGAAGG + Intergenic
1035381842 7:158445572-158445594 CTGGGGCAGAGGCGAGGGGTGGG - Intronic
1035848148 8:2887018-2887040 GTGGGTCAGAGGCAAGGCAGAGG + Intergenic
1036699238 8:11000976-11000998 CTGAATCAGAGGAAGGGGGCAGG - Intronic
1038515347 8:28183205-28183227 CTGGGGCAGAGGCAGAGGGGAGG + Intronic
1039143442 8:34419011-34419033 CAGAGGCAGAGGCAATGGGCAGG + Intergenic
1040918393 8:52587488-52587510 CTGAGTCAGAAGCCTGGGGTGGG + Intergenic
1041352354 8:56960403-56960425 CTGTGTCAGAGGGAGAGGGGTGG - Exonic
1041758442 8:61338775-61338797 CTGAGCCAGAGCCAGGGGGCAGG - Intronic
1044584693 8:93858863-93858885 CTGAGTCAGAAGCATGGGGTGGG - Intronic
1045646834 8:104307616-104307638 CTGGGTAAGAGGCCAGGGAGTGG - Intergenic
1046885681 8:119364408-119364430 CTGAGAAAGGGGAAAGGGGGAGG - Intergenic
1047127264 8:121976207-121976229 CTCAGTGAGTGGCATGGGGGTGG - Intergenic
1047234292 8:123025722-123025744 CTGAGTCAGAGGCTATGGAAAGG - Intronic
1048521500 8:135159688-135159710 TTGAGTCAGTGGACAGGGGGAGG + Intergenic
1048650208 8:136467708-136467730 CTGGGGCAGAGGCAAGAGGAAGG + Intergenic
1049400354 8:142423958-142423980 CTGAGCCAGAGGGCAGGGGTGGG + Intergenic
1049644509 8:143730075-143730097 CTGGGCTAGAGGCACGGGGGTGG - Intronic
1049700996 8:144012490-144012512 CTGGGGCAGTGGCAAGGGTGCGG - Exonic
1050175582 9:2866580-2866602 GTGAGTCAGAGGAGAGGGGAGGG + Intergenic
1053696707 9:40645784-40645806 CTGAGTCAGAGAGATGGGGATGG + Intergenic
1053943122 9:43275972-43275994 CTGAGTCAGAGAGATGGGGATGG + Intergenic
1054206127 9:62131476-62131498 CTGAGGAAGAGGCAAAGGGAGGG - Intergenic
1054307957 9:63445015-63445037 CTGAGTCAGAGAGATGGGGATGG + Intergenic
1054406686 9:64769013-64769035 CTGAGTCAGAGAGATGGGGATGG + Intergenic
1054440313 9:65254473-65254495 CTGAGTCAGAGAGATGGGGATGG + Intergenic
1054490094 9:65767465-65767487 CTGAGTCAGAGAGATGGGGATGG - Intergenic
1054632231 9:67456891-67456913 CTGAGGAAGAGGCAAAGGGAGGG + Intergenic
1055809160 9:80131541-80131563 CTGTCTCAGAAGAAAGGGGGTGG + Intergenic
1056520300 9:87395160-87395182 CTGTGTGAGAGGCAGGGGAGAGG - Intergenic
1058255426 9:102756482-102756504 CTGAGTCACAGGCATGGTGAAGG - Intergenic
1058802729 9:108560593-108560615 CTGAGGCAGAAGGAAGGGTGAGG - Intergenic
1059802592 9:117765227-117765249 CTGAATCAGAAGCACCGGGGTGG - Intergenic
1060009678 9:120032544-120032566 ATGAGTCAGTGGCAAGGGCTGGG - Intergenic
1060150910 9:121287454-121287476 CAGACTCAGAGGCTAGGGGTGGG + Intronic
1060522083 9:124299659-124299681 CTGAGGCAGAGGCAGGGGTGGGG + Intronic
1060698780 9:125732480-125732502 GTGAGGCAGAGGCACGGAGGAGG - Intergenic
1061601050 9:131670366-131670388 CTGCGTCAGAAGCGAGGGTGGGG - Intronic
1061716240 9:132520133-132520155 CTGAGTGAGAGGAGAGGGGAGGG - Intronic
1061865568 9:133490366-133490388 CTGAGACCGAGGCAGGAGGGTGG + Intergenic
1062026822 9:134344400-134344422 CTGAGTCAGGAGCAAAGGGGCGG - Intronic
1062137082 9:134934887-134934909 CTGGGACAGAGGAAAGGGGAAGG - Intergenic
1062243763 9:135552996-135553018 GGGAGGCAGAGGCATGGGGGCGG - Intergenic
1062381385 9:136288466-136288488 CTGGCTCAGAGGCCAGGGAGGGG - Intronic
1062682939 9:137792919-137792941 GTGCGTGACAGGCAAGGGGGTGG - Intronic
1202779158 9_KI270717v1_random:19429-19451 CTGAGTCAGAGAGATGGGGATGG + Intergenic
1203586217 Un_KI270747v1:5831-5853 CTGAGTCAGAGAGATGGGGATGG + Intergenic
1203617250 Un_KI270749v1:77366-77388 CTGAGTCAGAGAGATGGGGATGG - Intergenic
1186512330 X:10139205-10139227 AGGAGACAGAGGCCAGGGGGTGG - Intronic
1189169670 X:38897024-38897046 CTTAGTGAGAGACAAGGAGGTGG + Intergenic
1192240346 X:69323397-69323419 CTGAGGCAGAGGCAAGGTGAGGG + Intergenic
1192362172 X:70446897-70446919 CTCACTCAGAGGCAAAGGTGGGG + Intronic
1194989929 X:100536615-100536637 CTGAGTCAGGGGTGTGGGGGTGG + Intergenic
1195886111 X:109639335-109639357 CTGAGGCAGAGGAAATGGGGAGG + Intronic
1196256239 X:113522449-113522471 CTGAGTCAAAGCCATGGTGGTGG + Intergenic
1201194432 Y:11477735-11477757 CTGAGTCAGAGAGATGGGGATGG + Intergenic
1201858683 Y:18572133-18572155 TTCAGTCACAGGCATGGGGGAGG - Intronic
1201874638 Y:18748248-18748270 TTCAGTCACAGGCATGGGGGAGG + Intronic