ID: 915121565

View in Genome Browser
Species Human (GRCh38)
Location 1:153632675-153632697
Sequence CAGCATCCTTACCCATGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 127}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915121565 Original CRISPR CAGCATCCTTACCCATGTGA GGG (reversed) Intronic
901114102 1:6827298-6827320 CAGCACCCTTTCCCTTGGGATGG + Intronic
903134411 1:21300116-21300138 CAGCATCCTGGCCCATGCCATGG - Intronic
905541859 1:38766266-38766288 CAGGCTCCTTGCCCCTGTGAAGG - Intergenic
910207666 1:84764383-84764405 CAGCATGCTTCCCAGTGTGAGGG + Intergenic
910827829 1:91428252-91428274 CAGCTTCCTTAACACTGTGAGGG + Intergenic
912374674 1:109200619-109200641 CAGTCTCCTTACCCATGGCATGG + Intronic
914397722 1:147286710-147286732 CAACTTCCTTATCCATATGATGG + Intronic
915121565 1:153632675-153632697 CAGCATCCTTACCCATGTGAGGG - Intronic
916549729 1:165838656-165838678 CAGCAATCTTATCCAGGTGATGG - Intronic
916871393 1:168918322-168918344 CTGCTTCTTTAGCCATGTGATGG - Intergenic
920205581 1:204288593-204288615 CAGCATCCCTAGCCCTGGGATGG + Intronic
924784255 1:247180758-247180780 CATCCTCCTTAACCATGTGGTGG + Intergenic
1067761295 10:49049064-49049086 CAGAACCCTTTCCCAGGTGATGG - Intronic
1068237432 10:54256601-54256623 CAGCAGCCTTACACATATAATGG - Intronic
1071121960 10:82288500-82288522 CAGCATCCTGGCCCATGTTCAGG - Intronic
1076169207 10:128305931-128305953 AAGGATCATGACCCATGTGAAGG - Intergenic
1078955831 11:16193918-16193940 CAGCCTCCTCACACATCTGATGG + Intronic
1081965167 11:47164995-47165017 CAGCCTCTTTCCCCATGGGACGG + Exonic
1083152014 11:60797917-60797939 CACCATCCTTACCGATGGGGAGG - Intronic
1084274650 11:68045113-68045135 CGGCATCCTTACCCGTGTCCTGG + Intronic
1085055107 11:73398770-73398792 CAGCCTCCTTCCCCAGGGGAAGG + Intergenic
1085517784 11:77121570-77121592 CAGCAGGCTCACCCAGGTGAAGG - Intronic
1101759939 12:107650225-107650247 CAGCTTCCTTACCCATAAAATGG + Intronic
1105316476 13:19270165-19270187 CAGCTTCCTTAGCAATGTCATGG - Intergenic
1106650875 13:31688603-31688625 CAGCCTCCTTAGCACTGTGAGGG - Intergenic
1108096844 13:46911057-46911079 CAGCATCCATATCCATGAGGTGG - Intergenic
1113067816 13:106389807-106389829 TATCATCCTTACCCATATAATGG + Intergenic
1113092956 13:106633952-106633974 AAGCATCCTTATCCATGAAATGG - Intergenic
1113768890 13:112896177-112896199 CATCATCCTCACCAAGGTGATGG + Intronic
1114589199 14:23844200-23844222 CAACATCCTTCCCCATGGTAAGG - Intergenic
1115824870 14:37258684-37258706 CAACATCCTTCACCATATGAAGG - Intronic
1117608336 14:57455121-57455143 CAGCATCCATATTCATTTGAAGG - Intergenic
1118969499 14:70621398-70621420 CAGCATCTCTACCTATGGGAGGG + Intergenic
1119481803 14:74962677-74962699 CAGCTTCCTAACCCATCTCAGGG + Intergenic
1123806245 15:23877103-23877125 AAGCAGCCTAACCCATGAGAGGG + Intergenic
1127299851 15:57642526-57642548 GAGCTTCCAGACCCATGTGAGGG - Intronic
1128420978 15:67491474-67491496 CAGCTTCCCTTCCCAGGTGATGG - Intronic
1130744435 15:86635760-86635782 CAGCATGTTGACCTATGTGATGG - Intronic
1132329384 15:101001135-101001157 CAGCATCCTTGTGCATGTAAAGG - Intronic
1135666563 16:24340593-24340615 CAGCACCCCTCCTCATGTGAAGG + Intronic
1137434929 16:48447371-48447393 CAGCACCCTTCCCCAGGTGGGGG + Intronic
1138232817 16:55351817-55351839 CAGCTTCCTTACCCTTGAGTGGG - Intergenic
1140270823 16:73464980-73465002 CAGCCTGCCTGCCCATGTGAAGG - Intergenic
1141150915 16:81564189-81564211 CAGCTTCCTTGCCTGTGTGAGGG - Intronic
1141987944 16:87592164-87592186 CAGCATCCTTGCCGGTGTGGGGG - Intergenic
1141987956 16:87592222-87592244 CAGCATCCTTGCCGGTGTGAGGG - Intergenic
1141987975 16:87592311-87592333 CAGCATCCTTGCCGGTGTGAGGG - Intergenic
1142154239 16:88525996-88526018 CAGTTTCCTCACCCATGAGATGG + Intronic
1143726374 17:8849704-8849726 AGGCATCCTCACCCATGAGAAGG + Intronic
1147625456 17:41897065-41897087 CAGCATCCTTGTCCATGGCACGG - Intronic
1149913329 17:60585984-60586006 CTACATGCTTCCCCATGTGACGG - Intronic
1150302304 17:64056626-64056648 GATCATCCCTACCCATGTGCAGG + Intronic
1150825336 17:68469615-68469637 CAACATCCTTACTCAAGAGAGGG - Intergenic
1150836764 17:68571024-68571046 AACCATCCTAACCCAGGTGATGG - Intronic
1153344766 18:4013339-4013361 CAGTTTCCTTACCTGTGTGAGGG - Intronic
1154968533 18:21383654-21383676 CAGCATCCTTTCTCATCTGCAGG + Exonic
1158158270 18:54450379-54450401 CAGCACACAAACCCATGTGAGGG - Intergenic
1158659332 18:59371900-59371922 CAGCCTCCTTAGCAATGTCAGGG + Intergenic
1161682210 19:5685927-5685949 CAACATCCTAACCCATGAGAAGG - Intronic
1163246917 19:16101788-16101810 GAAAATCCCTACCCATGTGATGG - Exonic
1164879592 19:31720849-31720871 CAGCTCCCTTACCCATGAGCTGG + Intergenic
939995198 2:148913551-148913573 CATCATACTTAGCCAAGTGAAGG + Intronic
940274798 2:151928043-151928065 CAGCAGACTTGGCCATGTGAAGG + Intronic
941764366 2:169280550-169280572 CACCATCCTTGCTCATCTGAAGG - Intronic
945898208 2:215508537-215508559 CAGCTGCCTCTCCCATGTGATGG - Intergenic
947432755 2:230045131-230045153 CGGGCTCCTTACCCATTTGAAGG - Intronic
947985537 2:234444689-234444711 AAGCATCCTTAAGCATGTTAGGG + Intergenic
948838516 2:240637622-240637644 CTCCAGCCTTACCCATCTGAGGG + Intergenic
1169183663 20:3593453-3593475 CAGCTTCCTTGTCCATATGATGG - Intronic
1170342715 20:15347257-15347279 CAGAATCCTTTGCTATGTGAAGG - Intronic
1172053845 20:32140524-32140546 CAGCATCCGTTCCTATGTCAAGG - Intronic
1172093500 20:32449462-32449484 CAGCTTCCTTCCCCATTTGGGGG - Intronic
1173016368 20:39229496-39229518 ATGCATCCTTATCCATATGAGGG - Intergenic
1175374987 20:58518001-58518023 CTGCATCCTCACCCTTGTGATGG + Intergenic
1177708403 21:24738753-24738775 CAGAATTCTTCCCAATGTGAGGG - Intergenic
1178924493 21:36763409-36763431 CAGCATCCTTGCATATCTGATGG - Intronic
1179653415 21:42830110-42830132 CTGCAGCCAAACCCATGTGATGG + Intergenic
1180140333 21:45889586-45889608 CAGCATCCTTTCCCAAGGGCGGG - Intronic
1181747915 22:24968522-24968544 CAGCATCCACACCCATGGAATGG + Intronic
949307224 3:2655892-2655914 CAGCTTCCTCCTCCATGTGATGG - Intronic
950929073 3:16771146-16771168 CAGCATCCTAACCAACCTGAGGG - Intergenic
951898546 3:27634162-27634184 GAAAATCCCTACCCATGTGATGG - Intergenic
956603816 3:71051481-71051503 CAGCATCCTCACTTAGGTGAGGG + Intronic
964883951 3:161458853-161458875 CAGCATCCTAACCCATCAGGTGG + Intergenic
965018521 3:163193262-163193284 CTGCAACCTTACTTATGTGATGG + Intergenic
966332989 3:178836089-178836111 CAGCCTCCTTTTCCTTGTGATGG - Intronic
970782349 4:19753215-19753237 CAGCATCCTTATCTATGCAATGG - Intergenic
971722134 4:30258186-30258208 CAGGATCCTTACCCATCCAATGG + Intergenic
971724319 4:30290039-30290061 CAACATCCTTCCCCATCTAATGG + Intergenic
971788263 4:31133593-31133615 CAGCAGCGGTACTCATGTGAAGG - Intronic
975190480 4:71454915-71454937 CAGCTTCTTTACTCATGTGTTGG + Intronic
980986902 4:139704406-139704428 CAGCAGCCTGACCCGTGTGCTGG + Intronic
982230206 4:153201800-153201822 CAGGATCCTAACACTTGTGAAGG + Intronic
985118811 4:186618866-186618888 CAGCATCCTTAGCCATTAAACGG + Exonic
986273374 5:6253293-6253315 CTGCATTCTAACCCATGGGAAGG + Intergenic
986414573 5:7515823-7515845 CACTATGCTTACCCATGTCAAGG + Intronic
987788813 5:22537215-22537237 CAGTATTCTTACCCAGTTGATGG - Intronic
987889622 5:23859912-23859934 CTGCATCTATACCCATGTTATGG + Intergenic
988177843 5:27750118-27750140 CAGCATCCTTGCCGCTGTGAAGG - Intergenic
990963307 5:61417425-61417447 CAGCATTTCTACCCATTTGAAGG - Intronic
992555120 5:77895622-77895644 AAACATCTTTTCCCATGTGAAGG + Intergenic
995341719 5:111068361-111068383 CAATACTCTTACCCATGTGAAGG - Intergenic
999884910 5:155911574-155911596 CAGCCACATTCCCCATGTGATGG + Intronic
1003768504 6:9269012-9269034 AAGCATCCTTACATATGTGACGG - Intergenic
1003807706 6:9744512-9744534 CAGCAGCATTTCACATGTGATGG + Intronic
1005752560 6:28896896-28896918 CACCAGCCTTGCCCATGTGGTGG - Intergenic
1008922986 6:56862249-56862271 CAGCATCCTTTCTCATTTTAAGG + Intronic
1012949974 6:105507299-105507321 TAGCACCCAAACCCATGTGATGG + Intergenic
1019149972 6:169998732-169998754 CAGCTCCCTCACCCATGGGATGG + Intergenic
1022529467 7:31057900-31057922 CAGCATCCCTCCCCATCAGAGGG - Intronic
1023288518 7:38644315-38644337 CAGCAGCCATTTCCATGTGAGGG - Intergenic
1028355713 7:89904214-89904236 CAGTTCCCTTACCCATGTGGAGG - Intergenic
1029727225 7:102415078-102415100 CCCCATTCTTACCCATGTGGAGG - Intronic
1031329425 7:120446096-120446118 AAGCATCCTTAACCATGTCCTGG + Intronic
1034079784 7:148265959-148265981 CAGCATCTTTGCTCATCTGAAGG + Intronic
1038918234 8:32051614-32051636 CAGCAACCTCAGCCAGGTGAAGG + Intronic
1041956833 8:63565686-63565708 CAGTTTCCTTAGCCATATGAGGG + Intergenic
1042466003 8:69130789-69130811 GAAAATCCCTACCCATGTGATGG - Intergenic
1043135331 8:76516229-76516251 CAGCTTCCAAACCAATGTGATGG + Intergenic
1044875958 8:96666577-96666599 CAGCATACTTTCCCATGTTCTGG - Intronic
1046175095 8:110565279-110565301 CATCATCCTTGACCATGGGATGG - Intergenic
1046759361 8:118005183-118005205 AAGCATCATTAAGCATGTGATGG - Intronic
1047990025 8:130276471-130276493 CAGCTTGCTAAGCCATGTGATGG + Intronic
1049267726 8:141678069-141678091 CAGCTTCCTGACCCATAAGATGG - Intergenic
1051067185 9:13118545-13118567 CATCATCAGTACCCATGTCAAGG - Intronic
1056650726 9:88459031-88459053 CAGCATCTTCACCCATATGGTGG - Intronic
1057066080 9:92053156-92053178 CAGCATCATTAGCCATTTGGGGG + Intronic
1057420539 9:94908600-94908622 CAGCAGCCTAAACCATTTGACGG - Intronic
1058624788 9:106923932-106923954 CTGCATCTTTATCCATGAGAAGG + Intronic
1193515009 X:82452151-82452173 CAGCAATCTTGCCCATGTAATGG + Intergenic
1194954400 X:100162357-100162379 CAGCTTCCTTAACACTGTGAGGG + Intergenic
1200249028 X:154542381-154542403 CAGCATCTTTCCCCACCTGATGG - Exonic
1200740263 Y:6846613-6846635 CAGCTTCCTTAACATTGTGAGGG + Intergenic
1201312831 Y:12612382-12612404 CAGCTTCCTTAACACTGTGAGGG - Intergenic